Starting /dee2/code/volunteer_pipeline.sh SRR7171470 current disk space = 3114733764608 free memory = 1578056428 SRR7171470 SRAfilesize a665a0ac8e8a5a825d9bfc21686b69b2 SRR7171470.sra SRR7171470.sra file validated SRR7171470 is paired end SRR7171470 is conventional basespace SRR7171470 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171470_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.45325 33.0 33.0 34.0 32.0 34.0 2 32.85025 34.0 33.0 34.0 32.0 34.0 3 32.5655 33.0 33.0 34.0 31.0 34.0 4 32.0845 33.0 32.0 33.0 31.0 34.0 5 32.516 33.0 33.0 33.0 32.0 34.0 6 36.52625 38.0 36.0 38.0 34.0 38.0 7 37.02125 38.0 37.0 38.0 35.0 38.0 8 37.3695 38.0 38.0 38.0 37.0 38.0 9 37.50275 38.0 38.0 38.0 37.0 38.0 10-14 37.564750000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.53959999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.52355 38.0 38.0 38.0 37.8 38.0 25-29 37.52625 38.0 38.0 38.0 37.6 38.0 30-34 37.49975 38.0 38.0 38.0 37.4 38.0 35-39 37.512249999999995 38.0 38.0 38.0 37.6 38.0 40-44 37.4591 38.0 38.0 38.0 37.0 38.0 45-49 37.43845 38.0 38.0 38.0 37.0 38.0 50-54 37.3958 38.0 38.0 38.0 37.0 38.0 55-59 37.33155 38.0 38.0 38.0 37.0 38.0 60-64 37.31545 38.0 38.0 38.0 37.0 38.0 65-69 37.257799999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.2292 38.0 38.0 38.0 36.4 38.0 75-79 37.16445 38.0 38.0 38.0 36.0 38.0 80-84 37.10675 38.0 38.0 38.0 36.0 38.0 85-89 37.05035 38.0 38.0 38.0 36.0 38.0 90-94 36.9747 38.0 38.0 38.0 36.0 38.0 95-99 36.82035 38.0 38.0 38.0 35.0 38.0 100-104 36.8173 38.0 38.0 38.0 34.8 38.0 105-109 36.674400000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.68130000000001 38.0 38.0 38.0 34.2 38.0 115-119 36.5406 38.0 38.0 38.0 34.0 38.0 120-124 36.418099999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.20825000000001 38.0 37.0 38.0 33.0 38.0 130-134 36.10485 38.0 37.0 38.0 33.2 38.0 135-139 35.9585 38.0 36.4 38.0 32.6 38.0 140-144 35.72065 38.0 36.0 38.0 31.0 38.0 145-149 35.4577 38.0 36.0 38.0 31.0 38.0 150-151 33.523375 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 3.0 25 4.0 26 13.0 27 14.0 28 14.0 29 23.0 30 32.0 31 39.0 32 55.0 33 79.0 34 136.0 35 237.0 36 570.0 37 2776.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.490660352538804 12.786108918705605 11.26019468560905 40.46303604314654 2 20.0 14.124999999999998 34.525 31.35 3 18.35 17.349999999999998 26.05 38.25 4 22.35 22.875 23.525 31.25 5 23.35 26.85 25.8 24.0 6 20.025000000000002 32.375 25.724999999999998 21.875 7 15.475 26.200000000000003 40.949999999999996 17.375 8 18.0 26.200000000000003 33.1 22.7 9 17.1 25.1 33.675 24.125 10-14 20.06 29.054999999999996 28.005000000000003 22.88 15-19 19.735 28.439999999999998 28.134999999999998 23.69 20-24 19.905 28.1 27.845 24.15 25-29 19.835 28.12 27.944999999999997 24.099999999999998 30-34 19.29 28.225 28.585 23.9 35-39 19.615 27.939999999999998 28.09 24.355 40-44 19.595000000000002 28.435 28.345 23.625 45-49 20.215 27.74 28.050000000000004 23.995 50-54 19.575 28.335 28.07 24.02 55-59 20.47 27.944999999999997 28.355000000000004 23.23 60-64 20.580000000000002 28.15 27.685 