Starting /dee2/code/volunteer_pipeline.sh SRR7171478 current disk space = 3114007732224 free memory = 1577077136 SRR7171478 SRAfilesize d1df80af558b0fccfa7894b0c0352314 SRR7171478.sra SRR7171478.sra file validated SRR7171478 is paired end SRR7171478 is conventional basespace SRR7171478 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171478_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65625 33.0 32.0 34.0 28.0 34.0 2 32.46725 33.0 33.0 34.0 29.0 34.0 3 33.008 33.0 33.0 34.0 32.0 34.0 4 32.969 33.0 33.0 34.0 32.0 34.0 5 33.0255 33.0 33.0 34.0 32.0 34.0 6 36.9535 38.0 37.0 38.0 35.0 38.0 7 37.30925 38.0 38.0 38.0 36.0 38.0 8 37.4455 38.0 38.0 38.0 37.0 38.0 9 37.51675 38.0 38.0 38.0 38.0 38.0 10-14 37.533500000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.53269999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.55125 38.0 38.0 38.0 38.0 38.0 25-29 37.470349999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.44235 38.0 38.0 38.0 37.8 38.0 35-39 37.436449999999994 38.0 38.0 38.0 37.8 38.0 40-44 37.411449999999995 38.0 38.0 38.0 37.2 38.0 45-49 37.46515000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.344049999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.2755 38.0 38.0 38.0 37.0 38.0 60-64 37.2428 38.0 38.0 38.0 37.0 38.0 65-69 37.12395 38.0 38.0 38.0 36.8 38.0 70-74 37.07405 38.0 38.0 38.0 36.0 38.0 75-79 37.05905 38.0 38.0 38.0 36.0 38.0 80-84 37.086749999999995 38.0 38.0 38.0 36.0 38.0 85-89 37.06755 38.0 38.0 38.0 36.0 38.0 90-94 37.01825 38.0 38.0 38.0 36.0 38.0 95-99 36.970800000000004 38.0 38.0 38.0 35.6 38.0 100-104 36.7945 38.0 38.0 38.0 35.6 38.0 105-109 36.71565 38.0 38.0 38.0 35.0 38.0 110-114 36.73545 38.0 38.0 38.0 35.0 38.0 115-119 36.616 38.0 38.0 38.0 34.6 38.0 120-124 36.5745 38.0 38.0 38.0 34.0 38.0 125-129 36.4683 38.0 38.0 38.0 34.0 38.0 130-134 36.336149999999996 38.0 38.0 38.0 33.8 38.0 135-139 36.1611 38.0 37.8 38.0 33.0 38.0 140-144 36.1149 38.0 37.2 38.0 33.0 38.0 145-149 35.89755 38.0 36.0 38.0 32.6 38.0 150-151 34.226375000000004 37.0 33.5 38.0 23.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 3.0 21 2.0 22 4.0 23 3.0 24 12.0 25 5.0 26 14.0 27 15.0 28 19.0 29 27.0 30 28.0 31 46.0 32 62.0 33 63.0 34 95.0 35 175.0 36 398.0 37 3028.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.19162884518406 12.581946545637923 10.312657589510842 36.91376701966717 2 22.975 15.85 30.825000000000003 30.349999999999998 3 20.75 21.95 25.275 32.025 4 22.5 29.299999999999997 23.875 24.325 5 22.925 32.025 24.675 20.375 6 19.075 35.275 25.074999999999996 20.575 7 14.575 25.3 41.949999999999996 18.175 8 17.575 25.35 30.0 27.075 9 18.275 24.775 33.225 23.724999999999998 10-14 20.02 29.845 26.96 23.175 15-19 19.665 28.96 27.279999999999998 24.095 20-24 20.21 29.044999999999998 27.445000000000004 23.3 25-29 19.695 28.645 27.755000000000003 23.905 30-34 20.31 28.63 27.13 23.93 35-39 20.11 28.615000000000002 27.529999999999998 23.745 40-44 19.775000000000002 28.749999999999996 28.065 23.41 45-49 19.805 27.905 27.99 24.3 50-54 20.22 28.444999999999997 28.1 23.235 55-59 19.895 28.235 27.91 23.96 60-64 20.035 28.615000000000002 26.939999999999998 24.41 65-69 20.294999999999998 27.975 27.73 24.0 70-74 20.06 28.68 27.800000000000004 23.46 75-79 20.169999999999998 28.244999999999997 27.615000000000002 23.97 80-84 