Starting /dee2/code/volunteer_pipeline.sh SRR7171475 current disk space = 3087546646528 free memory = 1449970124 SRR7171475 SRAfilesize 324c41f7e100921bb40373f27187874a SRR7171475.sra SRR7171475.sra file validated SRR7171475 is paired end SRR7171475 is conventional basespace SRR7171475 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171475_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0185 34.0 33.0 34.0 32.0 34.0 2 33.23275 34.0 33.0 34.0 32.0 34.0 3 33.1545 34.0 33.0 34.0 32.0 34.0 4 33.08175 34.0 33.0 34.0 32.0 34.0 5 33.16 34.0 33.0 34.0 32.0 34.0 6 36.87575 38.0 37.0 38.0 35.0 38.0 7 37.3045 38.0 38.0 38.0 36.0 38.0 8 37.428 38.0 38.0 38.0 37.0 38.0 9 37.50325 38.0 38.0 38.0 37.0 38.0 10-14 37.438500000000005 38.0 38.0 38.0 37.4 38.0 15-19 37.42195 38.0 38.0 38.0 37.0 38.0 20-24 37.4612 38.0 38.0 38.0 37.2 38.0 25-29 37.38555 38.0 38.0 38.0 37.0 38.0 30-34 37.34705 38.0 38.0 38.0 37.0 38.0 35-39 37.305899999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.34835 38.0 38.0 38.0 37.0 38.0 45-49 37.358799999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.3467 38.0 38.0 38.0 37.0 38.0 55-59 37.2666 38.0 38.0 38.0 37.0 38.0 60-64 37.21405 38.0 38.0 38.0 36.6 38.0 65-69 37.2116 38.0 38.0 38.0 36.8 38.0 70-74 37.10745 38.0 38.0 38.0 36.0 38.0 75-79 37.044650000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.99495 38.0 38.0 38.0 35.8 38.0 85-89 36.959500000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.86319999999999 38.0 38.0 38.0 35.4 38.0 95-99 36.69715 38.0 38.0 38.0 34.6 38.0 100-104 36.495799999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.47579999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.355500000000006 38.0 38.0 38.0 33.8 38.0 115-119 36.39365 38.0 38.0 38.0 34.0 38.0 120-124 36.33205 38.0 38.0 38.0 34.0 38.0 125-129 36.25514999999999 38.0 37.8 38.0 33.8 38.0 130-134 35.91615 38.0 36.6 38.0 32.0 38.0 135-139 35.621750000000006 38.0 36.0 38.0 31.0 38.0 140-144 35.49025 38.0 36.0 38.0 30.6 38.0 145-149 35.512649999999994 38.0 35.8 38.0 30.2 38.0 150-151 33.239374999999995 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 1.0 20 2.0 21 1.0 22 2.0 23 2.0 24 5.0 25 8.0 26 11.0 27 19.0 28 21.0 29 34.0 30 44.0 31 55.0 32 64.0 33 101.0 34 127.0 35 213.0 36 481.0 37 2807.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.0449635769907 11.228334589299171 9.922130118060789 37.80457171564933 2 21.2 15.15 33.7 29.95 3 20.175 19.375 25.7 34.75 4 23.549999999999997 27.625 23.525 25.3 5 23.3 31.4 24.2 21.099999999999998 6 19.2 34.625 25.624999999999996 20.549999999999997 7 14.725 26.75 39.975 18.55 8 17.625 24.55 32.025 25.8 9 17.45 24.7 34.75 23.1 10-14 20.205000000000002 28.7 27.74 23.355 15-19 19.825 28.715000000000003 27.839999999999996 23.62 20-24 19.35 28.185 28.74 23.724999999999998 25-29 19.92398479695939 28.64572914582917 27.820564112822566 23.609721944388877 30-34 19.224612306153077 28.554277138569283 28.07403701850926 24.147073536768385 35-39 19.93496748374187 28.23411705852926 27.963981990995496 23.866933466733368 40-44 20.17706197169009 28.294903216125643 28.369929475316365 23.158105336867905 45-49 19.978990545745585 28.988044620079034 27.447351308088642 23.58561352608674 50-54 19.766976697669765 28.71287128712871 27.662766276627664 23.857385738573857 55-59 20.375 28.494999999999997 27.495000000000005 23.635 60-64 19.985 28.565 27.395000000000003 24.055 65-69 20.095 28.335 28.09 23.48 70-74 20.31 28.465 27.439999999999998 23.785 75-79 20.125 28.294999999999998 27.675 23.905 80-84 20.630000000000003 27.01 28.044999999999998 