Starting /dee2/code/volunteer_pipeline.sh SRR7171471 current disk space = 3114196955136 free memory = 1573127540 SRR7171471 SRAfilesize 046e5513a03275625177a38a43b296e3 SRR7171471.sra SRR7171471.sra file validated SRR7171471 is paired end SRR7171471 is conventional basespace SRR7171471 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171471_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.71025 31.0 18.0 33.0 18.0 33.0 2 31.76875 33.0 32.0 33.0 27.0 33.0 3 32.0735 33.0 32.0 33.0 31.0 34.0 4 32.492 33.0 33.0 33.0 32.0 34.0 5 32.5915 33.0 33.0 34.0 32.0 34.0 6 36.93925 38.0 37.0 38.0 35.0 38.0 7 37.36275 38.0 38.0 38.0 37.0 38.0 8 37.42375 38.0 38.0 38.0 37.0 38.0 9 37.53625 38.0 38.0 38.0 38.0 38.0 10-14 37.5595 38.0 38.0 38.0 38.0 38.0 15-19 37.596799999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.57355 38.0 38.0 38.0 38.0 38.0 25-29 37.4282 38.0 38.0 38.0 37.8 38.0 30-34 37.28815 38.0 38.0 38.0 37.0 38.0 35-39 37.28955 38.0 38.0 38.0 37.0 38.0 40-44 37.3418 38.0 38.0 38.0 37.0 38.0 45-49 37.43835 38.0 38.0 38.0 38.0 38.0 50-54 37.3925 38.0 38.0 38.0 37.2 38.0 55-59 37.272400000000005 38.0 38.0 38.0 36.6 38.0 60-64 37.17745000000001 38.0 38.0 38.0 36.4 38.0 65-69 37.17380000000001 38.0 38.0 38.0 36.4 38.0 70-74 37.2527 38.0 38.0 38.0 36.8 38.0 75-79 37.2041 38.0 38.0 38.0 36.2 38.0 80-84 37.2254 38.0 38.0 38.0 36.4 38.0 85-89 37.1407 38.0 38.0 38.0 36.0 38.0 90-94 37.065 38.0 38.0 38.0 36.0 38.0 95-99 36.886900000000004 38.0 38.0 38.0 35.2 38.0 100-104 36.808550000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.81015000000001 38.0 38.0 38.0 35.0 38.0 110-114 36.580949999999994 38.0 38.0 38.0 34.0 38.0 115-119 36.36415 38.0 37.8 38.0 34.0 38.0 120-124 36.34325 38.0 37.8 38.0 33.8 38.0 125-129 36.183949999999996 38.0 37.2 38.0 33.2 38.0 130-134 36.1616 38.0 37.0 38.0 33.0 38.0 135-139 35.82625 38.0 36.0 38.0 31.2 38.0 140-144 35.621050000000004 38.0 36.0 38.0 31.0 38.0 145-149 35.322449999999996 38.0 35.2 38.0 29.4 38.0 150-151 33.30275 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 3.0 22 3.0 23 2.0 24 3.0 25 8.0 26 5.0 27 10.0 28 12.0 29 21.0 30 32.0 31 59.0 32 61.0 33 96.0 34 133.0 35 248.0 36 574.0 37 2728.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.19119119119119 10.76076076076076 10.66066066066066 37.38738738738739 2 21.75 14.7 34.449999999999996 29.099999999999998 3 20.8 18.925 26.224999999999998 34.050000000000004 4 21.725 27.275 23.825 27.175 5 24.0 29.799999999999997 23.95 22.25 6 18.95 34.325 25.275 21.45 7 14.7 25.85 41.9 17.549999999999997 8 17.599999999999998 26.125 30.975 25.3 9 17.7 24.625 33.725 23.95 10-14 19.435 29.654999999999998 27.36 23.549999999999997 15-19 20.29 27.884999999999998 27.76 24.065 20-24 19.31 28.18 28.305000000000003 24.205 25-29 19.77192017206022 28.585004751663085 28.3149102185765 23.328164857700195 30-34 19.788799359391422 28.336920074070367 28.106701366297983 23.767579200240228 35-39 19.11911911911912 28.473473473473476 27.902902902902905 24.504504504504503 40-44 20.195195195195197 28.573573573573576 27.402402402402405 23.82882882882883 45-49 19.632669402462216 28.28045240716645 27.364628165348815 24.72225002502252 50-54 19.994999999999997 28.449999999999996 27.58 23.974999999999998 55-59 20.3 28.349999999999998 27.46 23.89 60-64 19.25 28.825 28.050000000000004 23.875 65-69 20.145 27.845 28.02 23.990000000000002 70-74 20.055 27.800000000000004 28.27 23.875 75-79 19.139999999999997 