Starting /dee2/code/volunteer_pipeline.sh SRR7171472 current disk space = 3115403051008 free memory = 1333501620 SRR7171472 SRAfilesize 650a4d2a5e8cce76bc408ccca166dbd6 SRR7171472.sra SRR7171472.sra file validated SRR7171472 is paired end SRR7171472 is conventional basespace SRR7171472 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171472_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.105 32.0 28.0 33.0 18.0 33.0 2 31.479 33.0 31.0 33.0 27.0 34.0 3 31.356 33.0 32.0 33.0 27.0 33.0 4 30.66125 33.0 31.0 33.0 27.0 33.0 5 32.085 33.0 32.0 33.0 31.0 33.0 6 36.66975 38.0 37.0 38.0 34.0 38.0 7 37.1805 38.0 38.0 38.0 36.0 38.0 8 37.4625 38.0 38.0 38.0 37.0 38.0 9 37.46175 38.0 38.0 38.0 37.0 38.0 10-14 37.47005 38.0 38.0 38.0 37.0 38.0 15-19 37.47625 38.0 38.0 38.0 37.6 38.0 20-24 37.480050000000006 38.0 38.0 38.0 37.4 38.0 25-29 37.37665 38.0 38.0 38.0 37.0 38.0 30-34 37.339549999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.3099 38.0 38.0 38.0 37.0 38.0 40-44 37.252750000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.245850000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.1983 38.0 38.0 38.0 36.6 38.0 55-59 37.09935 38.0 38.0 38.0 36.0 38.0 60-64 37.04215 38.0 38.0 38.0 36.0 38.0 65-69 36.92275 38.0 38.0 38.0 35.8 38.0 70-74 36.94355 38.0 38.0 38.0 35.4 38.0 75-79 36.90075 38.0 38.0 38.0 35.4 38.0 80-84 36.7093 38.0 38.0 38.0 34.6 38.0 85-89 36.46445 38.0 38.0 38.0 34.0 38.0 90-94 36.5751 38.0 38.0 38.0 34.0 38.0 95-99 36.61319999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.40535 38.0 37.6 38.0 34.0 38.0 105-109 36.22775 38.0 37.4 38.0 33.6 38.0 110-114 36.065400000000004 38.0 37.0 38.0 32.6 38.0 115-119 35.86045 38.0 36.6 38.0 31.8 38.0 120-124 35.5889 38.0 36.2 38.0 30.6 38.0 125-129 35.53535 38.0 36.0 38.0 30.6 38.0 130-134 35.4751 38.0 36.0 38.0 30.2 38.0 135-139 35.15814999999999 38.0 35.2 38.0 28.0 38.0 140-144 34.944950000000006 38.0 35.0 38.0 27.6 38.0 145-149 34.4639 38.0 34.6 38.0 23.8 38.0 150-151 32.239125 36.0 28.5 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 2.0 22 2.0 23 2.0 24 6.0 25 10.0 26 22.0 27 21.0 28 19.0 29 28.0 30 55.0 31 67.0 32 83.0 33 131.0 34 164.0 35 302.0 36 797.0 37 2286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.84195768544481 12.770838643894978 7.8766250318633695 39.51057863879684 2 20.480721081622434 13.87080620931397 33.04957436154231 32.598898347521285 3 21.099999999999998 16.625 26.525 35.75 4 25.4 24.625 23.125 26.85 5 24.725 28.499999999999996 24.975 21.8 6 19.6 33.575 25.525 21.3 7 15.525 26.125 40.45 17.9 8 17.45 25.874999999999996 31.35 25.324999999999996 9 17.424999999999997 24.65 34.699999999999996 23.225 10-14 19.575 29.385 27.48 23.56 15-19 19.885 27.965 28.105000000000004 24.044999999999998 20-24 20.03 27.52 28.575 23.875 25-29 19.765 27.845 27.76 24.63 30-34 20.145 28.189999999999998 27.775 23.89 35-39 20.169999999999998 27.965 28.044999999999998 23.82 40-44 19.939999999999998 28.49 27.6 23.97 45-49 20.025000000000002 27.83 28.07 24.075 50-54 19.975 28.185 27.98 23.86 55-59 20.39 27.92 27.944999999999997 23.745 60-64 20.474999999999998 27.935 28.084999999999997 23.505000000000003 65-69 19.942991448717308 27.76916537480622 27.589138370755613 24.69870480572086 70-74 20.2080312046807 