24.315 85-89 20.52 27.439999999999998 28.249999999999996 23.79 90-94 20.51 27.91 27.99 23.59 95-99 20.424999999999997 28.27 27.834999999999997 23.47 100-104 20.69 28.585 27.26 23.465 105-109 20.435 27.834999999999997 28.125 23.605 110-114 19.875 27.889999999999997 27.584999999999997 24.65 115-119 21.16 28.194999999999997 27.235 23.41 120-124 20.285 27.894999999999996 27.55 24.27 125-129 20.585 27.779999999999998 27.465 24.169999999999998 130-134 21.29 28.325 27.155 23.23 135-139 21.529999999999998 27.589999999999996 26.834999999999997 24.044999999999998 140-144 20.455000000000002 27.445000000000004 27.794999999999998 24.305 145-149 20.985 28.005000000000003 26.905 24.104999999999997 150-151 20.65 27.9375 26.7125 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 1.0 25 0.5 26 2.5 27 6.0 28 9.0 29 9.0 30 12.5 31 18.5 32 30.0 33 39.0 34 42.5 35 63.5 36 80.5 37 101.5 38 132.5 39 168.5 40 208.0 41 221.0 42 228.5 43 256.0 44 280.5 45 290.5 46 280.0 47 259.0 48 241.0 49 211.0 50 187.0 51 160.5 52 113.0 53 75.5 54 65.0 55 52.5 56 35.5 57 30.5 58 22.0 59 12.5 60 10.5 61 10.5 62 7.0 63 2.5 64 2.5 65 2.0 66 1.0 67 2.0 68 3.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.05 35-39 0.05 40-44 0.034999999999999996 45-49 0.045 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.6 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.9625 0.0 0.0 0.0 0.0 128-129 4.3875 0.0 0.0 0.0 0.0 130-131 4.699999999999999 0.0 0.0 0.0 0.0 132-133 5.175 0.0 0.0 0.0 0.0 134-135 5.675 0.0 0.0 0.0 0.0 136-137 6.225 0.0 0.0 0.0 0.0 138-139 6.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGCGA 10 0.006830828 145.0 2 CGGCGAT 10 0.006830828 145.0 3 >>END_MODULE SRR7171475 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171475_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61725 33.0 33.0 34.0 32.0 34.0 2 32.619 33.0 33.0 34.0 32.0 34.0 3 32.67625 34.0 33.0 34.0 32.0 34.0 4 32.48125 34.0 33.0 34.0 31.0 34.0 5 32.55625 34.0 33.0 34.0 32.0 34.0 6 36.46525 38.0 38.0 38.0 34.0 38.0 7 36.44 38.0 38.0 38.0 34.0 38.0 8 36.40725 38.0 38.0 38.0 34.0 38.0 9 36.43275 38.0 38.0 38.0 34.0 38.0 10-14 36.58105 38.0 38.0 38.0 34.4 38.0 15-19 36.796749999999996 38.0 38.0 38.0 35.8 38.0 20-24 36.868900000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.920500000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.97125 38.0 38.0 38.0 36.4 38.0 35-39 36.93300000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.8843 38.0 38.0 38.0 36.0 38.0 45-49 36.8591 38.0 38.0 38.0 36.0 38.0 50-54 36.7482 38.0 38.0 38.0 35.8 38.0 55-59 36.733900000000006 38.0 38.0 38.0 35.4 38.0 60-64 36.75235 38.0 38.0 38.0 35.8 38.0 65-69 36.7648 38.0 38.0 38.0 35.8 38.0 70-74 36.78465 38.0 38.0 38.0 35.6 38.0 75-79 36.850100000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.81895000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.709900000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.57335 38.0 38.0 38.0 34.4 38.0 95-99 36.42725 38.0 38.0 38.0 34.0 38.0 100-104 36.3543 38.0 38.0 38.0 34.0 38.0 105-109 36.2526 38.0 38.0 38.0 33.8 38.0 110-114 36.23025 38.0 38.0 38.0 34.0 38.0 115-119 35.8551 38.0 37.2 38.0 31.6 38.0 120-124 35.858050000000006 38.0 37.0 38.0 31.6 38.0 125-129 35.772850000000005 38.0 37.0 38.0 31.0 38.0 130-134 35.63735 38.0 36.0 38.0 31.0 38.0 135-139 35.3895 38.0 36.0 38.0 29.2 38.0 140-144 35.0034 38.0 35.2 38.0 27.4 38.0 145-149 34.63475 38.0 35.0 38.0 23.6 38.0 150-151 32.175125 35.5 28.0 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 1.0 15 4.0 16 3.0 17 5.0 18 5.0 19 6.0 