Starting /dee2/code/volunteer_pipeline.sh SRR7171473 current disk space = 3087327940608 free memory = 1535308408 SRR7171473 SRAfilesize d36cede6dff04ea403bab512b2e0a92c SRR7171473.sra SRR7171473.sra file validated SRR7171473 is paired end SRR7171473 is conventional basespace SRR7171473 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171473_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88425 34.0 33.0 34.0 32.0 34.0 2 33.23975 34.0 33.0 34.0 32.0 34.0 3 33.0945 34.0 33.0 34.0 31.0 34.0 4 32.821 33.0 33.0 34.0 32.0 34.0 5 33.17625 34.0 33.0 34.0 32.0 34.0 6 36.986 38.0 37.0 38.0 35.0 38.0 7 37.274 38.0 38.0 38.0 36.0 38.0 8 37.46275 38.0 38.0 38.0 37.0 38.0 9 37.48275 38.0 38.0 38.0 38.0 38.0 10-14 37.52595 38.0 38.0 38.0 37.6 38.0 15-19 37.4036 38.0 38.0 38.0 37.2 38.0 20-24 37.3603 38.0 38.0 38.0 37.0 38.0 25-29 37.40650000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.48225 38.0 38.0 38.0 37.6 38.0 35-39 36.271950000000004 38.0 37.4 38.0 31.6 38.0 40-44 37.02375000000001 38.0 38.0 38.0 34.6 38.0 45-49 37.33175 38.0 38.0 38.0 37.0 38.0 50-54 37.252500000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.23535 38.0 38.0 38.0 36.4 38.0 60-64 37.24965 38.0 38.0 38.0 36.8 38.0 65-69 37.20885 38.0 38.0 38.0 36.6 38.0 70-74 34.5415 33.6 33.6 37.8 31.8 38.0 75-79 35.2336 36.2 35.0 38.0 31.8 38.0 80-84 37.0669 38.0 38.0 38.0 36.0 38.0 85-89 37.07039999999999 38.0 38.0 38.0 36.0 38.0 90-94 37.08735 38.0 38.0 38.0 36.0 38.0 95-99 37.040800000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.87555 38.0 38.0 38.0 35.4 38.0 105-109 36.75485 38.0 38.0 38.0 34.8 38.0 110-114 36.592 38.0 38.0 38.0 34.0 38.0 115-119 36.49034999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.342150000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.24985 38.0 37.6 38.0 33.8 38.0 130-134 36.064099999999996 38.0 37.2 38.0 32.8 38.0 135-139 36.111000000000004 38.0 37.0 38.0 33.0 38.0 140-144 36.0583 38.0 36.4 38.0 33.0 38.0 145-149 35.83925 38.0 36.0 38.0 32.0 38.0 150-151 33.43525 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 1.0 23 4.0 24 5.0 25 6.0 26 13.0 27 17.0 28 25.0 29 27.0 30 43.0 31 55.0 32 58.0 33 87.0 34 123.0 35 217.0 36 701.0 37 2616.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.75907258064516 10.609879032258064 9.50100806451613 38.13004032258064 2 22.1 14.124999999999998 33.0 30.775000000000002 3 20.150000000000002 18.45 26.0 35.4 4 23.375 26.125 23.825 26.674999999999997 5 23.125 31.825 23.925 21.125 6 19.525000000000002 34.25 26.025 20.200000000000003 7 15.6 26.525 39.6 18.275 8 17.525 26.650000000000002 31.45 24.375 9 17.474999999999998 23.724999999999998 35.425000000000004 23.375 10-14 20.645 28.965000000000003 27.505000000000003 22.884999999999998 15-19 20.064999999999998 27.555000000000003 27.950000000000003 24.43 20-24 20.11 27.689999999999998 28.4 23.799999999999997 25-29 20.035 28.48 27.834999999999997 23.65 30-34 19.887983197479624 28.0892133820073 27.919187878181727 24.10361554233135 35-39 19.976991947181514 28.735057270044518 27.43460211073876 23.853348672035214 40-44 20.457045704570458 28.197819781978197 27.73777377737774 23.607360736073606 45-49 20.528079211881785 28.15422313347002 26.994049107366102 24.323648547282094 50-54 20.075000000000003 28.035 27.689999999999998 24.2 55-59 20.25 27.675 27.634999999999998 24.44 60-64 20.05 28.24 27.46 24.25 65-69 19.905 27.525 28.34 24.23 70-74 20.880000000000003 28.665000000000003 26.43 24.025 75-79 20.52 28.37 27.639999999999997 23.47 80-84 20.95 27.855 27.150000000000002 24.044999999999998 85-89 20.085 28.9 