28.039205880882136 28.399259888983348 23.35350302545382 75-79 20.29 27.99 27.735 23.985 80-84 20.255000000000003 27.785 27.55 24.41 85-89 20.419999999999998 27.589999999999996 27.525 24.465 90-94 19.950000000000003 28.03 27.855 24.165 95-99 20.595 27.215 28.71 23.48 100-104 20.035 27.689999999999998 28.105000000000004 24.169999999999998 105-109 20.465 27.48 27.944999999999997 24.11 110-114 20.62015503875969 28.212053013253314 27.62190547636909 23.545886471617905 115-119 21.1902975743936 27.406851712928233 27.7569392348087 23.645911477869465 120-124 20.707070707070706 27.987798779877988 27.552755275527552 23.75237523752375 125-129 21.07 27.605 27.52 23.805 130-134 21.175 27.339999999999996 27.73 23.755000000000003 135-139 21.195 27.51 27.68 23.615 140-144 21.044999999999998 28.060000000000002 26.775 24.12 145-149 20.995 27.48 27.67 23.855 150-151 20.474999999999998 27.9125 27.6875 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 2.0 24 3.0 25 2.0 26 2.0 27 5.5 28 6.5 29 12.0 30 16.0 31 19.0 32 30.0 33 39.5 34 44.5 35 54.0 36 79.5 37 101.0 38 119.0 39 147.0 40 167.5 41 208.5 42 237.5 43 260.0 44 302.5 45 296.0 46 283.5 47 266.5 48 225.0 49 191.0 50 164.5 51 140.5 52 126.5 53 103.0 54 74.0 55 59.0 56 42.0 57 37.0 58 31.0 59 19.5 60 15.5 61 14.5 62 13.5 63 8.5 64 5.0 65 5.0 66 5.0 67 4.5 68 2.0 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.025 115-119 0.025 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.05 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.6 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.775 0.0 0.0 0.0 0.0 130-131 4.2625 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 5.05 0.0 0.0 0.0 0.0 136-137 5.5625 0.0 0.0 0.0 0.0 138-139 6.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAGAG 10 0.006832588 144.9875 4 >>END_MODULE SRR7171472 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171472_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67375 33.0 33.0 34.0 32.0 34.0 2 32.67775 34.0 33.0 34.0 31.0 34.0 3 32.76025 34.0 33.0 34.0 32.0 34.0 4 32.7525 34.0 33.0 34.0 32.0 34.0 5 32.78875 34.0 33.0 34.0 32.0 34.0 6 36.87475 38.0 38.0 38.0 36.0 38.0 7 36.775 38.0 38.0 38.0 35.0 38.0 8 36.83425 38.0 38.0 38.0 36.0 38.0 9 36.86875 38.0 38.0 38.0 36.0 38.0 10-14 36.7663 38.0 38.0 38.0 35.4 38.0 15-19 36.7373 38.0 38.0 38.0 35.2 38.0 20-24 36.658100000000005 38.0 38.0 38.0 34.8 38.0 25-29 36.7041 38.0 38.0 38.0 35.0 38.0 30-34 36.724599999999995 38.0 38.0 38.0 35.2 38.0 35-39 36.7471 38.0 38.0 38.0 35.2 38.0 40-44 36.6771 38.0 38.0 38.0 35.0 38.0 45-49 36.77425 38.0 38.0 38.0 35.2 38.0 50-54 36.72245 38.0 38.0 38.0 35.2 38.0 55-59 36.6436 38.0 38.0 38.0 34.6 38.0 60-64 36.46525 38.0 38.0 38.0 34.0 38.0 65-69 36.42115 38.0 38.0 38.0 33.8 38.0 70-74 36.3572 38.0 38.0 38.0 34.0 38.0 75-79 36.40185 38.0 38.0 38.0 34.0 38.0 80-84 36.36995 38.0 38.0 38.0 34.0 38.0 85-89 36.18730000000001 38.0 38.0 38.0 32.8 38.0 90-94 36.01004999999999 38.0 37.6 38.0 32.2 38.0 95-99 35.9682 38.0 37.4 38.0 32.2 38.0 100-104 35.774449999999995 38.0 37.0 38.0 30.4 38.0 105-109 35.53945 38.0 37.0 38.0 29.4 38.0 110-114 35.319100000000006 38.0 36.4 38.0 28.0 38.0 115-119 35.3948 38.0 36.0 38.0 29.0 38.0 120-124 35.0645 38.0 35.6 38.0 27.2 38.0 125-129 35.051750000000006 38.0 35.6 38.0 27.0 38.0 130-134 34.8196 38.0 35.2 38.0 25.2 38.0 135-139 34.17485 38.0 34.2 38.0 22.6 38.0 140-144 33.64935 38.0 33.8 38.0 19.8 38.0 145-149 33.650549999999996 38.0 33.6 38.0 21.0 38.0 150-151 31.062875 35.