Starting /dee2/code/volunteer_pipeline.sh SRR7171469 current disk space = 3087330312192 free memory = 1540355548 SRR7171469 SRAfilesize 30ecffd0e020722b1ca050719ebbcc22 SRR7171469.sra SRR7171469.sra file validated SRR7171469 is paired end SRR7171469 is conventional basespace SRR7171469 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171469_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.856 32.0 25.0 33.0 18.0 33.0 2 31.16275 33.0 30.0 33.0 27.0 34.0 3 31.72725 33.0 32.0 33.0 28.0 34.0 4 31.1285 33.0 31.0 33.0 28.0 34.0 5 31.9465 33.0 32.0 33.0 30.0 34.0 6 36.692 38.0 37.0 38.0 34.0 38.0 7 36.98425 38.0 38.0 38.0 35.0 38.0 8 37.391 38.0 38.0 38.0 37.0 38.0 9 37.49675 38.0 38.0 38.0 37.0 38.0 10-14 37.50410000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.53655 38.0 38.0 38.0 38.0 38.0 20-24 37.5343 38.0 38.0 38.0 38.0 38.0 25-29 37.446549999999995 38.0 38.0 38.0 37.6 38.0 30-34 37.459050000000005 38.0 38.0 38.0 37.4 38.0 35-39 37.460300000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.3993 38.0 38.0 38.0 37.0 38.0 45-49 37.37434999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.369550000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.2775 38.0 38.0 38.0 37.0 38.0 60-64 37.1699 38.0 38.0 38.0 36.2 38.0 65-69 37.1579 38.0 38.0 38.0 36.0 38.0 70-74 37.126349999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.099999999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.9368 38.0 38.0 38.0 35.4 38.0 85-89 36.723699999999994 38.0 38.0 38.0 34.8 38.0 90-94 36.7496 38.0 38.0 38.0 34.8 38.0 95-99 36.79015 38.0 38.0 38.0 34.8 38.0 100-104 36.64025 38.0 38.0 38.0 34.2 38.0 105-109 36.4678 38.0 37.8 38.0 34.0 38.0 110-114 36.22855 38.0 37.0 38.0 33.2 38.0 115-119 36.1094 38.0 37.0 38.0 32.8 38.0 120-124 35.912549999999996 38.0 37.0 38.0 31.4 38.0 125-129 35.8851 38.0 36.6 38.0 31.6 38.0 130-134 35.714 38.0 36.0 38.0 31.2 38.0 135-139 35.5461 38.0 36.0 38.0 30.6 38.0 140-144 35.256 38.0 35.2 38.0 28.2 38.0 145-149 34.92255 38.0 35.0 38.0 27.4 38.0 150-151 32.746625 36.5 29.5 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 4.0 24 3.0 25 6.0 26 12.0 27 18.0 28 21.0 29 38.0 30 33.0 31 53.0 32 86.0 33 100.0 34 147.0 35 273.0 36 725.0 37 2480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.12544802867383 13.00563236047107 8.85816692268305 43.01075268817204 2 19.43471735867934 13.906953476738368 35.01750875437719 31.6408204102051 3 20.225 18.3 23.45 38.025 4 21.75 28.625 21.075 28.549999999999997 5 21.675 33.725 24.075 20.525 6 17.974999999999998 35.449999999999996 24.3 22.275 7 13.925 25.525 42.625 17.925 8 17.05 25.4 31.2 26.35 9 17.525 24.224999999999998 33.525 24.725 10-14 19.105 29.805 27.51 23.580000000000002 15-19 19.575 28.044999999999998 28.410000000000004 23.97 20-24 19.18 28.715000000000003 27.994999999999997 24.11 25-29 19.56 28.9 27.889999999999997 23.65 30-34 20.02 28.645 28.02 23.315 35-39 19.68 28.62 27.639999999999997 24.060000000000002 40-44 19.189999999999998 28.775000000000002 27.855 24.18 45-49 19.225 27.93 28.494999999999997 24.349999999999998 50-54 19.759999999999998 28.665000000000003 27.375 24.2 55-59 19.725 28.299999999999997 27.584999999999997 24.39 60-64 19.57 28.804999999999996 27.825 23.799999999999997 65-69 19.596959695969595 28.402840284028404 27.84278427842784 