Starting /dee2/code/volunteer_pipeline.sh SRR7171479 current disk space = 3087312527360 free memory = 1464953652 SRR7171479 SRAfilesize c1c52947f8f0e0ef5d027e532616b7ef SRR7171479.sra SRR7171479.sra file validated SRR7171479 is paired end SRR7171479 is conventional basespace SRR7171479 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171479_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.27575 32.0 28.0 33.0 18.0 34.0 2 31.974 33.0 32.0 33.0 30.0 34.0 3 32.5035 33.0 33.0 33.0 32.0 34.0 4 32.7575 33.0 33.0 34.0 32.0 34.0 5 32.66825 33.0 33.0 34.0 32.0 34.0 6 36.86775 38.0 37.0 38.0 36.0 38.0 7 37.29375 38.0 38.0 38.0 37.0 38.0 8 37.42875 38.0 38.0 38.0 37.0 38.0 9 37.56725 38.0 38.0 38.0 38.0 38.0 10-14 37.5509 38.0 38.0 38.0 38.0 38.0 15-19 37.55890000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.52645 38.0 38.0 38.0 38.0 38.0 25-29 37.343 38.0 38.0 38.0 37.2 38.0 30-34 37.31420000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.27905 38.0 38.0 38.0 37.0 38.0 40-44 37.331399999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.413 38.0 38.0 38.0 37.6 38.0 50-54 37.34375 38.0 38.0 38.0 37.0 38.0 55-59 37.22115 38.0 38.0 38.0 36.8 38.0 60-64 37.10850000000001 38.0 38.0 38.0 36.2 38.0 65-69 37.192249999999994 38.0 38.0 38.0 36.4 38.0 70-74 37.24679999999999 38.0 38.0 38.0 36.6 38.0 75-79 37.180299999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.15265 38.0 38.0 38.0 36.0 38.0 85-89 37.06615000000001 38.0 38.0 38.0 36.0 38.0 90-94 37.032000000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.8269 38.0 38.0 38.0 35.2 38.0 100-104 36.77139999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.6939 38.0 38.0 38.0 34.6 38.0 110-114 36.534299999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.2487 38.0 37.4 38.0 33.4 38.0 120-124 36.181799999999996 38.0 37.4 38.0 33.4 38.0 125-129 36.185950000000005 38.0 37.4 38.0 33.4 38.0 130-134 36.072649999999996 38.0 36.8 38.0 33.0 38.0 135-139 35.7795 38.0 36.0 38.0 31.6 38.0 140-144 35.56425 38.0 36.0 38.0 31.0 38.0 145-149 35.2352 38.0 35.2 38.0 28.2 38.0 150-151 33.13175 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 4.0 23 1.0 24 4.0 25 4.0 26 12.0 27 12.0 28 20.0 29 31.0 30 37.0 31 53.0 32 55.0 33 86.0 34 137.0 35 251.0 36 580.0 37 2709.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.93363499245852 11.463046757164404 11.488185017596782 39.115133232780295 2 22.85 14.575 34.175 28.4 3 19.35 19.825 25.874999999999996 34.949999999999996 4 22.15 27.900000000000002 22.225 27.725 5 22.25 33.75 23.525 20.474999999999998 6 19.25 33.75 25.7 21.3 7 13.900000000000002 26.25 42.25 17.599999999999998 8 18.5 25.275 29.799999999999997 26.424999999999997 9 16.900000000000002 25.5 33.575 24.025 10-14 19.77 29.885 27.450000000000003 22.895 15-19 19.705000000000002 28.23 27.985 24.08 20-24 19.875 28.505000000000003 27.48 24.14 25-29 19.801980198019802 29.182918291829186 27.502750275027505 23.512351235123514 30-34 19.933970286628984 28.367765494472515 27.632434595568007 24.065829623330497 35-39 19.959979989995 28.51425712856428 27.443721860930463 24.082041020510257 40-44 19.834917458729365 28.65432716358179 28.029014507253624 23.481740870435218 45-49 20.09504752376188 28.704352176088044 27.408704352176088 23.791895947973988 50-54 19.605 28.599999999999998 27.400000000000002 24.395 55-59 20.025000000000002 28.410000000000004 27.705000000000002 23.86 60-64 20.0 29.005 27.0 23.995 65-69 20.315 28.715000000000003 27.744999999999997 23.225 70-74 