20 8.0 21 9.0 22 7.0 23 12.0 24 14.0 25 14.0 26 24.0 27 27.0 28 38.0 29 25.0 30 50.0 31 44.0 32 79.0 33 110.0 34 134.0 35 219.0 36 516.0 37 2638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.80485364023017 20.740555416562422 13.93545158869152 25.519139354515886 2 25.807259073842303 26.48310387984981 30.16270337922403 17.546933667083856 3 20.745745745745744 28.37837837837838 29.704704704704703 21.17117117117117 4 23.1981981981982 33.88388388388389 24.4994994994995 18.41841841841842 5 24.25531914893617 35.91989987484355 22.02753441802253 17.797246558197745 6 21.31394182547643 37.136409227683046 23.19458375125376 18.35506519558676 7 19.37829029832038 21.38380546502883 39.23289044873402 20.00501378791677 8 22.500626409421198 24.931094963668254 28.46404409922325 24.104234527687296 9 21.31394182547643 25.877632898696092 29.36308926780341 23.44533600802407 10-14 24.026071697167207 28.58861870142893 25.966407620957632 21.41890198044623 15-19 23.479263828293465 28.83004864349832 26.799057218795447 20.89163030941277 20-24 23.14057876523396 28.622298008927228 27.152816089071667 21.084307136767137 25-29 23.669172932330827 28.581453634085214 27.25814536340852 20.49122807017544 30-34 22.83783783783784 28.43843843843844 27.642642642642645 21.08108108108108 35-39 23.365187371791666 28.013208585580628 27.64797118126782 20.973632861359885 40-44 23.530295443164746 28.047070605908864 27.356034051076616 21.066599899849773 45-49 23.118953330994035 27.986365231339917 27.815930623088875 21.07875081457717 50-54 23.298731257208765 28.47399829497016 27.83210470889123 20.395165738929844 55-59 23.551833090927328 28.26621194643663 27.453733888359494 20.728221074276544 60-64 23.599618875683266 27.576350233187902 27.65157213780653 21.172458753322303 65-69 23.18215985968429 28.479077925331996 27.572037083437735 20.76672513154598 70-74 23.849812265331664 28.871088861076345 26.87359198998748 20.405506883604506 75-79 24.19709854927464 28.16408204102051 27.5887943971986 20.050025012506254 80-84 23.846923461730864 27.77888944472236 27.613806903451728 20.76038019009505 85-89 23.987788398979028 27.82643511335769 27.636254441719633 20.549522045943647 90-94 23.91042981665164 28.128444043682997 27.30688307784791 20.654243061817454 95-99 24.131187001654883 27.922370994433578 27.812045534326263 20.134396469585276 100-104 24.282560706401764 27.975115392333937 27.292795504716032 20.449528396548263 105-109 24.182219546457954 28.27613887216536 27.23259080874975 20.309050772626932 110-114 24.0054181508052 27.773039682937846 27.73290523252897 20.48863693372799 115-119 24.31022373833651 27.861944416574698 27.34022273502558 20.48760911006321 120-124 24.407000651923173 28.39877639035154 27.004663758086355 20.189559199638936 125-129 24.494190705128204 28.18008814102564 27.313701923076923 20.012019230769234 130-134 24.60452543051662 28.203844613536244 27.13255907088506 20.059070885062074 135-139 24.333400160384926 27.681435445068164 27.21030473135525 20.774859663191663 140-144 25.00627037873088 27.805367444193628 27.148231753197894 20.040130423877603 145-149 25.426449929761187 27.83965482640979 26.750953241019467 19.982942002809555 150-151 24.630047654878354 27.48934035615751 27.552044143466265 20.32856784549787 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 1.5 26 2.5 27 4.5 28 6.0 29 7.5 30 12.0 31 12.0 32 11.0 33 20.5 34 33.5 35 47.5 36 65.5 37 97.5 38 127.0 39 161.0 40 213.0 41 246.0 42 257.5 43 294.0 44 310.0 45 295.5 46 288.5 47 260.5 48 228.0 49 200.5 50 159.5 51 133.0 52 124.0 53 98.0 54 76.5 55 55.0 56 35.5 57 29.5 58 19.5 59 13.0 60 13.5 61 9.0 62 2.5 63 2.5 64 3.5 65 1.5 66 1.0 67 2.