Starting /dee2/code/volunteer_pipeline.sh SRR7171480 current disk space = 3087325376512 free memory = 1512055320 SRR7171480 SRAfilesize 748dc15a901305c1a97e260261cd86eb SRR7171480.sra SRR7171480.sra file validated SRR7171480 is paired end SRR7171480 is conventional basespace SRR7171480 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.719 33.0 33.0 34.0 32.0 34.0 2 32.969 34.0 33.0 34.0 31.0 34.0 3 32.41625 33.0 33.0 34.0 31.0 34.0 4 31.70975 33.0 32.0 33.0 30.0 34.0 5 32.54425 33.0 33.0 33.0 32.0 34.0 6 36.49475 38.0 37.0 38.0 34.0 38.0 7 37.24625 38.0 38.0 38.0 36.0 38.0 8 37.444 38.0 38.0 38.0 37.0 38.0 9 37.48475 38.0 38.0 38.0 37.0 38.0 10-14 37.467000000000006 38.0 38.0 38.0 37.6 38.0 15-19 37.392 38.0 38.0 38.0 37.0 38.0 20-24 37.509100000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5401 38.0 38.0 38.0 38.0 38.0 30-34 37.536150000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.50450000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.42065 38.0 38.0 38.0 37.0 38.0 45-49 37.32015 38.0 38.0 38.0 37.0 38.0 50-54 37.1921 38.0 38.0 38.0 36.6 38.0 55-59 37.20375 38.0 38.0 38.0 36.6 38.0 60-64 37.2767 38.0 38.0 38.0 37.0 38.0 65-69 37.2697 38.0 38.0 38.0 37.0 38.0 70-74 37.25745 38.0 38.0 38.0 36.8 38.0 75-79 37.18814999999999 38.0 38.0 38.0 36.6 38.0 80-84 37.14565 38.0 38.0 38.0 36.2 38.0 85-89 36.97240000000001 38.0 38.0 38.0 35.8 38.0 90-94 36.896449999999994 38.0 38.0 38.0 35.8 38.0 95-99 36.849000000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.8021 38.0 38.0 38.0 35.0 38.0 105-109 36.6649 38.0 38.0 38.0 34.4 38.0 110-114 36.5476 38.0 38.0 38.0 34.0 38.0 115-119 36.4053 38.0 38.0 38.0 34.0 38.0 120-124 36.31615000000001 38.0 37.6 38.0 33.6 38.0 125-129 36.25429999999999 38.0 37.6 38.0 33.6 38.0 130-134 36.0112 38.0 37.0 38.0 32.8 38.0 135-139 35.779250000000005 38.0 36.2 38.0 31.8 38.0 140-144 35.46485 38.0 36.0 38.0 30.0 38.0 145-149 35.29305 38.0 35.6 38.0 30.0 38.0 150-151 32.667875 35.5 30.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 0.0 17 0.0 18 0.0 19 2.0 20 1.0 21 1.0 22 1.0 23 2.0 24 5.0 25 9.0 26 22.0 27 10.0 28 24.0 29 21.0 30 24.0 31 40.0 32 66.0 33 86.0 34 126.0 35 217.0 36 573.0 37 2767.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.25786163522013 10.38993710691824 8.70440251572327 39.64779874213836 2 22.225 14.025000000000002 35.05 28.7 3 18.45 19.325 24.8 37.425000000000004 4 22.525000000000002 28.175 23.474999999999998 25.825 5 22.55 32.175 23.95 21.325 6 20.599999999999998 32.975 23.95 22.475 7 14.499999999999998 24.875 42.25 18.375 8 18.625 26.85 30.175 24.349999999999998 9 18.25 23.25 34.775 23.724999999999998 10-14 19.655 29.29 27.29 23.765 15-19 19.915 28.375 27.615000000000002 24.095 20-24 20.175 28.165000000000003 27.755000000000003 23.905 25-29 20.175 28.51 27.85 23.465 30-34 20.356017800890044 28.091404570228512 27.716385819290963 23.836191809590478 35-39 20.138055222088834 28.416366546618647 27.47098839535814 23.974589835934374 40-44 20.41408281656331 28.760752150430086 27.220444088817764 23.604720944188838 45-49 19.95699569956996 28.24282428242824 27.302730273027304 24.497449744974496 50-54 20.155 28.165000000000003 27.83 23.849999999999998 55-59 19.955000000000002 28.23 27.445000000000004 24.37 60-64 19.93 28.694999999999997 27.800000000000004 23.575 65-69 19.515 28.075 28.144999999999996 24.265 70-74 20.345 28.02 27.57 24.065 75-79 19.915 28.82 27.650000000000002 23.615 80-84 20.560000000000002 28.17 27.38 23.89 85-89 20.465 28.005000000000003 27.544999999999998 23.985 90-94 20.369999999999997 27.875 