20.16 28.92 27.04 23.880000000000003 85-89 20.14 28.12 27.99 23.75 90-94 20.1 28.625 27.800000000000004 23.474999999999998 95-99 20.185 27.655 28.34 23.82 100-104 20.25 28.27 27.500000000000004 23.98 105-109 20.775 27.435 28.08 23.71 110-114 20.169999999999998 28.895 27.22 23.715 115-119 21.12 28.065 27.36 23.455000000000002 120-124 20.415 27.750000000000004 28.055000000000003 23.78 125-129 21.16 27.889999999999997 27.029999999999998 23.919999999999998 130-134 20.935000000000002 28.12 26.529999999999998 24.415 135-139 20.68 28.27 27.26 23.79 140-144 20.990000000000002 27.91 27.145000000000003 23.955000000000002 145-149 21.060000000000002 28.299999999999997 26.76 23.880000000000003 150-151 20.7125 28.299999999999997 26.5375 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.5 25 3.5 26 5.0 27 6.0 28 7.5 29 10.5 30 15.5 31 25.5 32 35.0 33 45.0 34 60.5 35 68.0 36 86.5 37 104.0 38 114.0 39 149.0 40 187.5 41 219.0 42 245.0 43 260.5 44 268.5 45 283.0 46 280.5 47 246.5 48 240.5 49 217.5 50 170.5 51 142.5 52 122.5 53 103.0 54 67.0 55 44.5 56 40.0 57 34.5 58 21.5 59 12.0 60 12.5 61 11.0 62 6.0 63 3.5 64 4.5 65 5.0 66 3.0 67 1.5 68 1.0 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.3375 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.1500000000000004 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.6 0.0 0.0 0.0 0.0 136-137 5.0375 0.0 0.0 0.0 0.0 138-139 5.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171478 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171478_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00625 33.0 33.0 34.0 32.0 34.0 2 33.05075 34.0 33.0 34.0 32.0 34.0 3 33.0595 34.0 33.0 34.0 32.0 34.0 4 33.0165 34.0 33.0 34.0 33.0 34.0 5 33.02325 34.0 33.0 34.0 32.0 34.0 6 37.125 38.0 38.0 38.0 37.0 38.0 7 37.18825 38.0 38.0 38.0 37.0 38.0 8 37.13425 38.0 38.0 38.0 37.0 38.0 9 37.05125 38.0 38.0 38.0 37.0 38.0 10-14 37.1063 38.0 38.0 38.0 36.8 38.0 15-19 37.0621 38.0 38.0 38.0 36.8 38.0 20-24 37.0832 38.0 38.0 38.0 36.8 38.0 25-29 37.0563 38.0 38.0 38.0 37.0 38.0 30-34 37.05749999999999 38.0 38.0 38.0 36.4 38.0 35-39 37.044250000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.39165 37.8 37.4 38.0 33.6 38.0 45-49 36.89985 38.0 38.0 38.0 36.0 38.0 50-54 36.859 38.0 38.0 38.0 36.0 38.0 55-59 36.9015 38.0 38.0 38.0 36.0 38.0 60-64 36.8548 38.0 38.0 38.0 36.0 38.0 65-69 36.7732 38.0 38.0 38.0 35.4 38.0 70-74 36.820949999999996 38.0 38.0 38.0 35.4 38.0 75-79 36.83235 38.0 38.0 38.0 35.6 38.0 80-84 36.7641 38.0 38.0 38.0 35.4 38.0 85-89 36.7022 38.0 38.0 38.0 35.2 38.0 90-94 36.53415 38.0 38.0 38.0 34.4 38.0 95-99 36.540949999999995 38.0 38.0 38.0 34.4 38.0 100-104 36.376999999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.3293 38.0 38.0 38.0 34.0 38.0 110-114 36.22605 38.0 38.0 38.0 33.8 38.0 115-119 36.123599999999996 38.0 38.0 38.0 33.4 38.0 120-124 35.94775 38.0 37.6 38.0 32.0 38.0 125-129 35.8587 38.0 37.0 38.0 31.8 38.0 130-134 35.764300000000006 38.0 36.8 38.0 31.4 38.0 135-139 35.59585 38.0 36.2 38.0 31.0 38.0 140-144 35.35465 38.0 36.0 38.0 29.8 38.0 145-149 35.117450000000005 38.0 35.4 38.0 28.0 38.0 150-151 32.687375 35.5 31.0 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 4.0 16 6.0 17 4.0 18 4.0 19 4.0 20 5.0 21 9.0 22 4.0 23 10.0 24 15.0 25 20.0 26 18.0 27 23.0 28 32.0 29 32.0 30 59.0 31 45.0 32 59.0 33 85.0 34 117.0 35 208.0 36 436.0 37 2796.