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.125 3 0.1 4 0.1 5 0.125 6 0.3 7 0.27499999999999997 8 0.22499999999999998 9 0.3 10-14 0.27499999999999997 15-19 0.295 20-24 0.305 25-29 0.25 30-34 0.1 35-39 0.065 40-44 0.15 45-49 0.255 50-54 0.295 55-59 0.305 60-64 0.295 65-69 0.22499999999999998 70-74 0.125 75-79 0.05 80-84 0.05 85-89 0.095 90-94 0.19 95-99 0.295 100-104 0.33999999999999997 105-109 0.33999999999999997 110-114 0.335 115-119 0.33 120-124 0.295 125-129 0.16 130-134 0.12 135-139 0.24 140-144 0.325 145-149 0.33999999999999997 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.3263871453678132 0.65 3 0.0 0.0 4 0.0 0.0 5 0.025106703489831784 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.35 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.3625 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 5.1125 0.0 0.0 0.0 0.0 134-135 5.6 0.0 0.0 0.0 0.0 136-137 6.175000000000001 0.0 0.0 0.0 0.0 138-139 6.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926242 spots for SRR7171475.sra Written 926242 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra Read 926232 spots for SRR7171475.sra Written 926232 spots for SRR7171475.sra SRR ids: ['SRR7171475.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a6ru9s50 SRR7171475.sra spots: 18524650 blocks: [[1, 926232], [926233, 1852464], [1852465, 2778696], [2778697, 3704928], [3704929, 4631160], [4631161, 5557392], [5557393, 6483624], [6483625, 7409856], [7409857, 8336088], [8336089, 9262320], [9262321, 10188552], [10188553, 11114784], [11114785, 12041016], [12041017, 12967248], [12967249, 13893480], [13893481, 14819712], [14819713, 15745944], [15745945, 16672176], [16672177, 17598408], [17598409, 18524650]] SRR7171475 file size 6255695 SRR7171475 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171475 SRR7171475_1.fastq SRR7171475_2.fastq Input file: SRR7171475_1.fastq Paired file: SRR7171475_2.fastq trimmed: SRR7171475-trimmed-pair1.fastq, SRR7171475-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:05:56 2025 >> started Thu Feb 13 19:06:17 2025 >> done (20.331s) 18524650 read pairs processed; of these: 863 ( 0.00%) short read pairs filtered out after trimming by size control 2618 ( 0.01%) empty read pairs filtered out after trimming by size control 18521169 (99.98%) read pairs available; of these: 2077281 (11.22%) trimmed read pairs available after processing 16443888 (88.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 3 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 2 0.00% 30 2 0.00% 31 2 0.00% 32 4 0.00% 33 3 0.00% 34 0 0.00% 35 2 0.00% 36 0 0.00% 37 1 0.00% 38 0 0.00% 39 3 0.00% 40 4 0.00% 41 2 0.00% 42 6 0.00% 43 3 0.00% 44 3 0.00% 45 8 0.00% 46 6 0.00% 47 4 0.00% 48 8 0.00% 49 6 0.00% 50 18 0.00% 51 18 0.00% 52 17 0.00% 53 30 0.00% 54 30 0.00% 55 33 0.00% 56 28 0.00% 57 29 0.00% 58 59 0.00% 59 44 0.00% 60 73 0.00% 61 97 0.00% 62 103 0.00% 63 103 0.00% 64 133 0.00% 65 133 0.00% 66 153 0.00% 67 187 0.00% 68 265 0.00% 69 256 0.00% 70 288 0.00% 71 371 0.00% 72 486 0.00% 73 490 0.00% 74 600 0.00% 75 689 0.00% 76 776 0.00% 77 891 0.00% 78 999 0.01% 79 1157 0.01% 80 1345 0.01% 81 1464 0.01% 82 1850 0.01% 83 1997 0.01% 84 2275 0.01% 85 2644 0.01% 86 2867 0.02% 87 3097 0.02% 88 3434 0.02% 89 3868 0.02% 90 4281 0.02% 91 4881 0.03% 92 5341 0.03% 93 6093 0.03% 94 6570 0.04% 95 7381 0.04% 96 7619 0.04% 97 8317 0.04% 98 8733 0.05% 99 9409 0.05% 100 10279 0.06% 101 10937 0.06% 102 12103 0.07% 103 12888 0.07% 104 13845 