23.585 65-69 20.43 28.345 27.894999999999996 23.330000000000002 70-74 20.07 28.144999999999996 28.1 23.685000000000002 75-79 19.82 28.325 27.985 23.87 80-84 20.225 27.735 27.91 24.13 85-89 20.285 28.355000000000004 27.834999999999997 23.525 90-94 20.05 28.449999999999996 28.060000000000002 23.44 95-99 19.830000000000002 27.939999999999998 28.09 24.14 100-104 20.3 28.26 27.97 23.47 105-109 21.11 27.794999999999998 27.505000000000003 23.59 110-114 20.745 27.775 27.67 23.810000000000002 115-119 20.405 28.17 28.000000000000004 23.425 120-124 20.485 28.050000000000004 27.355 24.11 125-129 20.805 28.005000000000003 27.245 23.945 130-134 20.395 28.46 27.025 24.12 135-139 21.17 27.800000000000004 27.229999999999997 23.799999999999997 140-144 21.115000000000002 27.79 27.11 23.985 145-149 21.16 27.755000000000003 26.810000000000002 24.275 150-151 21.227653456682084 27.740967620952617 27.628453556694588 23.40292536567071 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.5 23 1.0 24 1.5 25 2.5 26 4.0 27 5.5 28 9.0 29 13.5 30 17.0 31 22.0 32 31.5 33 47.5 34 58.0 35 59.5 36 85.5 37 116.0 38 131.0 39 164.5 40 200.5 41 213.5 42 222.5 43 255.0 44 276.0 45 276.5 46 267.5 47 248.5 48 243.0 49 205.5 50 159.0 51 142.5 52 119.5 53 92.5 54 68.5 55 49.5 56 45.5 57 40.5 58 25.5 59 19.5 60 17.5 61 13.5 62 9.0 63 5.5 64 3.0 65 1.0 66 0.5 67 0.0 68 1.5 69 2.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.0875 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.9625 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 4.987500000000001 0.0 0.0 0.0 0.0 124-125 5.449999999999999 0.0 0.0 0.0 0.0 126-127 5.925000000000001 0.0 0.0 0.0 0.0 128-129 6.324999999999999 0.0 0.0 0.0 0.0 130-131 6.975 0.0 0.0 0.0 0.0 132-133 7.6875 0.0 0.0 0.0 0.0 134-135 8.399999999999999 0.0 0.0 0.0 0.0 136-137 9.0125 0.0 0.0 0.0 0.0 138-139 9.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171470 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171470_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9645 33.0 33.0 34.0 32.0 34.0 2 33.03625 34.0 33.0 34.0 32.0 34.0 3 33.07675 34.0 33.0 34.0 32.0 34.0 4 33.049 34.0 33.0 34.0 32.0 34.0 5 33.06125 34.0 33.0 34.0 32.0 34.0 6 37.1445 38.0 38.0 38.0 37.0 38.0 7 37.366 38.0 38.0 38.0 37.0 38.0 8 37.18425 38.0 38.0 38.0 37.0 38.0 9 37.159 38.0 38.0 38.0 37.0 38.0 10-14 37.18745 38.0 38.0 38.0 36.8 38.0 15-19 37.22500000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.23285 38.0 38.0 38.0 37.0 38.0 25-29 37.1872 38.0 38.0 38.0 36.8 38.0 30-34 37.1349 38.0 38.0 38.0 36.4 38.0 35-39 37.148849999999996 38.0 38.0 38.0 36.6 38.0 40-44 37.048899999999996 38.0 38.0 38.0 36.0 38.0 45-49 37.0269 38.0 38.0 38.0 36.0 38.0 50-54 37.032300000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.941449999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.8913 38.0 38.0 38.0 35.4 38.0 65-69 36.8523 38.0 38.0 38.0 35.4 38.0 70-74 36.819250000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.68535 38.0 38.0 38.0 34.8 38.0 80-84 36.6781 38.0 38.0 38.0 34.6 38.0 85-89 36.5887 38.0 38.0 38.0 34.2 38.0 90-94 36.49865 38.0 