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 8.0 17 16.0 18 6.0 19 4.0 20 6.0 21 17.0 22 19.0 23 21.0 24 16.0 25 16.0 26 29.0 27 28.0 28 43.0 29 45.0 30 67.0 31 76.0 32 89.0 33 125.0 34 199.0 35 301.0 36 614.0 37 2253.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.80671006509765 20.981472208312468 14.321482223335003 26.89033550325488 2 26.450000000000003 26.125 30.125 17.299999999999997 3 21.15 28.249999999999996 30.599999999999998 20.0 4 24.75 33.225 22.125 19.900000000000002 5 25.174999999999997 34.425 23.3 17.1 6 21.175 37.974999999999994 23.3 17.549999999999997 7 22.25 21.099999999999998 35.949999999999996 20.7 8 21.85 24.875 28.225 25.05 9 22.5 25.124999999999996 30.075000000000003 22.3 10-14 24.03 29.160000000000004 26.21 20.599999999999998 15-19 23.405 27.965 27.345000000000002 21.285 20-24 24.08 28.32 27.22 20.380000000000003 25-29 24.095 28.27 26.884999999999998 20.75 30-34 23.965 28.08 27.355 20.599999999999998 35-39 23.175 27.935 27.889999999999997 21.0 40-44 23.41 28.255000000000003 27.474999999999998 20.86 45-49 23.7 27.560000000000002 27.79 20.95 50-54 23.72 28.194999999999997 27.54 20.544999999999998 55-59 23.84 28.255000000000003 27.405 20.5 60-64 23.61 27.965 27.54 20.885 65-69 23.535 27.76 27.775 20.93 70-74 23.86 27.54 27.675 20.925 75-79 23.745 27.855 27.33 21.07 80-84 24.435000000000002 27.97 27.355 20.24 85-89 24.125 27.665 27.465 20.745 90-94 23.13 28.485 27.365000000000002 21.02 95-99 23.605 28.105000000000004 27.12 21.17 100-104 24.086021505376344 28.287071767941985 27.25681420355089 20.370092523130783 105-109 23.702110633189957 28.56356907072122 27.683304991497447 20.051015304591377 110-114 24.681106497924066 28.072632684708122 26.987144214896702 20.25911660247111 115-119 25.0250050010002 28.105621124224843 27.035407081416285 19.83396679335867 120-124 24.740000000000002 27.185 27.735 20.34 125-129 24.355 28.33 27.01 20.305 130-134 25.395 27.845 26.69 20.07 135-139 24.676233811690583 28.686434321716085 27.04135206760338 19.595979798989948 140-144 25.368879107687693 27.92977542139749 26.634322012704448 20.06702345821037 145-149 24.902451225612808 28.7743871935968 26.623311655827912 19.699849924962482 150-151 25.400200100050025 27.963981990995496 26.688344172086044 19.947473736868435 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 1.0 26 2.5 27 4.5 28 6.0 29 6.0 30 8.0 31 10.5 32 15.5 33 24.5 34 37.0 35 49.5 36 73.5 37 99.5 38 132.5 39 175.0 40 211.5 41 230.5 42 252.5 43 285.0 44 283.0 45 276.5 46 276.5 47 259.0 48 220.5 49 190.0 50 185.0 51 144.0 52 101.5 53 91.0 54 73.5 55 59.5 56 42.0 57 29.5 58 23.0 59 18.0 60 17.5 61 17.0 62 15.5 63 13.5 64 9.5 65 5.0 66 4.0 67 3.0 68 2.5 69 3.0 70 1.5 71 0.0 72 0.5 73 1.5 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.03 110-114 0.045 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.034999999999999996 145-149 0.05 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.3624999999999998 0.0 0.0 0.0 0.0 114-115 1.5750000000000002 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.7125 0.0 0.0 0.0 0.0 130-131 4.1625 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.975 0.0 0.0 0.0 0.0 136-137 5.5 0.0 0.0 0.0 0.0 138-139 6.