27.279999999999998 23.735 90-94 20.560000000000002 27.38 28.08 23.98 95-99 20.43 27.915 27.845 23.810000000000002 100-104 20.875 27.935 27.175 24.015 105-109 21.195 27.71 27.169999999999998 23.925 110-114 20.724999999999998 28.205000000000002 27.189999999999998 23.880000000000003 115-119 20.695 27.825 27.74 23.74 120-124 20.599999999999998 27.87 27.305 24.224999999999998 125-129 21.72 28.095 26.865 23.32 130-134 20.66 28.575 26.650000000000002 24.115000000000002 135-139 20.72 28.42 26.565 24.295 140-144 20.785 27.83 26.875 24.51 145-149 20.630000000000003 28.595 26.450000000000003 24.325 150-151 20.724999999999998 27.500000000000004 26.7625 25.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 2.5 25 3.0 26 2.0 27 3.5 28 7.0 29 8.5 30 10.0 31 16.0 32 25.0 33 33.5 34 40.0 35 58.0 36 72.0 37 89.0 38 122.5 39 155.0 40 189.5 41 229.5 42 258.0 43 250.0 44 261.0 45 266.5 46 268.0 47 271.0 48 245.0 49 223.5 50 187.0 51 156.0 52 130.5 53 101.0 54 76.0 55 55.0 56 39.5 57 31.0 58 27.0 59 19.5 60 12.0 61 10.5 62 11.0 63 9.0 64 5.5 65 4.5 66 4.5 67 2.0 68 1.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.034999999999999996 40-44 0.01 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.225 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.762499999999999 0.0 0.0 0.0 0.0 126-127 5.3375 0.0 0.0 0.0 0.0 128-129 5.75 0.0 0.0 0.0 0.0 130-131 6.1875 0.0 0.0 0.0 0.0 132-133 6.6375 0.0 0.0 0.0 0.0 134-135 7.175 0.0 0.0 0.0 0.0 136-137 7.9 0.0 0.0 0.0 0.0 138-139 8.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 30 0.0014445208 24.164585 5 >>END_MODULE SRR7171473 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171473_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88975 33.0 33.0 34.0 32.0 34.0 2 32.957 34.0 33.0 34.0 32.0 34.0 3 32.97225 34.0 33.0 34.0 32.0 34.0 4 32.973 34.0 33.0 34.0 32.0 34.0 5 32.96375 34.0 33.0 34.0 32.0 34.0 6 37.1425 38.0 38.0 38.0 37.0 38.0 7 37.15625 38.0 38.0 38.0 37.0 38.0 8 37.17075 38.0 38.0 38.0 37.0 38.0 9 37.1535 38.0 38.0 38.0 37.0 38.0 10-14 37.10275 38.0 38.0 38.0 37.0 38.0 15-19 37.08115 38.0 38.0 38.0 37.0 38.0 20-24 37.02405 38.0 38.0 38.0 36.6 38.0 25-29 36.97065 38.0 38.0 38.0 36.2 38.0 30-34 37.050599999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.992650000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.781150000000004 38.0 38.0 38.0 35.6 38.0 45-49 36.888099999999994 38.0 38.0 38.0 35.8 38.0 50-54 36.9404 38.0 38.0 38.0 36.0 38.0 55-59 36.9048 38.0 38.0 38.0 36.0 38.0 60-64 36.82555 38.0 38.0 38.0 36.0 38.0 65-69 36.8232 38.0 38.0 38.0 35.8 38.0 70-74 36.7494 38.0 38.0 38.0 35.6 38.0 75-79 36.745400000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.7179 38.0 38.0 38.0 35.0 38.0 85-89 36.699 38.0 38.0 38.0 35.0 38.0 90-94 36.40815 38.0 38.0 38.0 34.0 38.0 95-99 36.4839 38.0 38.0 38.0 34.0 38.0 100-104 36.3793 38.0 38.0 38.0 34.0 38.0 105-109 36.3868 38.0 38.0 38.0 34.0 38.0 110-114 36.2187 38.0 38.0 38.0 33.6 38.0 115-119 36.1365 38.0 38.0 38.0 33.2 38.0 120-124 35.9121 38.0 37.2 38.0 32.4 38.0 125-129 35.746500000000005 38.0 37.0 38.0 31.0 38.0 130-134 35.68095 38.0 36.6 38.0 31.0 38.0 135-139 35.486599999999996 38.0 36.0 38.0 30.6 38.0 140-144 35.33935 38.0 36.0 38.0 28.8 38.0 145-149 34.974599999999995 38.0 35.2 38.0 27.2 38.0 150-151 32.44475 35.5 29.5 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 3.0 4 0.0 5 0.0 6 2.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 4.0 18 5.0 19 6.0 20 2.0 21 7.0 22 12.0 23 14.0 24 21.0 25 15.0 26 22.0 27 25.0 28 22.0 29 35.0 30 38.0 31 61.0 32 64.0 33 81.0 34 124.0 35 212.0 36 461.0 37 2758.