Starting /dee2/code/volunteer_pipeline.sh SRR7171481 current disk space = 3087400374272 free memory = 1448428560 SRR7171481 SRAfilesize 28dcf0c6ed91912292a36b17b11655b1 SRR7171481.sra SRR7171481.sra file validated SRR7171481 is paired end SRR7171481 is conventional basespace SRR7171481 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171481_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84425 34.0 33.0 34.0 32.0 34.0 2 33.26875 34.0 33.0 34.0 33.0 34.0 3 33.14275 34.0 33.0 34.0 32.0 34.0 4 32.9765 34.0 33.0 34.0 32.0 34.0 5 33.2075 34.0 33.0 34.0 33.0 34.0 6 36.572 38.0 37.0 38.0 34.0 38.0 7 37.1975 38.0 38.0 38.0 36.0 38.0 8 37.4445 38.0 38.0 38.0 37.0 38.0 9 37.552 38.0 38.0 38.0 37.0 38.0 10-14 37.44745 38.0 38.0 38.0 37.2 38.0 15-19 37.428700000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.50945 38.0 38.0 38.0 37.4 38.0 25-29 37.436899999999994 38.0 38.0 38.0 37.6 38.0 30-34 37.4274 38.0 38.0 38.0 37.4 38.0 35-39 37.396 38.0 38.0 38.0 37.2 38.0 40-44 37.404250000000005 38.0 38.0 38.0 37.2 38.0 45-49 37.447849999999995 38.0 38.0 38.0 37.2 38.0 50-54 37.362199999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.333 38.0 38.0 38.0 37.0 38.0 60-64 37.288650000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.26445 38.0 38.0 38.0 37.0 38.0 70-74 37.124900000000004 38.0 38.0 38.0 36.2 38.0 75-79 37.136900000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.1348 38.0 38.0 38.0 36.0 38.0 85-89 37.06075 38.0 38.0 38.0 36.0 38.0 90-94 36.9678 38.0 38.0 38.0 36.0 38.0 95-99 36.8645 38.0 38.0 38.0 35.2 38.0 100-104 36.5777 38.0 38.0 38.0 34.2 38.0 105-109 36.6388 38.0 38.0 38.0 34.0 38.0 110-114 36.6003 38.0 38.0 38.0 34.2 38.0 115-119 36.57795 38.0 38.0 38.0 34.0 38.0 120-124 36.52295 38.0 38.0 38.0 34.0 38.0 125-129 36.3739 38.0 37.8 38.0 33.8 38.0 130-134 36.15235 38.0 37.0 38.0 33.0 38.0 135-139 35.98285 38.0 36.4 38.0 32.4 38.0 140-144 35.8053 38.0 36.0 38.0 31.2 38.0 145-149 35.71295 38.0 36.0 38.0 31.2 38.0 150-151 33.54925 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 5.0 24 6.0 25 7.0 26 6.0 27 11.0 28 15.0 29 16.0 30 42.0 31 54.0 32 66.0 33 90.0 34 123.0 35 197.0 36 490.0 37 2870.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.31738035264483 11.561712846347607 11.209068010075567 34.91183879093199 2 23.425 13.900000000000002 32.550000000000004 30.125 3 20.424999999999997 19.875 26.724999999999998 32.975 4 23.425 26.875 23.775 25.924999999999997 5 23.125 32.175 24.125 20.575 6 18.65 35.9 24.425 21.025 7 14.549999999999999 25.124999999999996 41.4 18.925 8 17.325 25.474999999999998 31.55 25.650000000000002 9 18.05 24.725 33.475 23.75 10-14 20.155 29.020000000000003 27.305 23.52 15-19 20.64 28.299999999999997 27.445000000000004 23.615 20-24 19.950000000000003 28.415000000000003 28.185 23.45 25-29 20.042004200420042 28.597859785978596 26.957695769576954 24.402440244024405 30-34 19.879969992498125 28.327081770442607 27.836959239809957 23.95598899724931 35-39 20.040010002500626 28.55213803450863 27.4368592148037 23.970992748187047 40-44 19.929982495623904 28.237059264816207 27.976994248562143 23.85596399099775 45-49 20.575143785946487 28.052013003250813 27.311827956989248 24.06101525381345 50-54 20.41602080104005 27.94139706985349 27.76138806940347 23.881194059702985 55-59 20.195 27.715 28.08 24.01 60-64 19.7 28.42 27.834999999999997 24.044999999999998 65-69 20.13 28.310000000000002 27.605 23.955000000000002 70-74 20.46 28.485 26.945000000000004 24.11 75-79 20.145 28.68 27.279999999999998 23.895 80-84 20.549999999999997 27.43 27.700000000000003 24.32 85-89 20.745 27.79 27.950000000000003 23.515 90-94 20.215 28.255000000000003 27.544999999999998 23.985 95-99 20.405 27.87 27.66 24.065 100-104 20.61 27.485 27.57 24.335 105-109 20.535 27.644999999999996 27.700000000000003 24.12 110-114 20.77 27.544999999999998 27.85 23.835 115-119 20.875 28.17 27.415 23.54 120-124 21.195 27.79 26.905 24.11 125-129 20.735 27.939999999999998 27.29 24.035 130-134 20.380000000000003 27.905 27.395000000000003 24.32 135-139 21.044999999999998 28.025 27.084999999999997 23.845 140-144 20.765 28.050000000000004 27.04 24.145 145-149 21.42 28.62 26.295 23.665 150-151 22.2625 28.6625 25.424999999999997 23.65 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.5 24 2.0 25 3.0 26 6.5 27 8.5 28 11.5 29 14.0 30 15.0 31 17.0 32 28.5 33 42.5 34 48.5 35 56.5 36 76.5 37 101.5 38 115.5 39 138.0 40 180.0 41 213.0 42 232.5 43 248.5 44 268.5 45 263.0 46 264.0 47 296.0 48 269.5 49 213.0 50 168.5 51 143.5 52 131.5 53 100.0 54 75.0 55 58.5 56 42.0 57 32.0 58 23.0 59 15.5 60 12.5 61 12.0 62 12.5 63 8.0 64 4.5 65 5.0 66 3.5 67 3.0 68 2.5 69 1.5 70 1.