Starting /dee2/code/volunteer_pipeline.sh SRR7171476 current disk space = 3087597146112 free memory = 1576531784 SRR7171476 SRAfilesize 850e39a1e8b930d49a924972cb19f613 SRR7171476.sra SRR7171476.sra file validated SRR7171476 is paired end SRR7171476 is conventional basespace SRR7171476 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171476_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9235 34.0 33.0 34.0 32.0 34.0 2 33.232 34.0 33.0 34.0 33.0 34.0 3 32.57725 33.0 33.0 34.0 31.0 34.0 4 33.15075 34.0 33.0 34.0 32.0 34.0 5 33.2155 34.0 33.0 34.0 32.0 34.0 6 36.879 38.0 37.0 38.0 35.0 38.0 7 37.4015 38.0 38.0 38.0 37.0 38.0 8 37.53775 38.0 38.0 38.0 37.0 38.0 9 37.626 38.0 38.0 38.0 38.0 38.0 10-14 37.5748 38.0 38.0 38.0 38.0 38.0 15-19 37.49895 38.0 38.0 38.0 38.0 38.0 20-24 37.401349999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.46715 38.0 38.0 38.0 37.6 38.0 30-34 37.55405 38.0 38.0 38.0 38.0 38.0 35-39 36.325100000000006 38.0 37.6 38.0 31.6 38.0 40-44 37.0758 38.0 38.0 38.0 34.6 38.0 45-49 37.38385000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.34935 38.0 38.0 38.0 37.0 38.0 55-59 37.23075 38.0 38.0 38.0 37.0 38.0 60-64 37.307599999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.273399999999995 38.0 38.0 38.0 36.6 38.0 70-74 34.52985 33.6 33.6 37.8 32.0 38.0 75-79 35.2782 36.0 35.0 38.0 32.0 38.0 80-84 37.142649999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.16685 38.0 38.0 38.0 36.0 38.0 90-94 37.10445 38.0 38.0 38.0 36.0 38.0 95-99 37.033699999999996 38.0 38.0 38.0 35.8 38.0 100-104 36.944849999999995 38.0 38.0 38.0 35.6 38.0 105-109 36.80915 38.0 38.0 38.0 35.0 38.0 110-114 36.7093 38.0 38.0 38.0 34.8 38.0 115-119 36.562850000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.42335 38.0 38.0 38.0 33.8 38.0 125-129 36.3315 38.0 37.8 38.0 33.8 38.0 130-134 36.141650000000006 38.0 37.2 38.0 33.0 38.0 135-139 36.140600000000006 38.0 37.0 38.0 33.0 38.0 140-144 36.02890000000001 38.0 36.6 38.0 33.0 38.0 145-149 35.830799999999996 38.0 36.0 38.0 32.0 38.0 150-151 33.423125 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 2.0 20 0.0 21 2.0 22 1.0 23 1.0 24 5.0 25 14.0 26 9.0 27 9.0 28 26.0 29 18.0 30 38.0 31 47.0 32 50.0 33 88.0 34 125.0 35 213.0 36 717.0 37 2634.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.539042821158695 11.28463476070529 9.748110831234257 40.42821158690176 2 21.6 13.975000000000001 33.675 30.75 3 20.849999999999998 18.6 24.224999999999998 36.325 4 23.599999999999998 25.1 23.7 27.6 5 23.200000000000003 28.475 24.775 23.549999999999997 6 20.25 33.25 26.3 20.200000000000003 7 15.675 25.025 41.8 17.5 8 18.7 26.55 30.375000000000004 24.375 9 17.0 24.675 35.35 22.975 10-14 19.715 29.575000000000003 27.765 22.945 15-19 19.950000000000003 27.810000000000002 28.360000000000003 23.880000000000003 20-24 19.93 27.529999999999998 28.77 23.77 25-29 20.165 28.62 27.685 23.53 30-34 20.171008550427523 28.491424571228563 27.67638381919096 23.661183059152957 35-39 20.101005050252514 28.41642082104105 27.416370818540926 24.066203310165506 40-44 19.99 28.575 27.525 23.91 45-49 19.75098754937747 27.896394819740987 27.991399569978498 24.361218060903045 50-54 19.665 27.975 28.24 24.12 55-59 20.4 28.060000000000002 28.12 23.419999999999998 60-64 20.200000000000003 27.625 28.050000000000004 24.125 65-69 20.23 28.084999999999997 28.08 23.605 70-74 21.545 28.99 25.895000000000003 23.57 75-79 20.49 28.144999999999996 27.575 23.79 80-84 21.145 27.67 27.634999999999998 23.549999999999997 85-89 20.335 27.74 27.57 24.355 90-94 20.974999999999998 