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.15 20.825 16.1 23.925 2 27.952952952952952 26.001001001001 28.678678678678676 17.36736736736737 3 20.625782227784732 29.18648310387985 30.137672090112638 20.05006257822278 4 22.47247247247247 34.18418418418418 24.34934934934935 18.993993993993993 5 24.54954954954955 34.50950950950951 23.04804804804805 17.892892892892892 6 21.63786626596544 35.236664162284 24.167292762334082 18.95817680941648 7 20.18532431755572 21.763085399449036 38.06661657901327 19.984973703981968 8 22.30846269404106 24.111166750125186 26.81522283425138 26.765147721582373 9 21.512647132481845 25.144002003506138 30.753819183571252 22.58953168044077 10-14 23.26955824902334 28.2981067815286 26.374837223279574 22.057497746168487 15-19 23.345855246681694 28.104182319058353 27.518156774355123 21.031805659904833 20-24 23.17091491812309 28.49917371926486 27.5076368370975 20.822274525514548 25-29 23.575933526879567 28.61647812593853 26.849534487936733 20.958053859245172 30-34 23.07153576788394 28.08904452226113 28.264132066033014 20.57528764382191 35-39 23.879775955191036 28.240648129625924 27.290458091618326 20.589117823564713 40-44 22.916041228860202 28.860202141499048 27.419193435404782 20.804563194235964 45-49 22.950983828168027 27.62729685074851 28.523506734091026 20.89821258699244 50-54 23.054581872809212 28.277416124186278 27.926890335503256 20.74111166750125 55-59 23.72058087130696 27.806710065097644 27.651477215823732 20.821231847771656 60-64 24.041061592388584 28.052078117175768 27.496244366549828 20.41061592388583 65-69 23.65220003003454 28.20743855433749 27.49662111428142 20.64374030134655 70-74 24.163624543681554 28.22423363504526 27.389108366254938 20.223033455018253 75-79 23.69 27.97 27.625 20.715 80-84 23.97 27.855 27.6 20.575 85-89 24.1748349669934 27.335467093418686 27.435487097419486 21.054210842168434 90-94 23.7523151624368 28.007208289532965 27.321419632577467 20.91905691545277 95-99 24.062296559667484 27.808102558966397 27.748009414592616 20.3815914667735 100-104 23.880148311454054 28.063934261950095 27.482713698767412 20.57320372782844 105-109 23.946696057311758 27.834276839837685 28.270126747156954 19.948900355693603 110-114 23.814056003606673 28.55783198917998 27.15523718879928 20.472874818414066 115-119 24.41516806091269 27.676200971797826 27.746330711816864 20.162300255472623 120-124 24.175053828050675 27.274548094737366 28.205898552901708 20.34449952431025 125-129 24.329597758655193 27.696617970782473 27.9467680608365 20.027016209725833 130-134 24.502251125562783 27.688844422211105 27.903951975987994 19.90495247623812 135-139 24.893606368597606 27.562208982125867 27.877634806989438 19.666549842287086 140-144 25.016280118218702 28.197164754796372 27.03000551019386 19.756549616791062 145-149 25.35945092931216 28.19498021141225 26.636942036972094 19.80862682230349 150-151 24.649298597194388 28.582164328657317 26.791082164328657 19.977454909819638 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 2.0 26 3.0 27 2.0 28 3.5 29 7.0 30 10.0 31 14.0 32 19.0 33 26.0 34 40.5 35 60.0 36 74.0 37 100.5 38 129.5 39 153.0 40 176.5 41 224.5 42 265.5 43 284.0 44 310.5 45 316.5 46 292.0 47 248.5 48 229.5 49 209.5 50 174.0 51 137.5 52 107.5 53 87.5 54 69.0 55 57.5 56 41.5 57 27.0 58 20.0 59 15.0 60 13.5 61 11.5 62 6.0 63 5.0 64 3.5 65 3.5 66 3.0 67 0.0 68 1.5 69 2.0 70 1.5 71 1.