28.715000000000003 28.075 24.07 80-84 20.1 28.175 27.765 23.96 85-89 20.32203220322032 27.96279627962796 27.82278227822782 23.89238923892389 90-94 19.785 28.24 28.17 23.805 95-99 20.18 27.6 28.249999999999996 23.97 100-104 19.85 28.59 27.83 23.73 105-109 20.830000000000002 28.439999999999998 27.169999999999998 23.56 110-114 19.975 27.43 28.67 23.925 115-119 20.36 28.575 27.155 23.91 120-124 20.745 28.22 27.425 23.61 125-129 20.77 28.225 26.979999999999997 24.025 130-134 20.32 27.955000000000002 27.889999999999997 23.835 135-139 21.154999999999998 27.575 27.155 24.115000000000002 140-144 20.785 27.889999999999997 27.01 24.315 145-149 20.695 28.075 26.965 24.265 150-151 21.2 27.55 27.150000000000002 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.5 20 1.0 21 1.5 22 1.5 23 0.0 24 2.0 25 2.0 26 1.5 27 5.0 28 7.5 29 9.5 30 14.5 31 16.0 32 19.0 33 38.5 34 61.5 35 70.0 36 84.5 37 107.5 38 126.0 39 156.5 40 188.5 41 204.5 42 250.0 43 281.0 44 280.5 45 287.0 46 279.0 47 265.5 48 240.0 49 199.5 50 172.5 51 155.5 52 116.5 53 81.5 54 63.5 55 44.5 56 35.0 57 29.5 58 20.5 59 20.0 60 16.0 61 8.5 62 7.5 63 6.5 64 3.5 65 2.5 66 3.0 67 1.5 68 0.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.034999999999999996 30-34 0.095 35-39 0.1 40-44 0.1 45-49 0.09 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 4.125 0.0 0.0 0.0 0.0 126-127 4.525 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.625 0.0 0.0 0.0 0.0 136-137 7.2375 0.0 0.0 0.0 0.0 138-139 8.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTAGCC 10 0.006882143 144.6375 9 GTGATAG 10 0.006882143 144.6375 8 AAGTGAT 10 0.006882143 144.6375 6 >>END_MODULE SRR7171471 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171471_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9125 33.0 33.0 34.0 32.0 34.0 2 32.931 34.0 33.0 34.0 32.0 34.0 3 32.95125 34.0 33.0 34.0 32.0 34.0 4 32.88775 34.0 33.0 34.0 32.0 34.0 5 32.8415 34.0 33.0 34.0 32.0 34.0 6 37.106 38.0 38.0 38.0 37.0 38.0 7 37.05525 38.0 38.0 38.0 36.0 38.0 8 37.0465 38.0 38.0 38.0 37.0 38.0 9 37.057 38.0 38.0 38.0 37.0 38.0 10-14 36.991150000000005 38.0 38.0 38.0 36.2 38.0 15-19 36.966350000000006 38.0 38.0 38.0 36.2 38.0 20-24 36.94495 38.0 38.0 38.0 36.0 38.0 25-29 36.91420000000001 38.0 38.0 38.0 36.0 38.0 30-34 37.06885 38.0 38.0 38.0 36.8 38.0 35-39 37.1314 38.0 38.0 38.0 37.0 38.0 40-44 37.121249999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.05005 38.0 38.0 38.0 36.8 38.0 50-54 36.946 38.0 38.0 38.0 36.0 38.0 55-59 36.872699999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.70885 38.0 38.0 38.0 35.0 38.0 65-69 36.77475 38.0 38.0 38.0 35.6 38.0 70-74 36.8285 38.0 38.0 38.0 35.8 38.0 75-79 36.862750000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.8477 38.0 38.0 38.0 35.4 38.0 85-89 36.800149999999995 38.0 38.0 38.0 35.6 38.0 90-94 36.7062 38.0 38.0 38.0 35.0 38.0 95-99 36.6242 38.0 38.0 38.0 34.8 38.0 100-104 36.4479 38.0 38.0 38.0 34.0 38.0 105-109 36.301 38.0 38.0 38.0 33.8 38.0 110-114 36.0714 38.0 37.8 38.0 32.8 38.0 115-119 35.9186 38.0 37.2 38.0 31.8 38.0 120-124 35.7656 38.0 37.0 38.0 31.0 38.0 125-129 35.61274999999999 38.0 36.4 38.0 30.6 38.0 130-134 35.53685 38.0 36.0 38.0 30.6 38.0 135-139 35.2657 38.0 35.8 38.0 29.2 38.0 140-144 34.92895 38.0 35.2 38.0 26.2 38.0 145-149 34.59245 38.0 35.0 38.0 23.8 38.0 150-151 32.293 36.5 29.0 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 6.0 17 5.0 18 4.0 19 5.0 20 4.0 21 5.0 22 4.0 23 10.0 24 13.0 25 18.0 26 13.0 27 26.0 28 29.0 29 32.0 30 49.0 31 50.0 32 72.0 33 99.0 34 168.0 35 235.0 36 495.0 37 2649.