24.157415741574155 70-74 19.75598779938997 28.21141057052853 28.521426071303562 23.51117555877794 75-79 19.97 28.615000000000002 27.584999999999997 23.830000000000002 80-84 20.195 28.560000000000002 27.644999999999996 23.599999999999998 85-89 20.325 28.634999999999998 27.839999999999996 23.200000000000003 90-94 19.485 28.189999999999998 28.435 23.89 95-99 19.345000000000002 29.220000000000002 28.04 23.395 100-104 20.285 28.575 27.200000000000003 23.94 105-109 19.855 28.720000000000002 27.855 23.57 110-114 20.758113717057558 28.52427864179627 27.59913987098065 23.118467770165523 115-119 20.600150037509376 28.727181795448864 27.461865466366593 23.210802700675167 120-124 20.441022051102557 28.71643582179109 26.911345567278367 23.931196559827992 125-129 20.75 28.144999999999996 27.185 23.919999999999998 130-134 20.515 28.985 27.075 23.425 135-139 20.765 28.515 26.96 23.76 140-144 20.474999999999998 28.299999999999997 27.525 23.7 145-149 21.0 28.294999999999998 27.139999999999997 23.565 150-151 20.6375 27.5125 28.1 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 3.5 26 3.5 27 5.5 28 7.0 29 4.5 30 13.5 31 21.5 32 27.5 33 46.5 34 59.5 35 70.0 36 81.0 37 107.0 38 138.0 39 167.0 40 195.0 41 230.5 42 262.5 43 272.5 44 289.5 45 279.0 46 273.0 47 271.5 48 237.0 49 201.0 50 162.5 51 132.5 52 109.0 53 88.5 54 64.0 55 46.5 56 40.0 57 27.0 58 18.0 59 11.0 60 8.5 61 5.0 62 1.5 63 2.5 64 2.0 65 2.0 66 2.5 67 2.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.35 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.015 115-119 0.025 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.425 0.0 0.0 0.0 0.0 122-123 4.074999999999999 0.0 0.0 0.0 0.0 124-125 4.5625 0.0 0.0 0.0 0.0 126-127 5.1625 0.0 0.0 0.0 0.0 128-129 5.824999999999999 0.0 0.0 0.0 0.0 130-131 6.324999999999999 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.6125 0.0 0.0 0.0 0.0 136-137 8.0875 0.0 0.0 0.0 0.0 138-139 8.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 65 0.007646297 13.382307 140-144 >>END_MODULE SRR7171469 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171469_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82575 33.0 33.0 34.0 32.0 34.0 2 32.82975 34.0 33.0 34.0 32.0 34.0 3 32.87375 34.0 33.0 34.0 32.0 34.0 4 32.91875 34.0 33.0 34.0 32.0 34.0 5 32.9005 34.0 33.0 34.0 32.0 34.0 6 37.0265 38.0 38.0 38.0 36.0 38.0 7 37.0285 38.0 38.0 38.0 36.0 38.0 8 36.9965 38.0 38.0 38.0 36.0 38.0 9 37.0055 38.0 38.0 38.0 36.0 38.0 10-14 36.90985 38.0 38.0 38.0 36.0 38.0 15-19 36.8928 38.0 38.0 38.0 35.8 38.0 20-24 36.933949999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.90245 38.0 38.0 38.0 36.0 38.0 30-34 36.9055 38.0 38.0 38.0 36.0 38.0 35-39 36.906949999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.98905 38.0 38.0 38.0 36.0 38.0 45-49 36.94925 38.0 38.0 38.0 36.0 38.0 50-54 36.87305 38.0 38.0 38.0 35.6 38.0 55-59 36.816250000000004 38.0 38.0 38.0 35.6 38.0 60-64 36.582049999999995 38.0 38.0 38.0 34.6 38.0 65-69 36.604949999999995 38.0 38.0 38.0 34.6 38.0 70-74 36.59895 38.0 38.0 38.0 34.4 38.0 75-79 36.66285 38.0 38.0 38.0 34.6 38.0 80-84 36.57025 38.0 38.0 38.0 34.4 38.0 85-89 36.4244 38.0 38.0 38.0 34.0 38.0 90-94 36.306650000000005 38.0 38.0 38.0 33.4 38.0 95-99 36.19225 38.0 38.0 38.0 33.4 38.0 100-104 36.06035 38.0 37.8 38.0 32.4 38.0 105-109 35.8856 38.0 37.0 38.0 31.0 38.0 110-114 35.73925 38.0 37.0 38.0 30.6 38.0 115-119 35.74555 38.0 36.8 38.0 30.6 38.0 120-124 35.40095 38.0 36.0 38.0 28.6 38.0 125-129 35.4409 38.0 36.2 38.0 29.0 38.0 130-134 35.17165 38.0 35.8 38.0 27.8 38.0 135-139 34.58765 38.0 35.0 38.0 23.4 38.0 140-144 34.076 38.0 33.8 38.0 22.2 38.0 145-149 33.9797 38.0 33.6 38.0 21.8 38.0 150-151 31.290875 35.5 27.