27.939999999999998 23.815 95-99 20.615 28.035 27.750000000000004 23.599999999999998 100-104 20.580000000000002 28.294999999999998 27.965 23.16 105-109 20.375 28.515 27.36 23.75 110-114 20.630000000000003 27.92 28.24 23.21 115-119 20.630000000000003 27.675 27.400000000000002 24.295 120-124 20.380000000000003 28.08 27.500000000000004 24.04 125-129 20.880000000000003 27.525 27.855 23.74 130-134 20.735 28.000000000000004 27.63 23.635 135-139 20.630000000000003 27.900000000000002 27.415 24.055 140-144 20.71 27.689999999999998 27.525 24.075 145-149 21.305 28.67 26.515 23.51 150-151 21.0625 28.175 27.05 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 2.5 24 2.0 25 1.5 26 3.5 27 4.0 28 7.0 29 9.5 30 12.5 31 17.0 32 29.5 33 39.5 34 43.0 35 56.5 36 76.5 37 98.5 38 118.0 39 144.0 40 172.0 41 213.0 42 250.5 43 278.5 44 291.0 45 275.0 46 275.5 47 272.0 48 239.5 49 208.0 50 185.5 51 165.0 52 133.0 53 95.5 54 66.5 55 50.5 56 39.5 57 28.5 58 22.5 59 14.0 60 11.5 61 10.0 62 7.5 63 7.0 64 5.0 65 4.5 66 3.0 67 2.5 68 2.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.04 40-44 0.02 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0125 0.025 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.025 0.025 0.0 0.0 0.0 88-89 0.05 0.025 0.0 0.0 0.0 90-91 0.0625 0.025 0.0 0.0 0.0 92-93 0.075 0.025 0.0 0.0 0.0 94-95 0.1375 0.025 0.0 0.0 0.0 96-97 0.23750000000000002 0.025 0.0 0.0 0.0 98-99 0.32499999999999996 0.025 0.0 0.0 0.0 100-101 0.4375 0.025 0.0 0.0 0.0 102-103 0.5 0.025 0.0 0.0 0.0 104-105 0.7125 0.025 0.0 0.0 0.0 106-107 0.9125 0.025 0.0 0.0 0.0 108-109 1.1875 0.025 0.0 0.0 0.0 110-111 1.3624999999999998 0.025 0.0 0.0 0.0 112-113 1.6 0.025 0.0 0.0 0.0 114-115 1.8250000000000002 0.025 0.0 0.0 0.0 116-117 2.025 0.025 0.0 0.0 0.0 118-119 2.2625 0.025 0.0 0.0 0.0 120-121 2.6375 0.025 0.0 0.0 0.0 122-123 3.075 0.025 0.0 0.0 0.0 124-125 3.4625 0.025 0.0 0.0 0.0 126-127 4.0 0.025 0.0 0.0 0.0 128-129 4.3125 0.025 0.0 0.0 0.0 130-131 4.5875 0.025 0.0 0.0 0.0 132-133 5.0125 0.025 0.0 0.0 0.0 134-135 5.4375 0.025 0.0 0.0 0.0 136-137 6.0 0.025 0.0 0.0 0.0 138-139 6.4875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTAACA 10 0.006832588 144.9875 7 ATCTGAG 10 0.006832588 144.9875 6 TCGGAAG 45 0.008960331 48.329166 145 AAAAAAA 35 0.003538379 20.7125 75-79 >>END_MODULE SRR7171480 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171480_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.996 33.0 33.0 34.0 32.0 34.0 2 33.0695 34.0 33.0 34.0 32.0 34.0 3 33.0715 34.0 33.0 34.0 33.0 34.0 4 32.98075 34.0 33.0 34.0 32.0 34.0 5 33.0415 34.0 33.0 34.0 32.0 34.0 6 37.096 38.0 38.0 38.0 37.0 38.0 7 37.14475 38.0 38.0 38.0 37.0 38.0 8 37.06325 38.0 38.0 38.0 37.0 38.0 9 37.09425 38.0 38.0 38.0 37.0 38.0 10-14 37.02405 38.0 38.0 38.0 36.8 38.0 15-19 36.9351 38.0 38.0 38.0 36.4 38.0 20-24 36.987449999999995 38.0 38.0 38.0 36.8 38.0 25-29 37.028499999999994 38.0 38.0 38.0 36.8 38.0 30-34 37.0139 38.0 38.0 38.0 36.8 38.0 35-39 36.9755 38.0 38.0 38.0 36.4 38.0 40-44 36.967650000000006 38.0 38.0 38.0 36.2 38.0 45-49 36.874 38.0 38.0 38.0 36.0 38.0 50-54 36.7376 38.0 38.0 38.0 36.0 38.0 55-59 36.73030000000001 38.0 38.0 38.0 35.8 38.0 60-64 36.6909 38.0 38.0 38.0 35.8 38.0 65-69 36.7164 38.0 38.0 38.0 35.4 38.0 70-74 36.71835 38.0 38.0 38.0 35.4 38.0 75-79 36.69945 38.0 38.0 38.0 35.2 38.0 80-84 36.69435 38.0 38.0 38.0 35.0 38.0 85-89 36.62045 38.0 38.0 38.0 35.0 38.0 90-94 36.39775 38.0 38.0 38.0 34.0 38.0 95-99 36.31055 38.0 38.0 38.0 34.0 38.0 100-104 36.1906 38.0 38.0 38.0 33.8 38.0 105-109 36.15135 38.0 38.0 38.0 33.6 38.0 110-114 35.989 38.0 38.0 38.0 32.6 38.0 115-119 35.82675 38.0 37.4 38.0 31.8 38.0 120-124 35.71535 38.0 37.0 38.0 31.0 38.0 125-129 35.6212 38.0 36.4 38.0 30.4 38.0 130-134 35.58215 38.0 36.0 38.0 31.0 38.0 135-139 35.15665 38.0 35.8 38.0 28.6 38.0 140-144 34.75475 38.0 35.0 38.0 25.6 38.0 145-149 34.4275 38.0 33.4 38.0 23.6 38.0 150-151 31.74275 35.5 28.