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.225 20.075000000000003 16.5 26.200000000000003 2 26.034612490594434 26.435916729370458 29.99749184850765 17.531978931527465 3 20.777917189460478 29.535759096612296 30.012547051442912 19.673776662484315 4 24.341279799247175 34.17816813048933 23.43789209535759 18.0426599749059 5 24.617314930991217 36.4366373902133 21.9573400250941 16.98870765370138 6 19.679519278918377 38.15723585378067 23.635453179769655 18.5277916875313 7 20.390781563126254 20.691382765531063 37.6503006012024 21.26753507014028 8 21.863260706235913 25.77009767092412 27.44803405960431 24.91860756323566 9 22.99023290758828 26.84698221888305 28.825444527923867 21.337340345604808 10-14 24.005411363864116 28.855596753181683 25.84427297324381 21.29471890971039 15-19 23.537074148296593 28.361723446893787 27.334669338677354 20.766533066132265 20-24 23.282385367075918 28.2335254322225 27.035830618892508 21.44825858180907 25-29 23.82049484123009 28.08774917359511 27.2713613142342 20.820394670940598 30-34 22.992992992992995 28.3983983983984 27.64764764764765 20.96096096096096 35-39 23.27827827827828 28.838838838838836 27.147147147147148 20.735735735735737 40-44 23.721093202522773 28.441285413955352 27.014716187806588 20.822905195715286 45-49 23.446893787575153 28.45691382765531 27.985971943887776 20.11022044088176 50-54 23.66060241567684 28.537062095925425 27.514659449706812 20.287676038690925 55-59 23.767288033674085 28.813389456804973 27.440368811385046 19.9789536981359 60-64 23.79234315494087 28.54780517137703 27.460412908398478 20.199438765283624 65-69 24.09578198577297 27.938082356477306 27.993187055405272 19.972948602344452 70-74 23.923923923923923 28.838838838838836 27.04204204204204 20.195195195195197 75-79 23.280132085855808 28.678641116725874 27.73302646720368 20.30820033021464 80-84 24.28957374424655 27.951771062637583 27.511506904142486 20.247148288973385 85-89 24.004004004004003 28.753753753753752 26.891891891891888 20.35035035035035 90-94 24.506858916591572 27.98137578852508 27.49574446780815 20.0160208270752 95-99 24.099403777744378 28.598627185730745 27.336038879703388 19.965930156821486 100-104 24.380828236237843 28.36157625589091 27.474180286774292 19.783415221096963 105-109 24.186512910503886 28.648784156430185 27.405364753070945 19.759338179994987 110-114 23.828144583145335 28.36015440918434 27.512909209404924 20.298791798265402 115-119 24.194275976141547 28.259235126058847 27.943461480627533 19.603027417172072 120-124 24.909819639278556 27.84068136272545 27.17434869739479 20.0751503006012 125-129 24.618311057716376 28.007208289532965 27.15622966411373 20.21825098863693 130-134 24.98122653316646 28.335419274092615 27.11389236545682 19.569461827284105 135-139 25.21917739592205 27.724061920745452 26.94253794900055 20.114222734331946 140-144 24.7167351849995 28.03068284367793 27.945452722350346 19.307129248972224 145-149 25.552825552825553 28.145213859499574 26.761269618412477 19.540690969262396 150-151 24.852664576802507 28.46394984326019 27.42319749216301 19.260188087774292 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 2.5 22 0.5 23 0.5 24 1.5 25 3.0 26 4.5 27 4.5 28 4.0 29 5.5 30 7.5 31 14.0 32 19.0 33 24.5 34 33.5 35 47.0 36 71.0 37 89.0 38 120.0 39 182.5 40 237.5 41 247.0 42 257.0 43 285.5 44 299.0 45 