28.46 27.284999999999997 23.28 95-99 20.51 28.17 26.955000000000002 24.365000000000002 100-104 21.09 28.17 27.275 23.465 105-109 20.47 28.09 27.21 24.23 110-114 20.775 28.115000000000002 27.589999999999996 23.52 115-119 21.125 28.015 27.075 23.785 120-124 21.2 27.83 27.125 23.845 125-129 21.12 27.950000000000003 26.99 23.94 130-134 21.495 27.389999999999997 26.965 24.15 135-139 21.005 28.415000000000003 26.779999999999998 23.799999999999997 140-144 21.349999999999998 27.97 26.625 24.055 145-149 21.5 27.91 26.35 24.240000000000002 150-151 21.25 28.249999999999996 26.025 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 1.5 23 0.5 24 2.0 25 2.5 26 2.5 27 5.0 28 7.0 29 9.0 30 13.0 31 17.0 32 27.0 33 34.5 34 39.5 35 59.0 36 68.0 37 81.5 38 118.5 39 150.5 40 178.5 41 224.0 42 262.5 43 272.0 44 276.0 45 285.0 46 283.0 47 277.0 48 251.0 49 198.0 50 166.0 51 143.5 52 124.0 53 114.5 54 83.0 55 54.0 56 42.5 57 29.5 58 22.0 59 19.5 60 17.0 61 9.5 62 6.5 63 5.5 64 4.0 65 4.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.275 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.5750000000000002 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.1 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.4749999999999996 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.625 0.0 0.0 0.0 0.0 116-117 4.125 0.0 0.0 0.0 0.0 118-119 4.4875 0.0 0.0 0.0 0.0 120-121 4.887499999999999 0.0 0.0 0.0 0.0 122-123 5.425 0.0 0.0 0.0 0.0 124-125 5.925000000000001 0.0 0.0 0.0 0.0 126-127 6.5 0.0 0.0 0.0 0.0 128-129 7.2 0.0 0.0 0.0 0.0 130-131 8.024999999999999 0.0 0.0 0.0 0.0 132-133 8.825 0.0 0.0 0.0 0.0 134-135 9.649999999999999 0.0 0.0 0.0 0.0 136-137 10.45 0.0 0.0 0.0 0.0 138-139 11.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAATCC 10 0.006832588 144.9875 9 >>END_MODULE SRR7171476 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171476_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0395 33.0 33.0 34.0 32.0 34.0 2 33.0745 34.0 33.0 34.0 32.0 34.0 3 33.117 34.0 33.0 34.0 33.0 34.0 4 33.145 34.0 33.0 34.0 33.0 34.0 5 33.101 34.0 33.0 34.0 33.0 34.0 6 37.31625 38.0 38.0 38.0 37.0 38.0 7 37.25575 38.0 38.0 38.0 37.0 38.0 8 37.24975 38.0 38.0 38.0 37.0 38.0 9 37.274 38.0 38.0 38.0 37.0 38.0 10-14 37.2701 38.0 38.0 38.0 37.0 38.0 15-19 37.236250000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.1957 38.0 38.0 38.0 37.0 38.0 25-29 37.214549999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.24335 38.0 38.0 38.0 37.0 38.0 35-39 37.1622 38.0 38.0 38.0 37.0 38.0 40-44 37.00875 38.0 38.0 38.0 36.2 38.0 45-49 37.095349999999996 38.0 38.0 38.0 36.6 38.0 50-54 37.111599999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.141749999999995 38.0 38.0 38.0 36.8 38.0 60-64 37.03685 38.0 38.0 38.0 36.4 38.0 65-69 37.091049999999996 38.0 38.0 38.0 36.6 38.0 70-74 37.063900000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.0529 38.0 38.0 38.0 36.0 38.0 80-84 37.003499999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.924899999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.729 38.0 38.0 38.0 35.4 38.0 95-99 36.7273 38.0 38.0 38.0 35.0 38.0 100-104 36.64915 38.0 38.0 38.0 35.0 38.0 105-109 36.64215 38.0 38.0 38.0 34.6 38.0 110-114 36.47945 38.0 38.0 38.0 34.2 38.0 115-119 36.38595 38.0 38.0 38.0 34.0 38.0 120-124 36.17615 38.0 38.0 38.0 33.4 38.0 125-129 36.01625 38.0 37.6 38.0 32.6 38.0 130-134 36.09345 38.0 37.4 38.0 33.2 38.0 135-139 35.760999999999996 38.0 36.4 38.0 31.8 38.0 140-144 35.547399999999996 38.0 36.0 38.0 30.6 38.0 145-149 35.1457 38.0 35.8 38.0 28.2 38.0 150-151 32.441625 35.5 29.0 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 3.0 16 0.0 17 1.0 18 1.0 19 0.0 20 3.0 21 7.0 22 10.0 23 9.0 24 9.0 25 12.0 26 14.0 27 13.0 28 22.0 29 40.0 30 33.0 31 51.0 32 63.0 33 74.0 34 116.0 35 197.0 36 438.0 37 2877.