Starting /dee2/code/volunteer_pipeline.sh SRR7171477 current disk space = 3113991049216 free memory = 1571858608 SRR7171477 SRAfilesize d0f52a68eaabe99cd61edccc4f09dd14 SRR7171477.sra SRR7171477.sra file validated SRR7171477 is paired end SRR7171477 is conventional basespace SRR7171477 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02775 34.0 33.0 34.0 32.0 34.0 2 33.239 34.0 33.0 34.0 32.0 34.0 3 33.03525 34.0 33.0 34.0 32.0 34.0 4 33.07225 34.0 33.0 34.0 32.0 34.0 5 33.2865 34.0 33.0 34.0 33.0 34.0 6 36.7855 38.0 37.0 38.0 35.0 38.0 7 37.15775 38.0 38.0 38.0 36.0 38.0 8 37.454 38.0 38.0 38.0 37.0 38.0 9 37.5465 38.0 38.0 38.0 38.0 38.0 10-14 37.5476 38.0 38.0 38.0 37.6 38.0 15-19 37.479299999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.532399999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.445350000000005 38.0 38.0 38.0 37.2 38.0 30-34 37.4321 38.0 38.0 38.0 37.2 38.0 35-39 37.44635 38.0 38.0 38.0 37.0 38.0 40-44 37.41605 38.0 38.0 38.0 37.0 38.0 45-49 37.4535 38.0 38.0 38.0 37.2 38.0 50-54 37.4019 38.0 38.0 38.0 37.0 38.0 55-59 37.35209999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.3404 38.0 38.0 38.0 37.0 38.0 65-69 37.3076 38.0 38.0 38.0 37.0 38.0 70-74 37.0963 38.0 38.0 38.0 36.2 38.0 75-79 37.01825 38.0 38.0 38.0 36.0 38.0 80-84 37.0308 38.0 38.0 38.0 36.0 38.0 85-89 36.989599999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.8784 38.0 38.0 38.0 35.2 38.0 95-99 36.7171 38.0 38.0 38.0 34.8 38.0 100-104 36.4818 38.0 38.0 38.0 34.0 38.0 105-109 36.591300000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.52225 38.0 38.0 38.0 34.0 38.0 115-119 36.5793 38.0 38.0 38.0 34.0 38.0 120-124 36.479 38.0 38.0 38.0 34.0 38.0 125-129 36.40435000000001 38.0 38.0 38.0 34.0 38.0 130-134 36.0886 38.0 36.8 38.0 32.8 38.0 135-139 35.8856 38.0 36.6 38.0 31.8 38.0 140-144 35.711800000000004 38.0 36.0 38.0 31.4 38.0 145-149 35.579750000000004 38.0 36.0 38.0 30.6 38.0 150-151 33.15875 36.5 31.5 38.0 21.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 5.0 24 4.0 25 6.0 26 12.0 27 15.0 28 25.0 29 18.0 30 34.0 31 43.0 32 63.0 33 94.0 34 129.0 35 208.0 36 527.0 37 2814.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.63942670354538 11.491073673623333 9.705808398290168 37.16369122454111 2 21.875 15.575 33.475 29.075 3 20.8 20.075000000000003 26.674999999999997 32.45 4 24.2 27.1 22.5 26.200000000000003 5 23.575 31.3 24.725 20.4 6 19.325 35.25 23.674999999999997 21.75 7 14.124999999999998 26.974999999999998 41.349999999999994 17.549999999999997 8 18.35 25.924999999999997 31.175000000000004 24.55 9 17.875 24.95 33.800000000000004 23.375 10-14 20.26 28.975 27.3 23.465 15-19 20.815 27.785 28.044999999999998 23.355 20-24 20.39 28.33 27.625 23.655 25-29 19.861986198619864 28.127812781278127 27.96779677967797 24.04240424042404 30-34 20.260065016254064 27.76694173543386 27.996999249812454 23.975993998499625 35-39 19.939984996249063 27.981995498874717 28.077019254813703 24.001000250062514 40-44 20.2080312046807 28.434265139770964 28.134220133019955 23.22348352252838 45-49 20.284056811362273 27.99059811962393 27.720544108821766 24.00480096019204 50-54 20.29101455072754 28.7914395719786 27.28636431821591 23.631181559077955 55-59 20.544999999999998 28.4 27.334999999999997 23.72 60-64 20.4 28.455000000000002 27.165 23.98 65-69 19.735 27.315 28.244999999999997 24.705 70-74 20.330000000000002 28.155 27.560000000000002 23.955000000000002 75-79 20.68 27.495000000000005 28.155 23.669999999999998 80-84 20.285 27.775 27.794999999999998 24.145 85-89 21.044999999999998 27.355 