20.355 28.050000000000004 28.32 23.275000000000002 75-79 20.555 28.375 27.779999999999998 23.29 80-84 20.165 28.33 27.845 23.66 85-89 20.3 28.110000000000003 27.82 23.77 90-94 20.21 28.050000000000004 27.485 24.255 95-99 20.294999999999998 28.660000000000004 27.36 23.685000000000002 100-104 20.54 28.685 27.055 23.72 105-109 20.505000000000003 28.555000000000003 27.625 23.315 110-114 20.8 28.16 27.400000000000002 23.64 115-119 21.205 28.76 26.445 23.59 120-124 20.655 28.335 27.37 23.64 125-129 20.7 27.884999999999998 27.450000000000003 23.965 130-134 20.995 28.005000000000003 27.400000000000002 23.599999999999998 135-139 21.12 27.994999999999997 27.435 23.45 140-144 21.09 28.565 26.765 23.580000000000002 145-149 20.75 28.58 26.795 23.875 150-151 20.8 28.349999999999998 26.85 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.5 25 1.0 26 1.5 27 4.0 28 10.0 29 12.0 30 13.5 31 19.5 32 26.5 33 32.5 34 46.5 35 65.0 36 76.0 37 111.5 38 147.5 39 164.0 40 197.0 41 238.0 42 258.5 43 261.0 44 265.0 45 262.5 46 275.5 47 272.5 48 235.5 49 204.5 50 169.5 51 148.0 52 128.0 53 92.0 54 70.0 55 51.5 56 36.0 57 28.5 58 15.5 59 11.5 60 11.5 61 9.0 62 6.0 63 3.0 64 3.0 65 4.0 66 2.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.045 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.824999999999999 0.0 0.0 0.0 0.0 132-133 5.1375 0.0 0.0 0.0 0.0 134-135 5.8 0.0 0.0 0.0 0.0 136-137 6.275 0.0 0.0 0.0 0.0 138-139 6.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGGCA 10 0.006830828 145.0 8 >>END_MODULE SRR7171479 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171479_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8705 33.0 33.0 34.0 32.0 34.0 2 32.90725 34.0 33.0 34.0 32.0 34.0 3 32.9975 34.0 33.0 34.0 32.0 34.0 4 32.92125 34.0 33.0 34.0 32.0 34.0 5 32.82525 34.0 33.0 34.0 32.0 34.0 6 36.92925 38.0 38.0 38.0 36.0 38.0 7 36.927 38.0 38.0 38.0 36.0 38.0 8 36.92275 38.0 38.0 38.0 37.0 38.0 9 36.96075 38.0 38.0 38.0 36.0 38.0 10-14 36.98135 38.0 38.0 38.0 36.2 38.0 15-19 36.92355 38.0 38.0 38.0 36.0 38.0 20-24 36.90635 38.0 38.0 38.0 36.2 38.0 25-29 36.960100000000004 38.0 38.0 38.0 36.2 38.0 30-34 37.1411 38.0 38.0 38.0 37.0 38.0 35-39 37.10515 38.0 38.0 38.0 36.8 38.0 40-44 37.14765 38.0 38.0 38.0 37.0 38.0 45-49 37.03765 38.0 38.0 38.0 36.6 38.0 50-54 36.97865 38.0 38.0 38.0 36.2 38.0 55-59 36.86755 38.0 38.0 38.0 36.0 38.0 60-64 36.777750000000005 38.0 38.0 38.0 35.6 38.0 65-69 36.831149999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.8357 38.0 38.0 38.0 36.0 38.0 75-79 36.87745 38.0 38.0 38.0 36.0 38.0 80-84 36.8579 38.0 38.0 38.0 35.6 38.0 85-89 36.82915 38.0 38.0 38.0 35.4 38.0 90-94 36.75245 38.0 38.0 38.0 35.2 38.0 95-99 36.67285 38.0 38.0 38.0 35.0 38.0 100-104 36.53505 38.0 38.0 38.0 34.2 38.0 105-109 36.33655 38.0 38.0 38.0 33.8 38.0 110-114 36.0801 38.0 37.8 38.0 32.4 38.0 115-119 35.954100000000004 38.0 37.2 38.0 32.6 38.0 120-124 35.798 38.0 37.0 38.0 31.0 38.0 125-129 35.660900000000005 38.0 36.8 38.0 31.0 38.0 130-134 35.626999999999995 38.0 36.2 38.0 31.0 38.0 135-139 35.351 38.0 36.0 38.0 29.6 38.0 140-144 35.0093 38.0 35.4 38.0 27.2 38.0 145-149 34.630849999999995 38.0 35.0 38.0 24.0 38.0 150-151 32.463375 36.5 29.0 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 1.0 17 6.0 18 2.0 19 6.0 20 5.0 21 8.0 22 9.0 23 8.0 24 10.0 25 15.0 26 21.0 27 24.0 28 33.0 29 42.0 30 36.0 31 66.0 32 64.0 33 107.0 34 128.0 35 213.0 36 504.0 37 2685.