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 5.0 17 4.0 18 13.0 19 11.0 20 8.0 21 8.0 22 5.0 23 14.0 24 18.0 25 18.0 26 23.0 27 25.0 28 34.0 29 40.0 30 59.0 31 78.0 32 74.0 33 109.0 34 161.0 35 284.0 36 584.0 37 2424.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.76176176176176 18.493493493493492 15.74074074074074 29.004004004004003 2 24.95 27.275 31.15 16.625 3 21.4 28.125 30.599999999999998 19.875 4 22.875 35.35 23.674999999999997 18.099999999999998 5 23.95 36.025 23.925 16.1 6 20.825 38.025 23.974999999999998 17.175 7 19.900000000000002 20.875 40.050000000000004 19.175 8 21.275 25.05 28.15 25.525 9 20.974999999999998 25.8 30.175 23.05 10-14 23.265 28.79 26.165 21.78 15-19 23.455000000000002 28.29 27.505000000000003 20.75 20-24 22.96 28.689999999999998 27.97 20.380000000000003 25-29 23.02 28.115000000000002 27.845 21.02 30-34 23.465 28.660000000000004 28.065 19.81 35-39 23.16 27.775 28.83 20.235 40-44 23.11 28.360000000000003 27.875 20.655 45-49 23.235 28.425 27.900000000000002 20.44 50-54 23.535 27.544999999999998 28.225 20.695 55-59 23.645 28.265 28.035 20.055 60-64 22.685 28.57 28.645 20.1 65-69 23.75 28.115000000000002 27.665 20.47 70-74 23.625 28.23 28.110000000000003 20.035 75-79 23.73 27.99 27.92 20.36 80-84 23.355 28.485 28.225 19.935 85-89 23.515 28.21 28.105000000000004 20.169999999999998 90-94 23.669999999999998 28.355000000000004 27.735 20.24 95-99 23.415 28.435 27.860000000000003 20.29 100-104 23.67736773677368 28.38283828382838 27.797779777977798 20.142014201420142 105-109 24.24484896979396 28.085617123424683 28.225645129025807 19.443888777755554 110-114 23.849769953990798 28.410682136427283 27.785557111422282 19.953990798159634 115-119 23.728559283892583 28.31924788718308 27.634145121768267 20.318047707156072 120-124 24.375 27.575 28.065 19.985 125-129 24.2 28.345 27.735 19.72 130-134 24.865000000000002 28.42 27.375 19.34 135-139 25.101255062753136 28.016400820041003 27.05635281764088 19.82599129956498 140-144 25.278791818772817 28.094214132119816 27.51412711906786 19.11286693003951 145-149 26.456614153538382 27.506876719179797 27.191797949487373 18.844711177794448 150-151 26.206551637909474 28.469617404351087 26.469117279319832 18.854713678419603 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.5 24 1.0 25 1.5 26 3.5 27 5.0 28 6.0 29 6.0 30 7.5 31 14.0 32 22.0 33 32.0 34 46.0 35 69.5 36 94.0 37 121.0 38 151.0 39 180.5 40 223.5 41 261.5 42 280.5 43 291.5 44 293.5 45 296.0 46 267.5 47 224.0 48 201.0 49 174.0 50 154.5 51 136.5 52 110.5 53 89.5 54 68.0 55 45.0 56 34.5 57 24.0 58 15.0 59 15.0 60 13.0 61 7.5 62 3.5 63 3.0 64 2.