27.855 23.745 90-94 20.580000000000002 27.834999999999997 27.439999999999998 24.145 95-99 20.335 27.365000000000002 28.050000000000004 24.25 100-104 21.16 27.694999999999997 27.63 23.515 105-109 21.099999999999998 27.98 27.400000000000002 23.52 110-114 21.015 28.055000000000003 27.495000000000005 23.435 115-119 21.08 27.779999999999998 27.105 24.035 120-124 20.715 27.839999999999996 26.905 24.54 125-129 21.215 28.46 26.834999999999997 23.49 130-134 21.135 28.175 27.029999999999998 23.66 135-139 20.84 27.865000000000002 26.82 24.474999999999998 140-144 21.224999999999998 27.750000000000004 26.905 24.12 145-149 21.12 28.16 26.590000000000003 24.13 150-151 21.349999999999998 27.1375 26.75 24.762500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 2.5 25 3.0 26 3.5 27 6.5 28 8.0 29 10.0 30 13.5 31 19.0 32 27.5 33 35.0 34 42.5 35 58.5 36 72.5 37 97.0 38 127.5 39 151.0 40 176.5 41 205.5 42 234.0 43 254.0 44 284.0 45 290.0 46 282.0 47 264.5 48 229.0 49 206.5 50 193.5 51 160.0 52 121.0 53 102.5 54 75.5 55 52.0 56 38.0 57 29.0 58 23.0 59 15.5 60 13.0 61 13.5 62 12.0 63 10.0 64 8.5 65 6.5 66 4.0 67 2.5 68 2.5 69 2.5 70 1.5 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.025 35-39 0.025 40-44 0.015 45-49 0.02 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6124999999999998 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.387499999999999 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 6.2 0.0 0.0 0.0 0.0 134-135 6.7375 0.0 0.0 0.0 0.0 136-137 7.4375 0.0 0.0 0.0 0.0 138-139 8.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171477 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171477_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.649 33.0 33.0 34.0 32.0 34.0 2 32.58275 33.0 33.0 34.0 32.0 34.0 3 32.7275 34.0 33.0 34.0 32.0 34.0 4 32.495 34.0 33.0 34.0 31.0 34.0 5 32.576 34.0 33.0 34.0 32.0 34.0 6 36.57525 38.0 38.0 38.0 34.0 38.0 7 36.50725 38.0 38.0 38.0 34.0 38.0 8 36.4395 38.0 38.0 38.0 34.0 38.0 9 36.615 38.0 38.0 38.0 35.0 38.0 10-14 36.613749999999996 38.0 38.0 38.0 34.8 38.0 15-19 36.841049999999996 38.0 38.0 38.0 35.8 38.0 20-24 36.9457 38.0 38.0 38.0 36.2 38.0 25-29 37.02329999999999 38.0 38.0 38.0 36.6 38.0 30-34 37.02015 38.0 38.0 38.0 36.0 38.0 35-39 36.89705 38.0 38.0 38.0 36.0 38.0 40-44 36.87475 38.0 38.0 38.0 36.0 38.0 45-49 36.90535 38.0 38.0 38.0 36.0 38.0 50-54 36.81705 38.0 38.0 38.0 36.0 38.0 55-59 36.85269999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.8239 38.0 38.0 38.0 36.0 38.0 65-69 36.85445000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.8001 38.0 38.0 38.0 35.4 38.0 75-79 36.81445 38.0 38.0 38.0 35.4 38.0 80-84 36.78085 38.0 38.0 38.0 35.4 38.0 85-89 36.6634 38.0 38.0 38.0 35.0 38.0 90-94 36.596149999999994 38.0 38.0 38.0 34.4 38.0 95-99 36.48909999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.424850000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.2768 38.0 38.0 38.0 34.0 38.0 110-114 36.2281 38.0 38.0 38.0 34.0 38.0 115-119 36.0259 38.0 37.6 38.0 33.2 38.0 120-124 35.8797 38.0 37.0 38.0 31.6 38.0 125-129 35.82405 38.0 37.0 38.0 31.0 38.0 130-134 35.596500000000006 38.0 36.2 38.0 30.6 38.0 135-139 35.30425 38.0 36.0 38.0 28.2 38.0 140-144 35.054500000000004 38.0 35.6 38.0 27.0 38.0 145-149 34.70405 38.0 35.0 38.0 24.2 38.0 150-151 32.15225 35.5 28.0 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 3.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 3.0 18 4.0 19 3.0 20 7.0 21 7.0 22 10.0 23 14.0 24 15.0 25 22.0 26 26.0 27 27.0 28 30.0 29 38.0 30 42.0 31 80.0 32 65.0 33 96.0 34 123.0 35 191.0 36 508.0 37 2681.