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.975 19.05 16.55 27.425 2 26.284139313455274 24.830869456276623 30.117764971185167 18.767226259082936 3 20.922074668003006 28.388874968679527 31.1951891756452 19.493861187672263 4 22.080200501253135 34.48621553884712 24.035087719298247 19.398496240601503 5 24.580305687797544 34.92858932598346 22.350288148333753 18.140816837885243 6 20.200250312891114 37.77221526908636 24.405506883604506 17.622027534418024 7 20.110192837465565 20.66115702479339 38.417230152767345 20.811419984973703 8 22.25838758137206 24.13620430645969 27.240861291937907 26.364546820230345 9 20.655983975963945 26.01402103154732 29.34401602403605 23.985978968452677 10-14 23.656398697721013 28.770348109191087 25.885299273729025 21.68795391935888 15-19 23.64137240170298 28.254445279238666 27.287753568745305 20.816428750313047 20-24 22.856141053897012 28.851933480264474 27.459426968543376 20.83249849729513 25-29 23.411287495618208 28.00340527818118 27.587761029595875 20.997546196604738 30-34 22.911766177868977 27.98158250337821 28.166758420499477 20.93989289825334 35-39 23.507929361148634 28.56571114112762 27.4951223172745 20.431237180449248 40-44 23.299123904881103 28.245306633291616 27.794743429286605 20.660826032540676 45-49 22.967897030099664 27.92106976511243 27.95111934692242 21.15991385786548 50-54 24.018232819074335 27.59467040673212 27.935283510318577 20.451813263874975 55-59 23.43100425745054 27.44803405960431 28.409717004758328 20.711244678186826 60-64 23.295767593288254 27.973954420235415 28.03906836964688 20.69120961682945 65-69 23.725333066212563 27.89742562356005 27.82229790644095 20.55494340378644 70-74 23.702517391521948 27.83644462239127 27.851458885941643 20.609579100145137 75-79 22.849569913982798 28.650730146029208 28.225645129025807 20.27405481096219 80-84 23.488523278491773 28.29924488673301 27.48412261839276 20.728109216382457 85-89 23.441408986290405 27.849494646252378 27.719403582507756 20.989692784949465 90-94 23.207490486681355 27.984177848988583 28.174444221910676 20.63388744241939 95-99 23.20060105184072 28.289506636614075 27.848735286751815 20.66115702479339 100-104 24.034270254020743 28.618668269953407 27.38614159026003 19.960919885765822 105-109 24.374968685805904 27.210782103311786 27.99238438799539 20.421864822886917 110-114 24.815872538704344 28.408236885615512 26.975299363695576 19.80059121198457 115-119 24.31999198517257 27.61108049892301 28.162099884786855 19.90682763111757 120-124 24.8885549711996 27.538191835712496 27.32281492612071 20.250438266967194 125-129 24.483155628973318 27.646793812884816 27.751914701907193 20.11813585623467 130-134 24.1327526655654 28.00220253291285 27.386494468638933 20.478550332882815 135-139 24.981219011368758 28.191516001402313 27.164821956227776 19.66244303100115 140-144 24.97119094142993 27.35607996392605 27.441254571872335 20.23147452277168 145-149 25.54993235456231 27.328756827178434 27.048153530089692 20.073157288169565 150-151 25.557504384865947 27.411676271611125 26.98571786519669 20.04510147832623 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 1.5 26 1.0 27 1.5 28 5.5 29 7.5 30 7.5 31 11.5 32 18.5 33 25.5 34 33.0 35 58.5 36 87.0 37 107.0 38 130.0 39 163.0 40 203.5 41 247.5 42 273.5 43 275.0 44 288.0 45 306.5 46 299.5 47 262.5 48 229.5 49 205.0 50 171.0 51 142.0 52 113.0 53 86.0 54 59.5 55 33.0 56 28.0 57 27.0 58 17.0 59 10.5 60 12.5 61 11.0 62 7.5 63 5.0 64 1.5 65 1.5 66 3.5 67 3.0 68 0.5 69 1.0 70 1.