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 4.0 16 9.0 17 12.0 18 14.0 19 6.0 20 5.0 21 11.0 22 5.0 23 10.0 24 15.0 25 30.0 26 22.0 27 16.0 28 32.0 29 38.0 30 37.0 31 56.0 32 73.0 33 75.0 34 123.0 35 204.0 36 498.0 37 2702.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.975 19.425 14.75 28.849999999999998 2 25.193895421566175 26.09457092819615 31.048286214660997 17.663247435576682 3 19.21441080810608 27.9459594696022 31.523642732049034 21.31598699024268 4 23.686843421710854 33.941970985492745 23.336668334167083 19.034517258629315 5 23.66183091545773 36.36818409204602 22.336168084042022 17.63381690845423 6 20.640480360270203 36.82762071553665 24.293219914936202 18.23867900925694 7 19.53965474105579 21.09081811358519 39.404553415061294 19.96497373029772 8 21.115836877658246 25.344008006004504 28.121090818113586 25.41906429822367 9 21.46609957468101 25.11883912934701 29.647235426569928 23.767825869402053 10-14 23.40596043075382 28.61006761833208 26.381167042324066 21.60280490859003 15-19 23.43303772734105 27.426223758705348 27.706798937822537 21.43393957613107 20-24 23.156260952285585 28.468432383718017 27.632303609873325 20.743003054123065 25-29 23.42139497648354 28.269788852196537 27.434203942759932 20.87461222855999 30-34 22.75137568784392 28.499249624812407 27.723861930965484 21.02551275637819 35-39 23.34667333666833 28.38419209604802 27.448724362181093 20.82041020510255 40-44 23.400210136588782 28.52854355330965 27.317756541752136 20.75348976834943 45-49 23.181727108795833 28.205770386696056 28.190743338008417 20.4217591664997 50-54 23.831728840754113 28.449659045326914 27.3014440433213 20.417168070597675 55-59 23.617309331595045 27.718999147570578 27.75911347339919 20.90457804743519 60-64 22.64387407258873 27.85241628233407 28.348706637256864 21.155003007820333 65-69 23.469030093635773 27.81533223173602 28.19087677131841 20.5247609033098 70-74 24.114468681208727 28.126876125675405 27.171302781669 20.58735241144687 75-79 23.414682936587315 27.915583116623328 27.725545109021805 20.944188837767552 80-84 23.27116355817791 27.91139556977849 28.23141157057853 20.58602930146507 85-89 23.609165499299582 27.856714028417052 27.92675605363218 20.60736441865119 90-94 23.669053938999348 27.770821856062504 28.256623428657285 20.303500776280863 95-99 24.368231046931406 27.366626554352187 27.71259526674689 20.552547131969515 100-104 24.302908726178536 27.337011033099294 27.953861584754264 20.406218655967905 105-109 23.77632898696088 27.467402206619862 28.314944834503507 20.441323971915747 110-114 24.4758752131608 27.595546193198917 27.359815427826263 20.568763165814026 115-119 25.22567703109328 27.407221664994985 27.251755265797396 20.115346038114343 120-124 24.14640260716972 28.032088242667335 27.64602657307596 20.17548257708699 125-129 24.08770085598438 27.922110426991036 27.992191019672624 19.997997697351956 130-134 24.817335602041837 28.07526774096687 27.31458312481233 19.79281353217896 135-139 24.582685848914732 27.449997493608702 27.67557271041155 20.291743947065015 140-144 25.050150451354064 27.99899699097292 27.066198595787363 19.884653961885657 145-149 25.153004916223537 28.072639711046456 26.647938196046955 20.126417176683052 150-151 24.981179422835634 28.281053952321205 26.662484316185697 20.075282308657467 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 3.5 25 4.5 26 3.0 27 1.0 28 3.5 29 6.5 30 8.0 31 11.0 32 15.0 33 25.0 34 43.0 35 61.0 36 86.0 37 119.0 38 135.5 39 161.0 40 206.0 41 225.5 42 268.0 43 296.0 44 284.0 45 291.5 46 274.5 47 256.5 48 232.5 49 191.5 50 171.0 51 140.0 52 114.0 53 91.0 54 64.5 55 46.0 56 33.5 57 27.5 58 21.0 59 15.0 60 11.5 61 11.5 62 9.5 63 7.5 64 5.0 65 3.5 66 1.0 67 0.0 68 1.