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.46923461730866 21.1855927963982 14.082041020510255 26.263131565782892 2 23.84884884884885 25.0 32.207207207207205 18.943943943943946 3 20.77077077077077 27.05205205205205 30.53053053053053 21.646646646646648 4 24.624624624624623 33.908908908908906 22.772772772772772 18.693693693693696 5 23.073073073073072 36.711711711711715 21.371371371371374 18.843843843843842 6 21.357035553329993 36.22934401602404 24.361542313470206 18.052078117175764 7 20.255383074611917 21.4321482223335 37.43114672008012 20.881321982974463 8 20.876095118898625 25.732165206508135 27.48435544430538 25.90738423028786 9 21.657486229344016 24.98748122183275 29.56935403104657 23.785678517776667 10-14 23.106971153846153 28.48056891025641 26.437299679487182 21.975160256410255 15-19 23.553863875394402 28.301697801372267 27.22492111984775 20.91951720338559 20-24 23.464890313533008 28.162876890714216 27.57187218271061 20.80036061304217 25-29 23.588023232525536 28.104346084518326 26.682355297416382 21.625275385539755 30-34 23.946551896707035 28.24542087879091 26.86417775998399 20.943849464518067 35-39 23.056528264132066 28.59929964982491 27.613806903451728 20.730365182591296 40-44 23.81238424187816 27.431546278219955 27.461580817940636 21.294488661961257 45-49 23.02723813338674 28.499899859803723 27.318245543761265 21.154616463048267 50-54 22.984476715072606 28.207310966449672 27.87681522283425 20.931397095643465 55-59 23.989582811639202 27.485350828867634 27.565483047027595 20.95958331246557 60-64 23.70173769342481 27.16210125694827 28.103560518804144 21.032600530822776 65-69 23.336504280779053 28.082911931106995 27.146647974765937 21.433935813348022 70-74 23.783783783783786 28.22822822822823 26.656656656656658 21.33133133133133 75-79 23.475868967241812 27.85696424106027 27.6419104776194 21.02525631407852 80-84 23.390847711927982 28.247061765441362 26.811702925731435 21.550387596899228 85-89 24.000400340289247 27.54841615373067 27.268177951258572 21.18300555472151 90-94 24.35043804755945 28.090112640801003 26.988735919899874 20.570713391739677 95-99 24.119797666149147 28.326739119547252 26.764160865427954 20.789302348875644 100-104 24.63172662591442 27.638039883755887 26.956608878645156 20.77362461168454 105-109 23.88396212235082 27.401172403427026 27.89217896688211 20.822686507340045 110-114 23.87012726726125 28.449744463373083 26.891472091391922 20.788656177973746 115-119 24.794589178356713 28.04609218436874 27.294589178356716 19.864729458917836 120-124 24.47293304622164 27.5076368370975 27.05193049226301 20.967499624417847 125-129 23.967562697101666 27.92711618361115 27.20128147369475 20.90403964559243 130-134 25.385385385385383 27.792792792792792 26.716716716716714 20.105105105105107 135-139 24.828518499974965 27.72242527412006 27.006458719271016 20.442597506633955 140-144 25.06012024048096 27.650300601202403 27.299599198396795 19.98997995991984 145-149 25.73160954099018 28.257165764682302 26.398075766686713 19.61314892764081 150-151 25.482335254322226 26.998246053620644 27.023302430468554 20.496116261588572 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 2.5 27 3.5 28 4.5 29 8.0 30 7.5 31 10.0 32 18.5 33 30.0 34 39.0 35 51.5 36 78.0 37 95.0 38 117.5 39 158.0 40 194.5 41 231.0 42 253.0 43 267.0 44 281.0 45 281.0 46 273.5 47 258.0 48 236.5 49 218.0 50 186.0 51 139.0 52 106.0 53 93.0 54 76.0 55 54.0 56 42.0 57 35.5 58 30.5 59 23.0 60 18.5 61 16.0 62 12.0 63 9.5 64 6.0 65 6.0 66 8.5 67 5.0 68 1.0 69 1.5 70 2.