38.0 38.0 34.0 38.0 95-99 36.345749999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.150299999999994 38.0 37.0 38.0 33.0 38.0 105-109 36.09765 38.0 37.0 38.0 33.0 38.0 110-114 35.81915 38.0 37.0 38.0 31.4 38.0 115-119 35.66825 38.0 36.6 38.0 30.6 38.0 120-124 35.45795 38.0 36.0 38.0 29.2 38.0 125-129 35.3059 38.0 36.0 38.0 28.2 38.0 130-134 35.029250000000005 38.0 35.0 38.0 27.4 38.0 135-139 34.5629 38.0 35.0 38.0 24.6 38.0 140-144 34.222849999999994 38.0 34.2 38.0 23.0 38.0 145-149 33.8997 38.0 33.4 38.0 22.2 38.0 150-151 31.066750000000003 35.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 1.0 17 4.0 18 3.0 19 1.0 20 2.0 21 6.0 22 5.0 23 11.0 24 9.0 25 21.0 26 25.0 27 14.0 28 31.0 29 38.0 30 63.0 31 51.0 32 76.0 33 132.0 34 168.0 35 298.0 36 732.0 37 2306.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.5 19.575 17.075000000000003 28.849999999999998 2 24.825 26.650000000000002 30.325000000000003 18.2 3 21.025 27.650000000000002 30.625000000000004 20.7 4 22.925 33.650000000000006 24.25 19.175 5 24.75 34.4 22.775000000000002 18.075 6 20.849999999999998 38.5 23.150000000000002 17.5 7 21.175 22.35 38.275 18.2 8 22.525000000000002 25.275 27.775 24.425 9 22.5 25.874999999999996 29.375 22.25 10-14 23.05 29.154999999999998 26.11 21.685 15-19 23.175 28.494999999999997 27.125 21.205 20-24 23.25 27.860000000000003 27.685 21.205 25-29 23.685000000000002 28.144999999999996 27.315 20.855 30-34 23.9 28.42 27.465 20.215 35-39 23.605 27.744999999999997 27.500000000000004 21.15 40-44 23.84 27.655 27.815 20.69 45-49 23.025000000000002 28.34 28.084999999999997 20.549999999999997 50-54 23.22 27.825 27.68 21.275 55-59 23.635 28.415000000000003 26.974999999999998 20.974999999999998 60-64 23.74 28.675 27.175 20.41 65-69 23.205000000000002 28.915000000000003 27.534999999999997 20.345 70-74 24.18 27.77 27.3 20.75 75-79 23.880000000000003 28.23 27.189999999999998 20.7 80-84 23.255 28.175 27.779999999999998 20.79 85-89 23.905 28.084999999999997 27.435 20.575 90-94 23.575 29.09 27.015 20.32 95-99 23.919999999999998 28.465 27.224999999999998 20.39 100-104 24.415 28.485 26.76 20.34 105-109 24.145 27.860000000000003 27.560000000000002 20.435 110-114 23.815 28.83 27.32 20.035 115-119 24.845 28.025 26.83 20.3 120-124 24.38 28.17 27.42 20.03 125-129 25.155 27.63 26.985 20.23 130-134 25.19 28.1 27.18 19.53 135-139 25.430000000000003 28.15 26.69 19.73 140-144 25.66 27.639999999999997 27.435 19.265 145-149 26.240000000000002 28.365000000000002 26.36 19.035 150-151 26.4125 28.0625 27.187499999999996 18.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 0.5 25 1.0 26 1.5 27 2.5 28 4.0 29 7.0 30 10.0 31 15.0 32 19.0 33 25.0 34 41.5 35 60.0 36 76.0 37 96.5 38 131.0 39 162.0 40 209.0 41 251.5 42 266.5 43 276.0 44 275.0 45 281.5 46 284.5 47 267.0 48 221.5 49 191.5 50 184.0 51 140.5 52 110.0 53 97.5 54 69.0 55 55.5 56 47.0 57 34.5 58 23.0 59 15.5 60 10.5 61 6.5 62 7.0 63 5.5 64 2.5 65 1.5 66 1.5 67 2.0 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67361285463218 99.25 2 0.2761737383881496 0.5499999999999999 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.025106703489831784 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.0875 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.475 0.0 0.0 0.0 0.0 122-123 4.949999999999999 0.0 0.0 0.0 0.0 124-125 5.425000000000001 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.225 0.0 0.0 0.0 0.0 130-131 6.875 0.0 0.0 0.0 0.0 132-133 7.575 0.0 0.0 0.0 0.0 134-135 8.25 0.0 0.0 0.0 0.0 136-137 8.825 0.0 0.0 0.0 0.0 138-139 9.