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.23380845211303 20.505126281570394 15.853963490872719 28.40710177544386 2 25.58838257386079 25.78868302453681 29.494241362043066 19.128693039559337 3 19.94993742177722 28.8360450563204 30.58823529411765 20.625782227784732 4 22.934401602403607 33.350025037556335 24.18627941912869 19.529293940911366 5 25.043826696719258 34.73578762834961 22.814926120711245 17.405459554219885 6 22.069138276553108 36.998997995991985 23.672344689378757 17.259519038076153 7 20.465931863727455 21.668336673346694 37.77555110220441 20.090180360721444 8 22.739794640621085 25.269221136989735 27.172551965940393 24.818432256448787 9 21.092184368737474 25.576152304609217 30.135270541082164 23.196392785571142 10-14 23.326653306613228 28.406813627254508 26.57815631262525 21.688376753507015 15-19 23.366733466933866 28.336673346693388 27.214428857715433 21.082164328657317 20-24 22.704273332999346 29.14683633084515 27.22809478483042 20.92079555132508 25-29 23.728898462154987 28.67304513349697 26.6242548715123 20.973801532835743 30-34 23.483179815778936 29.139967961553864 26.636964357228678 20.739887865438526 35-39 23.095011757642467 28.718667133636867 27.40781507980187 20.778506028918798 40-44 24.05006257822278 28.05006257822278 26.893617021276594 21.006257822277846 45-49 23.95812462432378 27.684832698857942 27.960328591464634 20.396714085353636 50-54 23.98557258791704 27.707644524596738 27.311892595932267 20.994890291553954 55-59 23.696207604829418 27.94950152797956 27.769149842192277 20.585141024998748 60-64 23.16633266533066 28.191382765531063 27.324649298597194 21.317635270541082 65-69 23.75275495892607 27.554598276898417 27.94029252654779 20.752354237627728 70-74 24.04923939151321 28.077461969575662 27.562049639711773 20.31124899919936 75-79 24.060000000000002 27.16 27.825 20.955 80-84 23.724999999999998 28.360000000000003 27.16 20.755000000000003 85-89 24.272136068034015 28.07903951975988 27.303651825912954 20.34517258629315 90-94 24.227552706695377 28.519204767389457 27.758024938654913 19.495217587260253 95-99 24.27855711422846 28.306613226452903 27.17935871743487 20.23547094188377 100-104 24.47506890503633 27.762465547481835 27.536958155850666 20.22550739163117 105-109 24.22207746655309 28.135491306308563 27.253595229743947 20.3888359973944 110-114 24.02766639935846 27.987169206094624 27.646351242983158 20.338813151563752 115-119 24.25973245152563 28.062528182774688 27.56651134826394 20.111228017435742 120-124 24.91108550819015 28.096979411912038 26.73946801582928 20.252467064068526 125-129 24.49551850182765 27.96054278704121 26.78884382354414 20.755094887587 130-134 25.615862207089922 27.7438413779291 26.847586621269777 19.792709793711197 135-139 25.703837290852622 27.95812042881475 26.815950305580603 19.52209197475203 140-144 25.48872180451128 28.25062656641604 26.401002506265662 19.859649122807017 145-149 26.037489975942265 27.83179631114675 26.227947072975137 19.902766639935844 150-151 26.158857429215736 28.07567025808068 26.421949386118765 19.343522926584818 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 1.5 20 1.5 21 0.5 22 1.0 23 0.5 24 0.5 25 2.0 26 3.5 27 2.5 28 2.5 29 4.5 30 5.0 31 5.5 32 10.0 33 20.5 34 30.5 35 49.5 36 76.5 37 99.5 38 141.0 39 187.5 40 202.0 41 221.0 42 257.5 43 280.0 44 291.0 45 296.5 46 291.0 47 262.5 48 237.0 49 205.5 50 173.0 51 154.0 52 125.5 53 93.0 54 62.0 55 44.0 56 37.0 57 25.5 58 17.5 59 14.0 60 12.5 61 13.5 62 9.0 63 7.0 64 3.5 65 1.0 66 1.0 67 2.0 68 3.0 69 2.5 70 2.