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.125 4 0.1 5 0.1 6 0.17500000000000002 7 0.17500000000000002 8 0.15 9 0.17500000000000002 10-14 0.16999999999999998 15-19 0.17500000000000002 20-24 0.155 25-29 0.11 30-34 0.05 35-39 0.02 40-44 0.06999999999999999 45-49 0.135 50-54 0.15 55-59 0.15 60-64 0.15 65-69 0.11499999999999999 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.02 90-94 0.11499999999999999 95-99 0.155 100-104 0.21 105-109 0.19499999999999998 110-114 0.185 115-119 0.185 120-124 0.145 125-129 0.06 130-134 0.05 135-139 0.135 140-144 0.185 145-149 0.19499999999999998 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.25 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 4.0 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.8125 0.0 0.0 0.0 0.0 138-139 5.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813656 spots for SRR7171478.sra Written 813656 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra Read 813652 spots for SRR7171478.sra Written 813652 spots for SRR7171478.sra SRR ids: ['SRR7171478.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dfab30oz SRR7171478.sra spots: 16273044 blocks: [[1, 813652], [813653, 1627304], [1627305, 2440956], [2440957, 3254608], [3254609, 4068260], [4068261, 4881912], [4881913, 5695564], [5695565, 6509216], [6509217, 7322868], [7322869, 8136520], [8136521, 8950172], [8950173, 9763824], [9763825, 10577476], [10577477, 11391128], [11391129, 12204780], [12204781, 13018432], [13018433, 13832084], [13832085, 14645736], [14645737, 15459388], [15459389, 16273044]] SRR7171478 file size 5492700 SRR7171478 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171478 SRR7171478_1.fastq SRR7171478_2.fastq Input file: SRR7171478_1.fastq Paired file: SRR7171478_2.fastq trimmed: SRR7171478-trimmed-pair1.fastq, SRR7171478-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:39:24 2025 >> started Fri Feb 14 11:39:54 2025 >> done (29.393s) 16273044 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 1188 ( 0.01%) empty read pairs filtered out after trimming by size control 16271844 (99.99%) read pairs available; of these: 1645745 (10.11%) trimmed read pairs available after processing 14626099 (89.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 4 0.00% 26 3 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 3 0.00% 32 1 0.00% 33 2 0.00% 34 2 0.00% 35 0 0.00% 36 5 0.00% 37 1 0.00% 38 3 0.00% 39 2 0.00% 40 2 0.00% 41 4 0.00% 42 2 0.00% 43 5 0.00% 44 4 0.00% 45 3 0.00% 46 5 0.00% 47 2 0.00% 48 12 0.00% 49 9 0.00% 50 12 0.00% 51 9 0.00% 52 22 0.00% 53 21 0.00% 54 23 0.00% 55 17 0.00% 56 29 0.00% 57 28 0.00% 58 32 0.00% 59 52 0.00% 60 49 0.00% 61 60 0.00% 62 75 0.00% 63 93 0.00% 64 86 0.00% 65 109 0.00% 66 154 0.00% 67 151 0.00% 68 159 0.00% 69 208 0.00% 70 257 0.00% 71 310 0.00% 72 347 0.00% 73 418 0.00% 74 450 0.00% 75 500 0.00% 76 628 0.00% 77 704 0.00% 78 785 0.00% 79 900 0.01% 80 1012 0.01% 81 1199 0.01% 82 1382 0.01% 83 1573 0.01% 84 1834 0.01% 85 1998 0.01% 86 2174 0.01% 87 2395 0.01% 88 2714 0.02% 89 2896 0.02% 90 3209 0.02% 91 3735 0.02% 92 4242 0.03% 93 4733 0.03% 94 5097 0.03% 95 5798 0.04% 96 6039 0.04% 97 6383 0.04% 98 6842 0.04% 99 7303 0.04% 100 8082 0.05% 101 8662 0.05% 102 9568 0.06% 103 