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676968 spots for SRR7171470.sra Written 676968 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra Read 676958 spots for SRR7171470.sra Written 676958 spots for SRR7171470.sra SRR ids: ['SRR7171470.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ugzq0cf1 SRR7171470.sra spots: 13539170 blocks: [[1, 676958], [676959, 1353916], [1353917, 2030874], [2030875, 2707832], [2707833, 3384790], [3384791, 4061748], [4061749, 4738706], [4738707, 5415664], [5415665, 6092622], [6092623, 6769580], [6769581, 7446538], [7446539, 8123496], [8123497, 8800454], [8800455, 9477412], [9477413, 10154370], [10154371, 10831328], [10831329, 11508286], [11508287, 12185244], [12185245, 12862202], [12862203, 13539170]] SRR7171470 file size 4566280 SRR7171470 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171470 SRR7171470_1.fastq SRR7171470_2.fastq Input file: SRR7171470_1.fastq Paired file: SRR7171470_2.fastq trimmed: SRR7171470-trimmed-pair1.fastq, SRR7171470-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:19:45 2025 >> started Fri Feb 14 11:20:00 2025 >> done (15.077s) 13539170 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 1959 ( 0.01%) empty read pairs filtered out after trimming by size control 13537191 (99.99%) read pairs available; of these: 2255037 (16.66%) trimmed read pairs available after processing 11282154 (83.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 0 0.00% 29 4 0.00% 30 2 0.00% 31 3 0.00% 32 3 0.00% 33 0 0.00% 34 0 0.00% 35 2 0.00% 36 1 0.00% 37 4 0.00% 38 2 0.00% 39 2 0.00% 40 6 0.00% 41 8 0.00% 42 1 0.00% 43 8 0.00% 44 9 0.00% 45 11 0.00% 46 9 0.00% 47 10 0.00% 48 17 0.00% 49 8 0.00% 50 25 0.00% 51 20 0.00% 52 19 0.00% 53 27 0.00% 54 42 0.00% 55 42 0.00% 56 48 0.00% 57 62 0.00% 58 66 0.00% 59 68 0.00% 60 101 0.00% 61 123 0.00% 62 144 0.00% 63 142 0.00% 64 163 0.00% 65 194 0.00% 66 233 0.00% 67 302 0.00% 68 328 0.00% 69 379 0.00% 70 415 0.00% 71 511 0.00% 72 648 0.00% 73 720 0.01% 74 893 0.01% 75 1017 0.01% 76 1125 0.01% 77 1276 0.01% 78 1434 0.01% 79 1691 0.01% 80 1854 0.01% 81 2100 0.02% 82 2515 0.02% 83 2897 0.02% 84 3356 0.02% 85 3741 0.03% 86 4047 0.03% 87 4584 0.03% 88 4929 0.04% 89 5433 0.04% 90 6100 0.05% 91 6550 0.05% 92 7295 0.05% 93 8369 0.06% 94 8893 0.07% 95 9893 0.07% 96 10807 0.08% 97 11227 0.08% 98 11803 0.09% 99 12629 0.09% 100 13614 0.10% 101 14431 0.11% 102 15663 0.12% 103 16627 0.12% 104 17890 0.13% 105 19071 0.14% 106 20247 0.15% 107 21044 0.16% 108 22166 0.16% 109 23228 0.17% 110 23728 0.18% 111 25040 0.18% 112 26160 0.19% 113 27160 0.20% 114 29159 0.22% 115 30544 0.23% 116 31742 0.23% 117 32780 