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.22499999999999998 4 0.25 5 0.22499999999999998 6 0.125 7 0.17500000000000002 8 0.15 9 0.15 10-14 0.17500000000000002 15-19 0.17500000000000002 20-24 0.18 25-29 0.155 30-34 0.095 35-39 0.055 40-44 0.125 45-49 0.165 50-54 0.18 55-59 0.17500000000000002 60-64 0.17500000000000002 65-69 0.16999999999999998 70-74 0.095 75-79 0.02 80-84 0.015 85-89 0.06999999999999999 90-94 0.13999999999999999 95-99 0.17500000000000002 100-104 0.20500000000000002 105-109 0.20500000000000002 110-114 0.20500000000000002 115-119 0.185 120-124 0.17500000000000002 125-129 0.11499999999999999 130-134 0.11499999999999999 135-139 0.165 140-144 0.20500000000000002 145-149 0.215 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.9625 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.7875 0.0 0.0 0.0 0.0 136-137 6.25 0.0 0.0 0.0 0.0 138-139 6.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAATG 10 0.006830828 145.0 6 TAATCAA 10 0.006830828 145.0 9 TGAATGG 10 0.006830828 145.0 7 >>END_MODULE Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239602 spots for SRR7171479.sra Written 1239602 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra Read 1239598 spots for SRR7171479.sra Written 1239598 spots for SRR7171479.sra SRR ids: ['SRR7171479.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1rnyw7oh SRR7171479.sra spots: 24791964 blocks: [[1, 1239598], [1239599, 2479196], [2479197, 3718794], [3718795, 4958392], [4958393, 6197990], [6197991, 7437588], [7437589, 8677186], [8677187, 9916784], [9916785, 11156382], [11156383, 12395980], [12395981, 13635578], [13635579, 14875176], [14875177, 16114774], [16114775, 17354372], [17354373, 18593970], [18593971, 19833568], [19833569, 21073166], [21073167, 22312764], [22312765, 23552362], [23552363, 24791964]] SRR7171479 file size 8379482 SRR7171479 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171479 SRR7171479_1.fastq SRR7171479_2.fastq Input file: SRR7171479_1.fastq Paired file: SRR7171479_2.fastq trimmed: SRR7171479-trimmed-pair1.fastq, SRR7171479-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:30:44 2025 >> started Thu Feb 13 19:31:12 2025 >> done (27.774s) 24791964 read pairs processed; of these: 854 ( 0.00%) short read pairs filtered out after trimming by size control 2645 ( 0.01%) empty read pairs filtered out after trimming by size control 24788465 (99.99%) read pairs available; of these: 2630342 (10.61%) trimmed read pairs available after processing 22158123 (89.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 0 0.00% 21 4 0.00% 22 2 0.00% 23 1 0.00% 24 5 0.00% 25 4 0.00% 26 4 0.00% 27 3 0.00% 28 2 0.00% 29 2 0.00% 30 1 0.00% 31 4 0.00% 32 1 0.00% 33 3 0.00% 34 5 0.00% 35 4 0.00% 36 4 0.00% 37 7 0.00% 38 3 0.00% 39 7 0.00% 40 6 0.00% 41 6 0.00% 42 9 0.00% 43 11 0.00% 44 7 0.00% 45 13 0.00% 46 16 0.00% 47 15 0.00% 48 22 0.00% 49 27 0.00% 50 26 0.00% 51 15 0.00% 52 35 0.00% 53 38 0.00% 54 46 0.00% 55 41 0.00% 56 61 0.00% 57 70 0.00% 58 89 0.00% 59 102 0.00% 60 94 0.00% 61 136 0.00% 62 164 0.00% 63 198 0.00% 64 212 0.00% 65 249 0.00% 66 261 0.00% 67 287 0.00% 68 347 0.00% 69 411 0.00% 70 457 0.00% 71 585 0.00% 72 650 0.00% 73 810 0.00% 74 870 0.00% 75 1068 0.00% 76 1161 0.00% 77 1242 0.01% 78 1416 0.01% 79 1699 0.01% 80 1923 0.01% 81 2392 0.01% 82 2611 0.01% 83 2970 0.01% 84 3281 0.01% 85 3701 0.01% 86 4039 0.02% 87 4442 0.02% 88 4827 0.02% 89 5352 0.02% 90 5870 0.02% 91 6598 0.03% 92 7349 0.03% 93 8109 0.03% 94 9094 0.04% 95 9663 0.04% 96 10387 0.04% 97 11034 0.04% 98 