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.1 3 0.1 4 0.1 5 0.1 6 0.15 7 0.15 8 0.125 9 0.15 10-14 0.16 15-19 0.165 20-24 0.16999999999999998 25-29 0.13999999999999999 30-34 0.09 35-39 0.05 40-44 0.11499999999999999 45-49 0.13999999999999999 50-54 0.15 55-59 0.165 60-64 0.155 65-69 0.135 70-74 0.1 75-79 0.025 80-84 0.025 85-89 0.08499999999999999 90-94 0.125 95-99 0.165 100-104 0.21 105-109 0.20500000000000002 110-114 0.21 115-119 0.2 120-124 0.155 125-129 0.11499999999999999 130-134 0.1 135-139 0.135 140-144 0.2 145-149 0.22 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77432296890673 99.47500000000001 2 0.17552657973921765 0.35000000000000003 3 0.025075225677031094 0.075 4 0.025075225677031094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.85 0.0 0.0 0.0 0.0 124-125 4.425 0.0 0.0 0.0 0.0 126-127 4.875 0.0 0.0 0.0 0.0 128-129 5.275 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.225 0.0 0.0 0.0 0.0 134-135 6.7625 0.0 0.0 0.0 0.0 136-137 7.475 0.0 0.0 0.0 0.0 138-139 8.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTCAA 10 0.006830828 145.0 5 >>END_MODULE Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065848 spots for SRR7171477.sra Written 1065848 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra Read 1065829 spots for SRR7171477.sra Written 1065829 spots for SRR7171477.sra SRR ids: ['SRR7171477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j3qd3ovr SRR7171477.sra spots: 21316599 blocks: [[1, 1065829], [1065830, 2131658], [2131659, 3197487], [3197488, 4263316], [4263317, 5329145], [5329146, 6394974], [6394975, 7460803], [7460804, 8526632], [8526633, 9592461], [9592462, 10658290], [10658291, 11724119], [11724120, 12789948], [12789949, 13855777], [13855778, 14921606], [14921607, 15987435], [15987436, 17053264], [17053265, 18119093], [18119094, 19184922], [19184923, 20250751], [20250752, 21316599]] SRR7171477 file size 7201795 SRR7171477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171477 SRR7171477_1.fastq SRR7171477_2.fastq Input file: SRR7171477_1.fastq Paired file: SRR7171477_2.fastq trimmed: SRR7171477-trimmed-pair1.fastq, SRR7171477-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:44:20 2025 >> started Fri Feb 14 11:44:44 2025 >> done (23.523s) 21316599 read pairs processed; of these: 948 ( 0.00%) short read pairs filtered out after trimming by size control 2499 ( 0.01%) empty read pairs filtered out after trimming by size control 21313152 (99.98%) read pairs available; of these: 2933145 (13.76%) trimmed read pairs available after processing 18380007 (86.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 5 0.00% 25 2 0.00% 26 1 0.00% 27 4 0.00% 28 3 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 4 0.00% 33 5 0.00% 34 8 0.00% 35 1 0.00% 36 3 0.00% 37 1 0.00% 38 2 0.00% 39 13 0.00% 40 4 0.00% 41 4 0.00% 42 3 0.00% 43 6 0.00% 44 12 0.00% 45 10 0.00% 46 8 0.00% 47 17 0.00% 48 22 0.00% 49 32 0.00% 50 28 0.00% 51 48 0.00% 52 47 0.00% 53 53 0.00% 54 55 0.00% 55 67 0.00% 56 79 0.00% 57 85 0.00% 58 112 0.00% 59 119 0.00% 60 146 0.00% 61 182 0.00% 62 177 0.00% 63 237 0.00% 64 268 0.00% 65 300 0.00% 66 375 0.00% 67 428 0.00% 68 476 0.00% 69 561 0.00% 70 662 0.00% 71 793 0.00% 72 924 0.00% 73 1086 0.01% 74 1302 0.01% 75 1392 0.01% 76 1606 0.01% 77 1746 0.01% 78 1998 0.01% 79 2301 0.01% 80 2703 0.01% 81 3231 0.02% 82 3601 0.02% 83 3866 0.02% 84 4525 0.02% 85 5129 0.02% 86 5382 0.03% 87 6074 0.03% 88 6391 0.03% 89 7046 0.03% 90 8066 0.04% 91 8770 0.04% 92 9752 0.05% 93 10815 0.05% 94 11920 0.06% 95 12817 0.06% 96 13771 0.06% 97 14739 0.07% 98 15573 0.07% 99 16396 