309.0 46 299.0 47 262.5 48 233.5 49 199.5 50 163.0 51 136.5 52 102.5 53 83.0 54 65.0 55 39.0 56 29.5 57 25.0 58 20.0 59 17.5 60 12.5 61 8.0 62 7.0 63 7.0 64 4.5 65 1.0 66 1.0 67 1.5 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.375 4 0.375 5 0.375 6 0.15 7 0.2 8 0.17500000000000002 9 0.17500000000000002 10-14 0.21 15-19 0.2 20-24 0.22499999999999998 25-29 0.16999999999999998 30-34 0.1 35-39 0.1 40-44 0.11 45-49 0.2 50-54 0.23500000000000001 55-59 0.22 60-64 0.22 65-69 0.19 70-74 0.1 75-79 0.065 80-84 0.06 85-89 0.1 90-94 0.13 95-99 0.20500000000000002 100-104 0.27 105-109 0.27499999999999997 110-114 0.265 115-119 0.245 120-124 0.2 125-129 0.11499999999999999 130-134 0.125 135-139 0.19499999999999998 140-144 0.27 145-149 0.28500000000000003 150-151 0.3125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.2625 0.0 0.0 0.0 0.0 130-131 5.7875 0.0 0.0 0.0 0.0 132-133 6.25 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.5375 0.0 0.0 0.0 0.0 138-139 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGCC 10 0.00682755 145.0 6 >>END_MODULE Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812234 spots for SRR7171471.sra Written 812234 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra Read 812225 spots for SRR7171471.sra Written 812225 spots for SRR7171471.sra SRR ids: ['SRR7171471.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uzhil5q4 SRR7171471.sra spots: 16244509 blocks: [[1, 812225], [812226, 1624450], [1624451, 2436675], [2436676, 3248900], [3248901, 4061125], [4061126, 4873350], [4873351, 5685575], [5685576, 6497800], [6497801, 7310025], [7310026, 8122250], [8122251, 8934475], [8934476, 9746700], [9746701, 10558925], [10558926, 11371150], [11371151, 12183375], [12183376, 12995600], [12995601, 13807825], [13807826, 14620050], [14620051, 15432275], [15432276, 16244509]] SRR7171471 file size 5483030 SRR7171471 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171471 SRR7171471_1.fastq SRR7171471_2.fastq Input file: SRR7171471_1.fastq Paired file: SRR7171471_2.fastq trimmed: SRR7171471-trimmed-pair1.fastq, SRR7171471-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:36:35 2025 >> started Fri Feb 14 11:37:00 2025 >> done (24.591s) 16244509 read pairs processed; of these: 473 ( 0.00%) short read pairs filtered out after trimming by size control 2728 ( 0.02%) empty read pairs filtered out after trimming by size control 16241308 (99.98%) read pairs available; of these: 2055169 (12.65%) trimmed read pairs available after processing 14186139 (87.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 4 0.00% 31 1 0.00% 32 4 0.00% 33 3 0.00% 34 0 0.00% 35 2 0.00% 36 2 0.00% 37 1 0.00% 38 3 0.00% 39 0 0.00% 40 1 0.00% 41 1 0.00% 42 8 0.00% 43 1 0.00% 44 6 0.00% 45 10 0.00% 46 8 0.00% 47 13 0.00% 48 14 0.00% 49 11 0.00% 50 17 0.00% 51 19 0.00% 52 23 0.00% 53 26 0.00% 54 24 0.00% 55 36 0.00% 56 31 0.00% 57 37 0.00% 58 54 0.00% 59 43 0.00% 60 55 0.00% 61 70 0.00% 62 105 0.00% 63 134 0.00% 64 148 0.00% 65 175 0.00% 66 169 0.00% 67 190 0.00% 68 233 0.00% 69 273 0.00% 70 346 0.00% 71 390 0.00% 72 450 0.00% 73 555 0.00% 74 582 0.00% 75 751 0.00% 76 837 0.01% 77 950 0.01% 78 1063 0.01% 79 1258 0.01% 80 1375 0.01% 81 1592 0.01% 82 1817 0.01% 83 2217 0.01% 84 2446 0.02% 85 2772 0.02% 86 3185 0.02% 87 3338 0.02% 88 3752 0.02% 89 4101 0.03% 90 4545 0.03% 91 5234 0.03% 92 5685 0.04% 93 6337 0.04% 94 7122 0.04% 95 7775 0.05% 96 8313 0.05% 97 8970 0.06% 98 