11873 0.05% 99 12768 0.05% 100 13230 0.05% 101 14698 0.06% 102 15687 0.06% 103 17118 0.07% 104 17926 0.07% 105 19116 0.08% 106 20390 0.08% 107 21360 0.09% 108 21720 0.09% 109 23054 0.09% 110 23936 0.10% 111 25265 0.10% 112 27062 0.11% 113 28303 0.11% 114 30282 0.12% 115 32073 0.13% 116 34198 0.14% 117 41271 0.17% 118 39670 0.16% 119 40351 0.16% 120 37890 0.15% 121 39052 0.16% 122 40480 0.16% 123 42554 0.17% 124 44128 0.18% 125 45577 0.18% 126 47366 0.19% 127 49116 0.20% 128 50513 0.20% 129 51728 0.21% 130 53303 0.22% 131 54334 0.22% 132 56273 0.23% 133 58753 0.24% 134 60218 0.24% 135 62270 0.25% 136 64590 0.26% 137 66007 0.27% 138 67819 0.27% 139 68772 0.28% 140 70452 0.28% 141 81445 0.33% 142 76524 0.31% 143 85818 0.35% 144 85072 0.34% 145 84061 0.34% 146 82224 0.33% 147 86868 0.35% 148 86148 0.35% 149 88603 0.36% 150 94346 0.38% 151 22158123 89.39% 24788465 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=6.08 fanout-score-rank=16 prefix-density=0.21 prefix-fanout=4.5 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=408.86 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=34.3 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.06 fanout-score-rank=24 prefix-density=0.21 prefix-fanout=3.5 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=326.73 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=30.6 sequence=GAAGAAGAAGAAA SRR7171479 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:32:05 Started mapping on | Feb 13 19:32:05 Finished on | Feb 13 19:34:55 Mapping speed, Million of reads per hour | 524.93 Number of input reads | 24788465 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 23194064 Uniquely mapped reads % | 93.57% Average mapped length | 296.34 Number of splices: Total | 23621345 Number of splices: Annotated (sjdb) | 23250991 Number of splices: GT/AG | 23255903 Number of splices: GC/AG | 295359 Number of splices: AT/AC | 16223 Number of splices: Non-canonical | 53860 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 614586 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 263188 % of reads mapped to too many loci | 1.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 979815 979815 979815 N_multimapping 614586 614586 614586 N_noFeature 502423 22998447 585248 N_ambiguous 217852 1718 104052 UnstrandedReadsAssigned:22473789 PositiveStrandReadsAssigned:193899 NegativeStrandReadsAssigned:22504764 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171479 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171479-trimmed-pair1.fastq SRR7171479-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,788,465 reads, 22,670,225 reads pseudoaligned [quant] estimated average fragment length: 231.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR7171479.ke.tsv 34699 SRR7171479.se.tsv 87100 total ==> SRR7171479.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.93 1369 33.0448 Potri.005G024800.1.v4.1 1035 804.935 264 14.1545 Potri.004G059700.1.v4.1 961 730.948 90 5.31382 Potri.007G009000.2.v4.1 1416 1185.93 0 0 Potri.003G141000.2.v4.1 2943 2712.93 732.514 11.6527 Potri.016G087400.1.v4.1 270 81.2274 2053.57 1091.08 Potri.015G069301.1.v4.1 564 337.202 0 0 Potri.010G195200.1.v4.1 1773 1542.93 260.794 7.29461 Potri.012G127500.1.v4.1 977 746.948 4801 277.391 ==> SRR7171479.se.tsv <== Potri.001G166300.v4.1 8 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 523 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 198 SRR7171479 completed mapping pipeline successfully