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCACA 10 0.006830828 145.0 7 TCATTCA 10 0.006830828 145.0 3 >>END_MODULE Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860977 spots for SRR7171472.sra Written 860977 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra Read 860975 spots for SRR7171472.sra Written 860975 spots for SRR7171472.sra SRR ids: ['SRR7171472.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6t1qsj3s SRR7171472.sra spots: 17219502 blocks: [[1, 860975], [860976, 1721950], [1721951, 2582925], [2582926, 3443900], [3443901, 4304875], [4304876, 5165850], [5165851, 6026825], [6026826, 6887800], [6887801, 7748775], [7748776, 8609750], [8609751, 9470725], [9470726, 10331700], [10331701, 11192675], [11192676, 12053650], [12053651, 12914625], [12914626, 13775600], [13775601, 14636575], [14636576, 15497550], [15497551, 16358525], [16358526, 17219502]] SRR7171472 file size 5813423 SRR7171472 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171472 SRR7171472_1.fastq SRR7171472_2.fastq Input file: SRR7171472_1.fastq Paired file: SRR7171472_2.fastq trimmed: SRR7171472-trimmed-pair1.fastq, SRR7171472-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:31:39 2025 >> started Fri Feb 14 10:32:00 2025 >> done (21.374s) 17219502 read pairs processed; of these: 170 ( 0.00%) short read pairs filtered out after trimming by size control 1107 ( 0.01%) empty read pairs filtered out after trimming by size control 17218225 (99.99%) read pairs available; of these: 1712268 ( 9.94%) trimmed read pairs available after processing 15505957 (90.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 2 0.00% 27 0 0.00% 28 1 0.00% 29 2 0.00% 30 5 0.00% 31 0 0.00% 32 3 0.00% 33 3 0.00% 34 2 0.00% 35 3 0.00% 36 0 0.00% 37 1 0.00% 38 1 0.00% 39 2 0.00% 40 1 0.00% 41 2 0.00% 42 1 0.00% 43 1 0.00% 44 6 0.00% 45 9 0.00% 46 2 0.00% 47 5 0.00% 48 4 0.00% 49 7 0.00% 50 11 0.00% 51 12 0.00% 52 9 0.00% 53 15 0.00% 54 16 0.00% 55 20 0.00% 56 16 0.00% 57 29 0.00% 58 29 0.00% 59 36 0.00% 60 40 0.00% 61 45 0.00% 62 66 0.00% 63 68 0.00% 64 90 0.00% 65 88 0.00% 66 111 0.00% 67 130 0.00% 68 130 0.00% 69 149 0.00% 70 218 0.00% 71 234 0.00% 72 277 0.00% 73 335 0.00% 74 441 0.00% 75 470 0.00% 76 574 0.00% 77 609 0.00% 78 672 0.00% 79 778 0.00% 80 904 0.01% 81 1077 0.01% 82 1262 0.01% 83 1386 0.01% 84 1590 0.01% 85 1832 0.01% 86 2065 0.01% 87 2147 0.01% 88 2529 0.01% 89 2751 0.02% 90 3064 0.02% 91 3373 0.02% 92 3923 0.02% 93 4313 0.03% 94 4972 0.03% 95 5242 0.03% 96 5665 0.03% 97 6182 0.04% 98 6681 0.04% 99 7051 0.04% 100 7656 0.04% 101 8508 0.05% 102 9000 0.05% 103 9750 0.06% 104 10628 0.06% 105 11244 0.07% 106 12183 0.07% 107 12791 0.07% 108 13380 0.08% 109 14121 0.08% 110 14682 0.09% 111 15493 0.09% 112 16379 0.10% 113 17939 0.10% 114 18861 0.11% 115 20532 0.12% 116 21184 0.12% 117 23209 0.13% 118 26785 0.16% 119 24178 0.14% 120 24296 0.14% 121 24808 0.14% 122 25987 0.15% 123 27583 0.16% 124 29132 0.17% 125 29954 0.17% 126 30884 0.18% 127 32546 0.19% 128 33513 0.19% 129 34327 0.20% 130 35072 0.20% 131 36294 0.21% 132 37651 0.22% 133 39165 