0.08% 100 17525 0.08% 101 18571 0.09% 102 20489 0.10% 103 21979 0.10% 104 23415 0.11% 105 24657 0.12% 106 25960 0.12% 107 26644 0.13% 108 27652 0.13% 109 28639 0.13% 110 29637 0.14% 111 31505 0.15% 112 33385 0.16% 113 35006 0.16% 114 37137 0.17% 115 39303 0.18% 116 41701 0.20% 117 45382 0.21% 118 45948 0.22% 119 43934 0.21% 120 44269 0.21% 121 45576 0.21% 122 47525 0.22% 123 49552 0.23% 124 52079 0.24% 125 53202 0.25% 126 55252 0.26% 127 56352 0.26% 128 57107 0.27% 129 57942 0.27% 130 59378 0.28% 131 60828 0.29% 132 63130 0.30% 133 65081 0.31% 134 66850 0.31% 135 69033 0.32% 136 71179 0.33% 137 72120 0.34% 138 72471 0.34% 139 73005 0.34% 140 74865 0.35% 141 79604 0.37% 142 83480 0.39% 143 80865 0.38% 144 84738 0.40% 145 89713 0.42% 146 84186 0.39% 147 90557 0.42% 148 87471 0.41% 149 87973 0.41% 150 90883 0.43% 151 18380007 86.24% 21313152 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.92 fanout-score-rank=12 prefix-density=0.37 prefix-fanout=4.1 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=78.50 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.4 sequence=CTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCTCCCAGTCACCTGC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=24 prefix-density=0.38 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=41.28 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.2 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCG SRR7171477 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:45:36 Started mapping on | Feb 14 11:45:36 Finished on | Feb 14 11:49:05 Mapping speed, Million of reads per hour | 367.12 Number of input reads | 21313152 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19236460 Uniquely mapped reads % | 90.26% Average mapped length | 294.40 Number of splices: Total | 18892119 Number of splices: Annotated (sjdb) | 18552186 Number of splices: GT/AG | 18592935 Number of splices: GC/AG | 236258 Number of splices: AT/AC | 13657 Number of splices: Non-canonical | 49269 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 507028 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 124202 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.58% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1569668 1569668 1569668 N_multimapping 507028 507028 507028 N_noFeature 475877 19067832 546703 N_ambiguous 198314 1238 99566 UnstrandedReadsAssigned:18562269 PositiveStrandReadsAssigned:167390 NegativeStrandReadsAssigned:18590191 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171477 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171477-trimmed-pair1.fastq SRR7171477-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,313,152 reads, 18,684,674 reads pseudoaligned [quant] estimated average fragment length: 222.532 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7171477.ke.tsv 34699 SRR7171477.se.tsv 87100 total ==> SRR7171477.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.47 1378 39.7795 Potri.005G024800.1.v4.1 1035 813.468 207 13.1965 Potri.004G059700.1.v4.1 961 739.478 43 3.01559 Potri.007G009000.2.v4.1 1416 1194.47 0 0 Potri.003G141000.2.v4.1 2943 2721.47 609 11.605 Potri.016G087400.1.v4.1 270 85.5514 1553 941.399 Potri.015G069301.1.v4.1 564 344.542 0 0 Potri.010G195200.1.v4.1 1773 1551.47 621 20.7576 Potri.012G127500.1.v4.1 977 755.478 13278 911.465 ==> SRR7171477.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 43 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 607 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 354 SRR7171477 completed mapping pipeline successfully