10458 0.06% 104 11057 0.07% 105 11709 0.07% 106 12297 0.08% 107 12804 0.08% 108 13208 0.08% 109 14105 0.09% 110 14597 0.09% 111 15936 0.10% 112 16844 0.10% 113 18039 0.11% 114 19271 0.12% 115 20430 0.13% 116 21311 0.13% 117 22975 0.14% 118 24067 0.15% 119 23387 0.14% 120 23548 0.14% 121 24371 0.15% 122 25847 0.16% 123 27384 0.17% 124 29008 0.18% 125 30380 0.19% 126 31089 0.19% 127 31577 0.19% 128 31745 0.20% 129 32710 0.20% 130 33447 0.21% 131 34316 0.21% 132 35908 0.22% 133 37788 0.23% 134 39568 0.24% 135 41189 0.25% 136 42318 0.26% 137 42650 0.26% 138 43176 0.27% 139 43543 0.27% 140 44402 0.27% 141 47587 0.29% 142 49383 0.30% 143 49274 0.30% 144 54944 0.34% 145 53938 0.33% 146 52785 0.32% 147 55199 0.34% 148 55375 0.34% 149 54169 0.33% 150 58992 0.36% 151 14626099 89.89% 16271844 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=21 prefix-density=0.32 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=428.58 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=34.2 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=25 prefix-density=0.29 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=31.09 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171478 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:40:58 Started mapping on | Feb 14 11:40:58 Finished on | Feb 14 11:43:44 Mapping speed, Million of reads per hour | 352.88 Number of input reads | 16271844 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14739716 Uniquely mapped reads % | 90.58% Average mapped length | 296.33 Number of splices: Total | 14667039 Number of splices: Annotated (sjdb) | 14407185 Number of splices: GT/AG | 14435726 Number of splices: GC/AG | 182566 Number of splices: AT/AC | 10068 Number of splices: Non-canonical | 38679 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415266 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 59752 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.38% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1116862 1116862 1116862 N_multimapping 415266 415266 415266 N_noFeature 349129 14605643 401011 N_ambiguous 152224 1074 69325 UnstrandedReadsAssigned:14238363 PositiveStrandReadsAssigned:132999 NegativeStrandReadsAssigned:14269380 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171478 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171478-trimmed-pair1.fastq SRR7171478-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,271,844 reads, 14,388,473 reads pseudoaligned [quant] estimated average fragment length: 237.984 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7171478.ke.tsv 34699 SRR7171478.se.tsv 87100 total ==> SRR7171478.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.02 1213 44.5516 Potri.005G024800.1.v4.1 1035 798.016 191 15.6564 Potri.004G059700.1.v4.1 961 724.032 12 1.08416 Potri.007G009000.2.v4.1 1416 1179.02 0 0 Potri.003G141000.2.v4.1 2943 2706.02 540.176 13.0579 Potri.016G087400.1.v4.1 270 80.7368 1089 882.321 Potri.015G069301.1.v4.1 564 330.904 0 0 Potri.010G195200.1.v4.1 1773 1536.02 311 13.2445 Potri.012G127500.1.v4.1 977 740.032 4348 384.334 ==> SRR7171478.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 36 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 420 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 196 SRR7171478 completed mapping pipeline successfully