0.07% 105 14994 0.08% 106 16015 0.09% 107 16732 0.09% 108 17123 0.09% 109 18170 0.10% 110 18841 0.10% 111 19846 0.11% 112 21201 0.11% 113 22512 0.12% 114 24111 0.13% 115 25795 0.14% 116 27846 0.15% 117 31493 0.17% 118 31923 0.17% 119 30183 0.16% 120 29891 0.16% 121 31273 0.17% 122 32268 0.17% 123 34263 0.18% 124 35847 0.19% 125 37419 0.20% 126 38673 0.21% 127 39760 0.21% 128 41026 0.22% 129 41427 0.22% 130 42763 0.23% 131 43548 0.24% 132 44926 0.24% 133 47144 0.25% 134 48937 0.26% 135 51371 0.28% 136 52250 0.28% 137 53573 0.29% 138 54522 0.29% 139 55382 0.30% 140 56364 0.30% 141 60848 0.33% 142 64590 0.35% 143 61744 0.33% 144 64147 0.35% 145 70322 0.38% 146 65716 0.35% 147 69367 0.37% 148 68270 0.37% 149 68930 0.37% 150 71781 0.39% 151 16443888 88.78% 18521169 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=5.68 fanout-score-rank=17 prefix-density=0.78 prefix-fanout=2.1 sequence=TTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=48.64 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.6 sequence=GATATCATAATGACTGAAAAACATCTTACATTGCTTAATCAAACACACGCTAGCTCGCTTATAAGCGCCCCTAGTTAAGGGAAACCTTTATTTAATAAAGTCACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACCATTGTCATAAGATGTA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=24 prefix-density=0.48 prefix-fanout=3.1 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=33.33 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=10.4 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7171475 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:07:03 Started mapping on | Feb 13 19:07:03 Finished on | Feb 13 19:09:36 Mapping speed, Million of reads per hour | 435.79 Number of input reads | 18521169 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17285399 Uniquely mapped reads % | 93.33% Average mapped length | 296.03 Number of splices: Total | 16994632 Number of splices: Annotated (sjdb) | 16661282 Number of splices: GT/AG | 16724866 Number of splices: GC/AG | 211609 Number of splices: AT/AC | 13224 Number of splices: Non-canonical | 44933 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 469438 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 45777 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 766333 766333 766333 N_multimapping 469438 469438 469438 N_noFeature 431409 17124556 494952 N_ambiguous 177960 784 80324 UnstrandedReadsAssigned:16676030 PositiveStrandReadsAssigned:160059 NegativeStrandReadsAssigned:16710123 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171475 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171475-trimmed-pair1.fastq SRR7171475-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,521,169 reads, 16,748,938 reads pseudoaligned [quant] estimated average fragment length: 229.895 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7171475.ke.tsv 34699 SRR7171475.se.tsv 87100 total ==> SRR7171475.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.1 1715 53.1049 Potri.005G024800.1.v4.1 1035 806.105 227 15.6006 Potri.004G059700.1.v4.1 961 732.105 65 4.91865 Potri.007G009000.2.v4.1 1416 1187.1 0 0 Potri.003G141000.2.v4.1 2943 2714.1 622.168 12.6995 Potri.016G087400.1.v4.1 270 81.5465 1242.42 844.049 Potri.015G069301.1.v4.1 564 337.917 0 0 Potri.010G195200.1.v4.1 1773 1544.1 377 13.526 Potri.012G127500.1.v4.1 977 748.105 7679 568.654 ==> SRR7171475.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 69 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 505 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 312 SRR7171475 completed mapping pipeline successfully