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.05 5 0.05 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.17500000000000002 15-19 0.20500000000000002 20-24 0.135 25-29 0.06999999999999999 30-34 0.05 35-39 0.05 40-44 0.065 45-49 0.18 50-54 0.27999999999999997 55-59 0.28500000000000003 60-64 0.26 65-69 0.145 70-74 0.06 75-79 0.02 80-84 0.005 85-89 0.06 90-94 0.165 95-99 0.27999999999999997 100-104 0.3 105-109 0.3 110-114 0.31 115-119 0.3 120-124 0.27499999999999997 125-129 0.11499999999999999 130-134 0.09 135-139 0.255 140-144 0.3 145-149 0.33 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.23750000000000002 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.7999999999999998 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.4124999999999996 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.2625 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 4.9375 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGCC 10 0.006671361 146.12659 145 TCGGAAG 40 0.0054465546 54.79747 145 >>END_MODULE Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734294 spots for SRR7171480.sra Written 734294 spots for SRR7171480.sra Read 734304 spots for SRR7171480.sra Written 734304 spots for SRR7171480.sra SRR ids: ['SRR7171480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ltq5p_1n SRR7171480.sra spots: 14685890 blocks: [[1, 734294], [734295, 1468588], [1468589, 2202882], [2202883, 2937176], [2937177, 3671470], [3671471, 4405764], [4405765, 5140058], [5140059, 5874352], [5874353, 6608646], [6608647, 7342940], [7342941, 8077234], [8077235, 8811528], [8811529, 9545822], [9545823, 10280116], [10280117, 11014410], [11014411, 11748704], [11748705, 12482998], [12482999, 13217292], [13217293, 13951586], [13951587, 14685890]] SRR7171480 file size 4954865 SRR7171480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171480 SRR7171480_1.fastq SRR7171480_2.fastq Input file: SRR7171480_1.fastq Paired file: SRR7171480_2.fastq trimmed: SRR7171480-trimmed-pair1.fastq, SRR7171480-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:26:14 2025 >> started Thu Feb 13 19:26:31 2025 >> done (17.733s) 14685890 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 885 ( 0.01%) empty read pairs filtered out after trimming by size control 14684910 (99.99%) read pairs available; of these: 1463500 ( 9.97%) trimmed read pairs available after processing 13221410 (90.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 2 0.00% 32 2 0.00% 33 0 0.00% 34 3 0.00% 35 4 0.00% 36 2 0.00% 37 1 0.00% 38 3 0.00% 39 5 0.00% 40 3 0.00% 41 3 0.00% 42 5 0.00% 43 3 0.00% 44 7 0.00% 45 2 0.00% 46 8 0.00% 47 6 0.00% 48 10 0.00% 49 12 0.00% 50 6 0.00% 51 9 0.00% 52 22 0.00% 53 14 0.00% 54 26 0.00% 55 23 0.00% 56 15 0.00% 57 33 0.00% 58 26 0.00% 59 45 0.00% 60 49 0.00% 61 54 0.00% 62 66 0.00% 63 71 0.00% 64 96 0.00% 65 115 0.00% 66 104 0.00% 67 170 0.00% 68 169 0.00% 69 212 0.00% 70 219 0.00% 71 256 0.00% 72 279 0.00% 73 350 0.00% 74 363 0.00% 75 450 0.00% 76 525 0.00% 77 619 0.00% 78 610 0.00% 79 764 0.01% 80 901 