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.15 3 0.125 4 0.15 5 0.17500000000000002 6 0.2 7 0.2 8 0.17500000000000002 9 0.2 10-14 0.2 15-19 0.2 20-24 0.19499999999999998 25-29 0.185 30-34 0.12 35-39 0.065 40-44 0.125 45-49 0.18 50-54 0.19 55-59 0.19499999999999998 60-64 0.2 65-69 0.18 70-74 0.08 75-79 0.0 80-84 0.0 85-89 0.05 90-94 0.155 95-99 0.2 100-104 0.22499999999999998 105-109 0.215 110-114 0.24 115-119 0.20500000000000002 120-124 0.185 125-129 0.145 130-134 0.13999999999999999 135-139 0.19 140-144 0.25 145-149 0.24 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.9249999999999999 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.4249999999999998 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 4.050000000000001 0.0 0.0 0.0 0.0 118-119 4.4375 0.0 0.0 0.0 0.0 120-121 4.875 0.0 0.0 0.0 0.0 122-123 5.4 0.0 0.0 0.0 0.0 124-125 5.925000000000001 0.0 0.0 0.0 0.0 126-127 6.5375 0.0 0.0 0.0 0.0 128-129 7.275 0.0 0.0 0.0 0.0 130-131 8.075 0.0 0.0 0.0 0.0 132-133 8.85 0.0 0.0 0.0 0.0 134-135 9.675 0.0 0.0 0.0 0.0 136-137 10.5 0.0 0.0 0.0 0.0 138-139 11.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805859 spots for SRR7171476.sra Written 805859 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra Read 805843 spots for SRR7171476.sra Written 805843 spots for SRR7171476.sra SRR ids: ['SRR7171476.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_878lyd3r SRR7171476.sra spots: 16116876 blocks: [[1, 805843], [805844, 1611686], [1611687, 2417529], [2417530, 3223372], [3223373, 4029215], [4029216, 4835058], [4835059, 5640901], [5640902, 6446744], [6446745, 7252587], [7252588, 8058430], [8058431, 8864273], [8864274, 9670116], [9670117, 10475959], [10475960, 11281802], [11281803, 12087645], [12087646, 12893488], [12893489, 13699331], [13699332, 14505174], [14505175, 15311017], [15311018, 16116876]] SRR7171476 file size 5439780 SRR7171476 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171476 SRR7171476_1.fastq SRR7171476_2.fastq Input file: SRR7171476_1.fastq Paired file: SRR7171476_2.fastq trimmed: SRR7171476-trimmed-pair1.fastq, SRR7171476-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:05:19 2025 >> started Thu Feb 13 20:05:35 2025 >> done (16.507s) 16116876 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 3673 ( 0.02%) empty read pairs filtered out after trimming by size control 16113184 (99.98%) read pairs available; of these: 2890897 (17.94%) trimmed read pairs available after processing 13222287 (82.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 4 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 6 0.00% 33 5 0.00% 34 3 0.00% 35 9 0.00% 36 2 0.00% 37 2 0.00% 38 5 0.00% 39 3 0.00% 40 8 0.00% 41 2 0.00% 42 15 0.00% 43 10 0.00% 44 12 0.00% 45 15 0.00% 46 7 0.00% 47 19 0.00% 48 31 0.00% 49 29 0.00% 50 30 0.00% 51 35 0.00% 52 46 0.00% 53 57 0.00% 54 66 0.00% 55 84 0.00% 56 92 0.00% 57 80 0.00% 58 103 0.00% 59 134 0.00% 60 161 0.00% 61 209 0.00% 62 232 0.00% 63 258 0.00% 64 317 0.00% 65 363 0.00% 66 396 0.00% 67 455 0.00% 68 548 0.00% 69 637 0.00% 70 764 0.00% 71 855 0.01% 72 1041 0.01% 73 1278 0.01% 74 1405 0.01% 75 1515 0.01% 76 1792 0.01% 77 1998 0.01% 78 2318 0.01% 79 2574 0.02% 80 3116 0.02% 81 3510 0.02% 82 3985 0.02% 83 4421 0.03% 84 5207 0.03% 85 5687 0.04% 86 6298 0.04% 87 6843 0.04% 88 7736 0.05% 89 8352 0.05% 90 8959 0.06% 91 9993 0.06% 92 