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.1285964473355 20.565424068051037 15.086314736052039 26.21966474856142 2 26.02053593789131 26.170798898071624 29.476584022038566 18.332081141998497 3 20.98672677185074 28.775356874530427 29.97746055597295 20.26045579764588 4 23.69146005509642 34.610568494866015 22.238918106686704 19.459053343350863 5 24.04809619238477 36.69839679358717 21.993987975951903 17.259519038076153 6 20.215430861723448 36.998997995991985 23.897795591182362 18.887775551102205 7 21.64328657314629 22.094188376753507 36.523046092184366 19.739478957915832 8 22.419839679358716 24.9248496993988 27.45490981963928 25.200400801603205 9 22.52004008016032 26.052104208416832 28.65731462925852 22.77054108216433 10-14 24.08920070157855 28.358807316462038 26.695063893760963 20.856928088198444 15-19 23.471637602726 28.327320104229305 27.32010422930447 20.880938063740228 20-24 23.281218681098416 27.59069953898577 27.866305872920428 21.26177590699539 25-29 23.316633266533067 27.950901803607213 27.429859719438877 21.30260521042084 30-34 23.14972458688032 27.871807711567353 27.275913870806207 21.70255383074612 35-39 22.905195715286816 28.30613675042547 27.79557513264591 20.993092401641807 40-44 23.705299008314135 28.498447360512873 26.90073124311329 20.8955223880597 45-49 23.140123240318623 28.645859425880467 26.892440258504084 21.32157707529683 50-54 23.256513026052104 29.128256513026052 27.049098196392784 20.56613226452906 55-59 24.24698040394928 27.609883225580113 27.71011877913096 20.43301759133965 60-64 23.46248308355471 28.234173725627787 27.637712395368652 20.66563079544885 65-69 24.219650283080316 27.93226113532742 27.461295656094997 20.386792925497268 70-74 23.133917396745932 28.305381727158952 28.08010012515644 20.480600750938674 75-79 24.168458960636222 27.899764917721203 27.579652878507478 20.352123243135097 80-84 23.726186309315466 27.85639281964098 27.77638881944097 20.641032051602583 85-89 24.168126094570926 27.830873154866147 27.495621716287218 20.505379034275705 90-94 24.301172227231742 27.847911030958823 27.12654042681094 20.724376314998498 95-99 24.413710162357187 27.96652635798757 27.14471838043696 20.47504509921828 100-104 24.53501779716248 27.923998596280143 27.091793252118112 20.449190354439263 105-109 23.834586466165415 27.24310776942356 28.01002506265664 20.912280701754383 110-114 24.485906309559635 27.339753235028592 27.32470659043034 20.849633864981442 115-119 24.76940044114698 28.06296370563465 27.13555243633447 20.032083416883896 120-124 24.784569138276552 28.00100200400802 26.65330661322645 20.561122244488978 125-129 25.01252128618652 27.667033957728137 27.27636982870881 20.04407492737654 130-134 25.329326321061856 27.878787878787882 27.06235912847483 19.729526671675433 135-139 24.956160128262937 27.45628538503933 26.985319905806904 20.602234580890826 140-144 25.568096313017307 28.04614998745924 26.536242789064456 19.849510910458992 145-149 25.238190753184238 28.106508875739642 26.757597031391033 19.897703339685087 150-151 25.755107156285252 27.860634164682292 26.394284998120064 19.989973680912396 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 1.5 4 1.5 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 1.5 27 2.5 28 3.5 29 3.5 30 6.0 31 9.5 32 13.0 33 23.0 34 34.0 35 53.0 36 82.0 37 102.5 38 126.5 39 163.0 40 193.5 41 229.0 42 257.0 43 271.0 44 293.0 45 307.0 46 288.5 47 265.0 48 240.5 49 215.0 50 180.5 51 144.5 52 111.5 53 78.0 54 68.0 55 52.0 56 42.0 57 35.0 58 24.5 59 19.0 60 11.5 61 7.0 62 4.5 63 5.0 64 6.0 65 3.0 66 2.0 67 3.0 68 3.