0.01% 81 1023 0.01% 82 1195 0.01% 83 1309 0.01% 84 1523 0.01% 85 1760 0.01% 86 1945 0.01% 87 2181 0.01% 88 2250 0.02% 89 2592 0.02% 90 2897 0.02% 91 3171 0.02% 92 3631 0.02% 93 3975 0.03% 94 4465 0.03% 95 4854 0.03% 96 5315 0.04% 97 5550 0.04% 98 6005 0.04% 99 6538 0.04% 100 7063 0.05% 101 7637 0.05% 102 8338 0.06% 103 8991 0.06% 104 9570 0.07% 105 10364 0.07% 106 11173 0.08% 107 11862 0.08% 108 12067 0.08% 109 12697 0.09% 110 13244 0.09% 111 13917 0.09% 112 14762 0.10% 113 15912 0.11% 114 16675 0.11% 115 17944 0.12% 116 19213 0.13% 117 20823 0.14% 118 21892 0.15% 119 22163 0.15% 120 21378 0.15% 121 21711 0.15% 122 23010 0.16% 123 23772 0.16% 124 25318 0.17% 125 26053 0.18% 126 27384 0.19% 127 28057 0.19% 128 28440 0.19% 129 29121 0.20% 130 30353 0.21% 131 30567 0.21% 132 31815 0.22% 133 33216 0.23% 134 34417 0.23% 135 35898 0.24% 136 36855 0.25% 137 37799 0.26% 138 38384 0.26% 139 39247 0.27% 140 40497 0.28% 141 41918 0.29% 142 43395 0.30% 143 46916 0.32% 144 47634 0.32% 145 48186 0.33% 146 46971 0.32% 147 48616 0.33% 148 49956 0.34% 149 48963 0.33% 150 52416 0.36% 151 13221410 90.03% 14684910 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=29 prefix-density=0.20 prefix-fanout=2.3 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=432.46 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=34.5 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=6.36 fanout-score-rank=17 prefix-density=0.39 prefix-fanout=4.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=297.41 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=29.6 sequence=GAAGAAGAAGAAA SRR7171480 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:27:17 Started mapping on | Feb 13 19:27:17 Finished on | Feb 13 19:28:45 Mapping speed, Million of reads per hour | 600.75 Number of input reads | 14684910 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13806282 Uniquely mapped reads % | 94.02% Average mapped length | 296.61 Number of splices: Total | 13820131 Number of splices: Annotated (sjdb) | 13608965 Number of splices: GT/AG | 13604609 Number of splices: GC/AG | 172946 Number of splices: AT/AC | 9474 Number of splices: Non-canonical | 33102 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366172 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 106818 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 512456 512456 512456 N_multimapping 366172 366172 366172 N_noFeature 305748 13695967 351012 N_ambiguous 130011 938 64254 UnstrandedReadsAssigned:13370523 PositiveStrandReadsAssigned:109377 NegativeStrandReadsAssigned:13391016 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171480 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171480-trimmed-pair1.fastq SRR7171480-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,684,910 reads, 13,459,834 reads pseudoaligned [quant] estimated average fragment length: 234.126 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7171480.ke.tsv 34699 SRR7171480.se.tsv 87100 total ==> SRR7171480.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.87 746 29.9616 Potri.005G024800.1.v4.1 1035 801.874 264 23.6011 Potri.004G059700.1.v4.1 961 727.874 19 1.87125 Potri.007G009000.2.v4.1 1416 1182.87 0 0 Potri.003G141000.2.v4.1 2943 2709.87 393.118 10.3994 Potri.016G087400.1.v4.1 270 79.9616 1182 1059.67 Potri.015G069301.1.v4.1 564 333.61 0 0 Potri.010G195200.1.v4.1 1773 1539.87 164.859 7.67472 Potri.012G127500.1.v4.1 977 743.874 3197 308.09 ==> SRR7171480.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 88 SRR7171480 completed mapping pipeline successfully