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.02 110-114 0.02 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.015 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.9875 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.7375 0.0 0.0 0.0 0.0 118-119 3.0250000000000004 0.0 0.0 0.0 0.0 120-121 3.4 0.0 0.0 0.0 0.0 122-123 4.05 0.0 0.0 0.0 0.0 124-125 4.5125 0.0 0.0 0.0 0.0 126-127 5.112500000000001 0.0 0.0 0.0 0.0 128-129 5.775 0.0 0.0 0.0 0.0 130-131 6.275 0.0 0.0 0.0 0.0 132-133 6.9 0.0 0.0 0.0 0.0 134-135 7.4875 0.0 0.0 0.0 0.0 136-137 7.9125 0.0 0.0 0.0 0.0 138-139 8.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGATG 10 0.006830828 145.0 9 >>END_MODULE Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833840 spots for SRR7171469.sra Written 833840 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra Read 833829 spots for SRR7171469.sra Written 833829 spots for SRR7171469.sra SRR ids: ['SRR7171469.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fmbbiiv7 SRR7171469.sra spots: 16676591 blocks: [[1, 833829], [833830, 1667658], [1667659, 2501487], [2501488, 3335316], [3335317, 4169145], [4169146, 5002974], [5002975, 5836803], [5836804, 6670632], [6670633, 7504461], [7504462, 8338290], [8338291, 9172119], [9172120, 10005948], [10005949, 10839777], [10839778, 11673606], [11673607, 12507435], [12507436, 13341264], [13341265, 14175093], [14175094, 15008922], [15008923, 15842751], [15842752, 16676591]] SRR7171469 file size 5629449 SRR7171469 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171469 SRR7171469_1.fastq SRR7171469_2.fastq Input file: SRR7171469_1.fastq Paired file: SRR7171469_2.fastq trimmed: SRR7171469-trimmed-pair1.fastq, SRR7171469-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:28:14 2025 >> started Thu Feb 13 19:28:31 2025 >> done (17.704s) 16676591 read pairs processed; of these: 125 ( 0.00%) short read pairs filtered out after trimming by size control 805 ( 0.00%) empty read pairs filtered out after trimming by size control 16675661 (99.99%) read pairs available; of these: 2315063 (13.88%) trimmed read pairs available after processing 14360598 (86.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 2 0.00% 27 0 0.00% 28 4 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 4 0.00% 34 3 0.00% 35 0 0.00% 36 2 0.00% 37 4 0.00% 38 2 0.00% 39 3 0.00% 40 4 0.00% 41 9 0.00% 42 3 0.00% 43 5 0.00% 44 4 0.00% 45 10 0.00% 46 10 0.00% 47 9 0.00% 48 12 0.00% 49 20 0.00% 50 21 0.00% 51 21 0.00% 52 31 0.00% 53 26 0.00% 54 31 0.00% 55 37 0.00% 56 63 0.00% 57 56 0.00% 58 78 0.00% 59 66 0.00% 60 90 0.00% 61 105 0.00% 62 139 0.00% 63 130 0.00% 64 182 0.00% 65 184 0.00% 66 225 0.00% 67 287 0.00% 68 321 0.00% 69 354 0.00% 70 394 0.00% 71 544 0.00% 72 621 0.00% 73 695 0.00% 74 816 0.00% 75 925 0.01% 76 1080 0.01% 77 1213 0.01% 78 1293 0.01% 79 1625 0.01% 80 1763 0.01% 81 1976 0.01% 82 2332 0.01% 83 2771 0.02% 84 3169 0.02% 85 3459 0.02% 86 3767 0.02% 87 4104 0.02% 88 4610 0.03% 89 5080 0.03% 90 5805 0.03% 91 6273 0.04% 92 7149 0.04% 93 7931 0.05% 94 8756 0.05% 95 9510 0.06% 96 10371 0.06% 97 10848 0.07% 98 11372 0.07% 99 12406 0.07% 100 13171 0.08% 101 14406 0.09% 102 15533 0.09% 103 16791 0.10% 104 17887 0.11% 105 19030 0.11% 106 20221 0.12% 107 20867 0.13% 108 21663 0.13% 109 22912 0.14% 110 23447 0.14% 111 24723 0.15% 112 26073 0.16% 113 27805 0.17% 114 29663 0.18% 115 30868 0.19% 116 32076 0.19% 117 34349 0.21% 118 37523 0.23% 119 35120 0.21% 120 35597 0.21% 121 36428 0.22% 122 38365 0.23% 123 39567 0.24% 124 41654 0.25% 125 42623 0.26% 126 44383 0.27% 127 45273 0.27% 