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.2 6 0.2 7 0.2 8 0.2 9 0.2 10-14 0.22499999999999998 15-19 0.22 20-24 0.22 25-29 0.2 30-34 0.15 35-39 0.11 40-44 0.16999999999999998 45-49 0.19499999999999998 50-54 0.2 55-59 0.23500000000000001 60-64 0.245 65-69 0.20500000000000002 70-74 0.125 75-79 0.034999999999999996 80-84 0.005 85-89 0.075 90-94 0.19 95-99 0.22 100-104 0.265 105-109 0.25 110-114 0.31 115-119 0.26 120-124 0.2 125-129 0.16999999999999998 130-134 0.17500000000000002 135-139 0.20500000000000002 140-144 0.325 145-149 0.29 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9750000000000001 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.5250000000000004 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.1 0.0 0.0 0.0 0.0 118-119 3.35 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.3125 0.0 0.0 0.0 0.0 124-125 4.9 0.0 0.0 0.0 0.0 126-127 5.4375 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.3125 0.0 0.0 0.0 0.0 132-133 6.775 0.0 0.0 0.0 0.0 134-135 7.325 0.0 0.0 0.0 0.0 136-137 8.075 0.0 0.0 0.0 0.0 138-139 8.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTCAC 10 0.006830828 145.0 9 >>END_MODULE Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814881 spots for SRR7171473.sra Written 814881 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra Read 814867 spots for SRR7171473.sra Written 814867 spots for SRR7171473.sra SRR ids: ['SRR7171473.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_92ennmv_ SRR7171473.sra spots: 16297354 blocks: [[1, 814867], [814868, 1629734], [1629735, 2444601], [2444602, 3259468], [3259469, 4074335], [4074336, 4889202], [4889203, 5704069], [5704070, 6518936], [6518937, 7333803], [7333804, 8148670], [8148671, 8963537], [8963538, 9778404], [9778405, 10593271], [10593272, 11408138], [11408139, 12223005], [12223006, 13037872], [13037873, 13852739], [13852740, 14667606], [14667607, 15482473], [15482474, 16297354]] SRR7171473 file size 5500938 SRR7171473 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171473 SRR7171473_1.fastq SRR7171473_2.fastq Input file: SRR7171473_1.fastq Paired file: SRR7171473_2.fastq trimmed: SRR7171473-trimmed-pair1.fastq, SRR7171473-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:29:29 2025 >> started Thu Feb 13 19:29:47 2025 >> done (17.693s) 16297354 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 2935 ( 0.02%) empty read pairs filtered out after trimming by size control 16294392 (99.98%) read pairs available; of these: 2259326 (13.87%) trimmed read pairs available after processing 14035066 (86.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 4 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 3 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 3 0.00% 32 3 0.00% 33 2 0.00% 34 2 0.00% 35 6 0.00% 36 4 0.00% 37 3 0.00% 38 3 0.00% 39 9 0.00% 40 4 0.00% 41 3 0.00% 42 5 0.00% 43 9 0.00% 44 11 0.00% 45 14 0.00% 46 9 0.00% 47 11 0.00% 48 14 0.00% 49 21 0.00% 50 21 0.00% 51 28 0.00% 52 33 0.00% 53 40 0.00% 54 31 0.00% 55 50 0.00% 56 60 0.00% 57 67 0.00% 58 60 0.00% 59 101 0.00% 60 108 0.00% 61 139 0.00% 62 164 0.00% 63 145 0.00% 64 194 0.00% 65 232 0.00% 66 273 0.00% 67 319 0.00% 68 334 0.00% 69 421 0.00% 70 501 0.00% 71 600 0.00% 72 663 0.00% 73 856 0.01% 74 951 0.01% 75 1036 0.01% 76 1171 0.01% 77 1296 0.01% 78 1507 0.01% 79 1710 0.01% 80 2002 0.01% 81 2253 0.01% 82 2659 0.02% 83 2996 0.02% 84 3382 0.02% 85 3820 0.02% 86 4141 0.03% 87 4563 0.03% 88 5027 0.03% 89 5355 0.03% 90 5847 0.04% 91 6629 0.04% 92 7550 0.05% 93 8277 0.05% 94 9170 0.06% 95 9715 0.06% 96 10742 0.07% 97 