11217 0.07% 93 12199 0.08% 94 13455 0.08% 95 14703 0.09% 96 15454 0.10% 97 16522 0.10% 98 17381 0.11% 99 18239 0.11% 100 19487 0.12% 101 20734 0.13% 102 22144 0.14% 103 23784 0.15% 104 25562 0.16% 105 26887 0.17% 106 28449 0.18% 107 29333 0.18% 108 30108 0.19% 109 31297 0.19% 110 32543 0.20% 111 33597 0.21% 112 35089 0.22% 113 37242 0.23% 114 38480 0.24% 115 40881 0.25% 116 42542 0.26% 117 45480 0.28% 118 47498 0.29% 119 46174 0.29% 120 45382 0.28% 121 46899 0.29% 122 48452 0.30% 123 50093 0.31% 124 52019 0.32% 125 53118 0.33% 126 55224 0.34% 127 56306 0.35% 128 56672 0.35% 129 57405 0.36% 130 58509 0.36% 131 58986 0.37% 132 60791 0.38% 133 62632 0.39% 134 64024 0.40% 135 65733 0.41% 136 67343 0.42% 137 67995 0.42% 138 68968 0.43% 139 69839 0.43% 140 71269 0.44% 141 75192 0.47% 142 75054 0.47% 143 76876 0.48% 144 77238 0.48% 145 79830 0.50% 146 76907 0.48% 147 78092 0.48% 148 81041 0.50% 149 78263 0.49% 150 84119 0.52% 151 13222287 82.06% 16113184 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=5.93 fanout-score-rank=10 prefix-density=0.74 prefix-fanout=3.1 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=23.87 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=5.1 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.64 fanout-score-rank=18 prefix-density=0.49 prefix-fanout=3.4 sequence=CAGAAAATGTCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=42.41 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=13.7 sequence=GAGAAGGCAATGAGAGATGC SRR7171476 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:06:24 Started mapping on | Feb 13 20:06:24 Finished on | Feb 13 20:08:53 Mapping speed, Million of reads per hour | 389.31 Number of input reads | 16113184 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14790034 Uniquely mapped reads % | 91.79% Average mapped length | 292.30 Number of splices: Total | 14595079 Number of splices: Annotated (sjdb) | 14313568 Number of splices: GT/AG | 14352782 Number of splices: GC/AG | 187937 Number of splices: AT/AC | 11084 Number of splices: Non-canonical | 43276 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 397898 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 67612 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.20% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 925252 925252 925252 N_multimapping 397898 397898 397898 N_noFeature 362636 14661375 414285 N_ambiguous 148820 555 71706 UnstrandedReadsAssigned:14278578 PositiveStrandReadsAssigned:128104 NegativeStrandReadsAssigned:14304043 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171476 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171476-trimmed-pair1.fastq SRR7171476-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,113,184 reads, 14,342,251 reads pseudoaligned [quant] estimated average fragment length: 210.676 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR7171476.ke.tsv 34699 SRR7171476.se.tsv 87100 total ==> SRR7171476.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.32 1155 43.4858 Potri.005G024800.1.v4.1 1035 825.324 202 16.6636 Potri.004G059700.1.v4.1 961 751.341 35 3.17155 Potri.007G009000.2.v4.1 1416 1206.32 0 0 Potri.003G141000.2.v4.1 2943 2733.32 512 12.7532 Potri.016G087400.1.v4.1 270 91.427 1242 924.887 Potri.015G069301.1.v4.1 564 355.81 0 0 Potri.010G195200.1.v4.1 1773 1563.32 365 15.8959 Potri.012G127500.1.v4.1 977 767.341 4698 416.836 ==> SRR7171476.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 512 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 449 SRR7171476 completed mapping pipeline successfully