128 45977 0.28% 129 46866 0.28% 130 47756 0.29% 131 48340 0.29% 132 49754 0.30% 133 51628 0.31% 134 53576 0.32% 135 55030 0.33% 136 56567 0.34% 137 57309 0.34% 138 58140 0.35% 139 58742 0.35% 140 59308 0.36% 141 60801 0.36% 142 66308 0.40% 143 65237 0.39% 144 66597 0.40% 145 69587 0.42% 146 67570 0.41% 147 71593 0.43% 148 69657 0.42% 149 70181 0.42% 150 75288 0.45% 151 14360598 86.12% 16675661 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=28 prefix-density=0.26 prefix-fanout=1.9 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=92.22 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.6 sequence=GAAAATCAAAGTACTTCACACCATGAAAAATCACACACTAAGCAAACCATGCATGATGGAATAAAAATGCTTTTAGGCGCACTGGAAATCTTTGGGGACCTTCTTTCCACAGACATTGAGAAGCAAGCTTAGAGATACAGGGATATTAAGGTTGATGCCCAAGATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.20 prefix-fanout=2.0 sequence=CTCAGTTGTTCCTTTACAATGATGGTGTCGTTAAAGGAGAGAGATCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=58.20 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=12.7 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGC SRR7171469 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:29:17 Started mapping on | Feb 13 19:29:17 Finished on | Feb 13 19:31:24 Mapping speed, Million of reads per hour | 472.70 Number of input reads | 16675661 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15783872 Uniquely mapped reads % | 94.65% Average mapped length | 294.66 Number of splices: Total | 15571241 Number of splices: Annotated (sjdb) | 15295454 Number of splices: GT/AG | 15320561 Number of splices: GC/AG | 200367 Number of splices: AT/AC | 10564 Number of splices: Non-canonical | 39749 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.39 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386239 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 62455 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.56% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 505550 505550 505550 N_multimapping 386239 386239 386239 N_noFeature 417590 15649903 473914 N_ambiguous 148284 908 70047 UnstrandedReadsAssigned:15217998 PositiveStrandReadsAssigned:133061 NegativeStrandReadsAssigned:15239911 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171469 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171469-trimmed-pair1.fastq SRR7171469-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,675,661 reads, 15,249,441 reads pseudoaligned [quant] estimated average fragment length: 222.735 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7171469.ke.tsv 34699 SRR7171469.se.tsv 87100 total ==> SRR7171469.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.27 770 28.9625 Potri.005G024800.1.v4.1 1035 813.265 136 11.2986 Potri.004G059700.1.v4.1 961 739.281 39 3.56428 Potri.007G009000.2.v4.1 1416 1194.27 0 0 Potri.003G141000.2.v4.1 2943 2721.27 548.147 13.6095 Potri.016G087400.1.v4.1 270 86.1921 1318.25 1033.35 Potri.015G069301.1.v4.1 564 344.668 0 0 Potri.010G195200.1.v4.1 1773 1551.27 152.768 6.65369 Potri.012G127500.1.v4.1 977 755.281 4653 416.237 ==> SRR7171469.se.tsv <== Potri.001G166300.v4.1 4 Potri.001G448400.v4.1 103 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 394 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 227 SRR7171469 completed mapping pipeline successfully