11050 0.07% 98 11750 0.07% 99 12394 0.08% 100 13262 0.08% 101 14338 0.09% 102 15148 0.09% 103 16843 0.10% 104 17474 0.11% 105 18906 0.12% 106 19693 0.12% 107 20570 0.13% 108 20908 0.13% 109 21648 0.13% 110 22564 0.14% 111 24117 0.15% 112 25076 0.15% 113 26402 0.16% 114 28109 0.17% 115 29832 0.18% 116 31549 0.19% 117 34453 0.21% 118 36674 0.23% 119 34733 0.21% 120 34195 0.21% 121 34774 0.21% 122 36098 0.22% 123 37482 0.23% 124 39526 0.24% 125 40813 0.25% 126 42989 0.26% 127 43799 0.27% 128 44078 0.27% 129 45109 0.28% 130 45711 0.28% 131 46725 0.29% 132 48155 0.30% 133 49785 0.31% 134 51529 0.32% 135 53287 0.33% 136 53937 0.33% 137 54970 0.34% 138 56372 0.35% 139 56786 0.35% 140 58474 0.36% 141 63554 0.39% 142 63547 0.39% 143 65582 0.40% 144 65543 0.40% 145 68736 0.42% 146 64774 0.40% 147 66276 0.41% 148 70055 0.43% 149 67791 0.42% 150 73995 0.45% 151 14035066 86.13% 16294392 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=8.60 fanout-score-rank=10 prefix-density=0.65 prefix-fanout=2.7 sequence=TTCTCAGCACCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=84.11 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=15.7 sequence=TCCTTCTTCTCCACGCTCTTGATAACTCCCACAGCAACGGTCTGGCGCATGTCCCTCAC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=4.60 fanout-score-rank=21 prefix-density=0.39 prefix-fanout=3.6 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=38.89 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=12.3 sequence=GAGAAGGCAATGAGAGATGC SRR7171473 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:30:31 Started mapping on | Feb 13 19:30:32 Finished on | Feb 13 19:32:37 Mapping speed, Million of reads per hour | 469.28 Number of input reads | 16294392 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15048903 Uniquely mapped reads % | 92.36% Average mapped length | 294.51 Number of splices: Total | 15047781 Number of splices: Annotated (sjdb) | 14776886 Number of splices: GT/AG | 14809281 Number of splices: GC/AG | 189540 Number of splices: AT/AC | 11050 Number of splices: Non-canonical | 37910 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 397537 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 118421 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.29% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 847952 847952 847952 N_multimapping 397537 397537 397537 N_noFeature 347404 14930319 395377 N_ambiguous 148914 715 77883 UnstrandedReadsAssigned:14552585 PositiveStrandReadsAssigned:117869 NegativeStrandReadsAssigned:14575643 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171473 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171473-trimmed-pair1.fastq SRR7171473-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,294,392 reads, 14,630,814 reads pseudoaligned [quant] estimated average fragment length: 221.242 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7171473.ke.tsv 34699 SRR7171473.se.tsv 87100 total ==> SRR7171473.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.76 1132 42.3121 Potri.005G024800.1.v4.1 1035 814.758 175 14.4331 Potri.004G059700.1.v4.1 961 740.768 33 2.99351 Potri.007G009000.2.v4.1 1416 1195.76 0 0 Potri.003G141000.2.v4.1 2943 2722.76 356.106 8.78859 Potri.016G087400.1.v4.1 270 85.9174 1151.33 900.464 Potri.015G069301.1.v4.1 564 345.767 0 0 Potri.010G195200.1.v4.1 1773 1552.76 430 18.6086 Potri.012G127500.1.v4.1 977 756.758 7858 697.757 ==> SRR7171473.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 376 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 340 SRR7171473 completed mapping pipeline successfully