9377 0.06% 99 10150 0.06% 100 10964 0.07% 101 11925 0.07% 102 12850 0.08% 103 13873 0.09% 104 15048 0.09% 105 15762 0.10% 106 17033 0.10% 107 17776 0.11% 108 18540 0.11% 109 19043 0.12% 110 20009 0.12% 111 21192 0.13% 112 22147 0.14% 113 23539 0.14% 114 25128 0.15% 115 26355 0.16% 116 28271 0.17% 117 32503 0.20% 118 32330 0.20% 119 32571 0.20% 120 30710 0.19% 121 31859 0.20% 122 33170 0.20% 123 34670 0.21% 124 36631 0.23% 125 37480 0.23% 126 38441 0.24% 127 39369 0.24% 128 40811 0.25% 129 41207 0.25% 130 42124 0.26% 131 43565 0.27% 132 44405 0.27% 133 45872 0.28% 134 47422 0.29% 135 48921 0.30% 136 50246 0.31% 137 51591 0.32% 138 52251 0.32% 139 53866 0.33% 140 54402 0.33% 141 60987 0.38% 142 57830 0.36% 143 63258 0.39% 144 62412 0.38% 145 62712 0.39% 146 61733 0.38% 147 64151 0.39% 148 63548 0.39% 149 65158 0.40% 150 68251 0.42% 151 14186139 87.35% 16241308 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=20 prefix-density=0.72 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=18.78 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.1 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=24 prefix-density=0.63 prefix-fanout=2.9 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=61.82 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.2 sequence=TATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATC SRR7171471 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:37:48 Started mapping on | Feb 14 11:37:48 Finished on | Feb 14 11:40:03 Mapping speed, Million of reads per hour | 433.10 Number of input reads | 16241308 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15002616 Uniquely mapped reads % | 92.37% Average mapped length | 295.35 Number of splices: Total | 14509391 Number of splices: Annotated (sjdb) | 14231529 Number of splices: GT/AG | 14280804 Number of splices: GC/AG | 182752 Number of splices: AT/AC | 11576 Number of splices: Non-canonical | 34259 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346077 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 114956 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.60% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 892615 892615 892615 N_multimapping 346077 346077 346077 N_noFeature 399371 14855690 450252 N_ambiguous 177757 845 81176 UnstrandedReadsAssigned:14425488 PositiveStrandReadsAssigned:146081 NegativeStrandReadsAssigned:14471188 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171471 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171471-trimmed-pair1.fastq SRR7171471-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,241,308 reads, 14,538,228 reads pseudoaligned [quant] estimated average fragment length: 225.813 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7171471.ke.tsv 34699 SRR7171471.se.tsv 87100 total ==> SRR7171471.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.19 1459 52.3143 Potri.005G024800.1.v4.1 1035 810.187 390 30.9507 Potri.004G059700.1.v4.1 961 736.197 12 1.04804 Potri.007G009000.2.v4.1 1416 1191.19 0 0 Potri.003G141000.2.v4.1 2943 2718.19 801.209 18.9521 Potri.016G087400.1.v4.1 270 83.5485 1140 877.318 Potri.015G069301.1.v4.1 564 341.375 0 0 Potri.010G195200.1.v4.1 1773 1548.19 518.921 21.5511 Potri.012G127500.1.v4.1 977 752.192 6583 562.712 ==> SRR7171471.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 514 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 102 SRR7171471 completed mapping pipeline successfully