0.23% 134 40766 0.24% 135 41999 0.24% 136 43621 0.25% 137 44828 0.26% 138 45495 0.26% 139 46920 0.27% 140 47528 0.28% 141 50191 0.29% 142 55772 0.32% 143 53871 0.31% 144 55413 0.32% 145 57989 0.34% 146 56506 0.33% 147 62039 0.36% 148 59084 0.34% 149 60517 0.35% 150 66217 0.38% 151 15505957 90.06% 17218225 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=17 prefix-density=0.35 prefix-fanout=2.6 sequence=AAGGATCTCTCTCCTTTAACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=33.35 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=CTCTGCCACTTACAATACCCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGCGGCTCTTTCACCGCGAGGGCTTGGCCAACGGCACGTGCCTCCGGGGCCAAGAGGCCCCTACTGCAGGTCGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTAGAGGCGTTCAGTCATAATCCAACGCACGGTAGCTTCGCGCCACTGGCTTTTCAACCAAGCGCGATGACCAATTGTGCGAATCAACGGTTCCTCTCGTACTAGGTTGGATTACTATTGCGACACTGTCATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=19 prefix-density=0.38 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=26.45 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=8.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171472 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:33:19 Started mapping on | Feb 14 10:33:19 Finished on | Feb 14 10:37:55 Mapping speed, Million of reads per hour | 224.59 Number of input reads | 17218225 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15107510 Uniquely mapped reads % | 87.74% Average mapped length | 296.80 Number of splices: Total | 14289005 Number of splices: Annotated (sjdb) | 14015685 Number of splices: GT/AG | 14057917 Number of splices: GC/AG | 181181 Number of splices: AT/AC | 11032 Number of splices: Non-canonical | 38875 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405574 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 352705 % of reads mapped to too many loci | 2.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.31% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1705141 1705141 1705141 N_multimapping 405574 405574 405574 N_noFeature 422569 14963145 492249 N_ambiguous 150962 1331 75425 UnstrandedReadsAssigned:14533979 PositiveStrandReadsAssigned:143034 NegativeStrandReadsAssigned:14539836 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171472 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171472-trimmed-pair1.fastq SRR7171472-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,218,225 reads, 14,887,771 reads pseudoaligned [quant] estimated average fragment length: 232.038 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR7171472.ke.tsv 34699 SRR7171472.se.tsv 87100 total ==> SRR7171472.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.96 1778 66.5484 Potri.005G024800.1.v4.1 1035 803.962 395 32.8611 Potri.004G059700.1.v4.1 961 729.968 21 1.92414 Potri.007G009000.2.v4.1 1416 1184.96 0 0 Potri.003G141000.2.v4.1 2943 2711.96 653 16.1046 Potri.016G087400.1.v4.1 270 78.6781 841 714.929 Potri.015G069301.1.v4.1 564 335.233 0 0 Potri.010G195200.1.v4.1 1773 1541.96 587.743 25.4938 Potri.012G127500.1.v4.1 977 745.962 10938 980.713 ==> SRR7171472.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 467 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 352 SRR7171472 completed mapping pipeline successfully