0.24% 118 33744 0.25% 119 34601 0.26% 120 35405 0.26% 121 36761 0.27% 122 37884 0.28% 123 39196 0.29% 124 40810 0.30% 125 41325 0.31% 126 43623 0.32% 127 44808 0.33% 128 45978 0.34% 129 46875 0.35% 130 47384 0.35% 131 47801 0.35% 132 49635 0.37% 133 50729 0.37% 134 51565 0.38% 135 53562 0.40% 136 55067 0.41% 137 55891 0.41% 138 56660 0.42% 139 57726 0.43% 140 58313 0.43% 141 59420 0.44% 142 60652 0.45% 143 61099 0.45% 144 62615 0.46% 145 63875 0.47% 146 64363 0.48% 147 65059 0.48% 148 65987 0.49% 149 66815 0.49% 150 68116 0.50% 151 11282154 83.34% 13537191 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=26 prefix-density=0.64 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=21.75 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.8 sequence=TGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=24 prefix-density=0.54 prefix-fanout=2.8 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=31.25 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.2 sequence=GAGAAGGCAATGAGAGATGC SRR7171470 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:21:22 Started mapping on | Feb 14 11:21:23 Finished on | Feb 14 11:24:13 Mapping speed, Million of reads per hour | 286.67 Number of input reads | 13537191 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12086445 Uniquely mapped reads % | 89.28% Average mapped length | 293.37 Number of splices: Total | 11342952 Number of splices: Annotated (sjdb) | 11105688 Number of splices: GT/AG | 11142252 Number of splices: GC/AG | 156573 Number of splices: AT/AC | 9966 Number of splices: Non-canonical | 34161 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291741 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 68691 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.90% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1159005 1159005 1159005 N_multimapping 291741 291741 291741 N_noFeature 359071 11985747 403881 N_ambiguous 121284 579 65044 UnstrandedReadsAssigned:11606090 PositiveStrandReadsAssigned:100119 NegativeStrandReadsAssigned:11617520 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171470 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171470-trimmed-pair1.fastq SRR7171470-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,537,191 reads, 11,622,991 reads pseudoaligned [quant] estimated average fragment length: 212.51 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR7171470.ke.tsv 34699 SRR7171470.se.tsv 87100 total ==> SRR7171470.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.49 1480 71.8366 Potri.005G024800.1.v4.1 1035 823.49 237 25.2354 Potri.004G059700.1.v4.1 961 749.49 6 0.701948 Potri.007G009000.2.v4.1 1416 1204.49 0 0 Potri.003G141000.2.v4.1 2943 2731.49 505 16.2111 Potri.016G087400.1.v4.1 270 89.0358 560 551.497 Potri.015G069301.1.v4.1 564 353.948 0 0 Potri.010G195200.1.v4.1 1773 1561.49 628.868 35.3134 Potri.012G127500.1.v4.1 977 765.49 11643 1333.66 ==> SRR7171470.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 317 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 467 SRR7171470 completed mapping pipeline successfully