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.8875000000000002 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.725 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.4375 0.0 0.0 0.0 0.0 128-129 4.8625 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.6375 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.6 0.0 0.0 0.0 0.0 138-139 7.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171481 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171481_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6705 33.0 33.0 34.0 32.0 34.0 2 32.649 33.0 33.0 34.0 32.0 34.0 3 32.7385 34.0 33.0 34.0 32.0 34.0 4 32.51375 34.0 33.0 34.0 31.0 34.0 5 32.64875 34.0 33.0 34.0 32.0 34.0 6 36.65225 38.0 38.0 38.0 35.0 38.0 7 36.63175 38.0 38.0 38.0 34.0 38.0 8 36.58625 38.0 38.0 38.0 34.0 38.0 9 36.6035 38.0 38.0 38.0 35.0 38.0 10-14 36.72195000000001 38.0 38.0 38.0 35.2 38.0 15-19 36.922399999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.9498 38.0 38.0 38.0 36.0 38.0 25-29 37.00965 38.0 38.0 38.0 36.2 38.0 30-34 36.974900000000005 38.0 38.0 38.0 36.4 38.0 35-39 36.8615 38.0 38.0 38.0 36.0 38.0 40-44 36.89595 38.0 38.0 38.0 36.0 38.0 45-49 36.908100000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.8096 38.0 38.0 38.0 36.0 38.0 55-59 36.82385000000001 38.0 38.0 38.0 35.6 38.0 60-64 36.7719 38.0 38.0 38.0 35.8 38.0 65-69 36.80895 38.0 38.0 38.0 36.0 38.0 70-74 36.7973 38.0 38.0 38.0 35.8 38.0 75-79 36.852700000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.71105 38.0 38.0 38.0 35.2 38.0 85-89 36.6548 38.0 38.0 38.0 35.0 38.0 90-94 36.530950000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.4871 38.0 38.0 38.0 34.2 38.0 100-104 36.464000000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.32495 38.0 38.0 38.0 34.0 38.0 110-114 36.261300000000006 38.0 38.0 38.0 33.8 38.0 115-119 35.97845 38.0 37.6 38.0 32.6 38.0 120-124 35.8023 38.0 37.0 38.0 31.6 38.0 125-129 35.76195 38.0 37.0 38.0 31.6 38.0 130-134 35.54235 38.0 36.2 38.0 30.2 38.0 135-139 35.42015 38.0 36.0 38.0 29.4 38.0 140-144 35.153299999999994 38.0 35.6 38.0 28.0 38.0 145-149 34.7931 38.0 35.0 38.0 24.8 38.0 150-151 32.1325 35.5 28.0 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 3.0 17 6.0 18 9.0 19 7.0 20 7.0 21 11.0 22 10.0 23 14.0 24 17.0 25 15.0 26 24.0 27 23.0 28 27.0 29 30.0 30 56.0 31 61.0 32 62.0 33 78.0 34 129.0 35 202.0 36 510.0 37 2694.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.709927481870466 19.02975743935984 16.25406351587897 25.006251562890725 2 26.244683512634477 25.66925193895422 28.971728796597446 19.11433575181386 3 21.816362271703778 28.57142857142857 29.29697272954716 20.31523642732049 4 22.86715036277208 35.05128846634976 22.366775081310983 19.714786089567177 5 24.418313735301474 35.62672004003002 21.691268451338505 18.263697773329998 6 22.4974974974975 36.83683683683684 23.223223223223226 17.442442442442445 7 20.115086314736054 22.441831373530146 36.97773329997498 20.465349011758818 8 22.191643732799598 25.168876657493122 25.494120590442833 27.145359019264447 9 20.72072072072072 26.626626626626624 29.87987987987988 22.772772772772772 10-14 23.811430287258535 29.066159543589233 25.91832649384446 21.20408367530778 15-19 23.346011410269245 28.115303773396054 27.299569612651386 21.239115203683316 20-24 24.394394394394396 27.48748748748749 27.51751751751752 20.6006006006006 25-29 23.1935548438751 27.737189751801438 27.46697357886309 21.602281825460366 30-34 23.859315589353614 27.871723033820295 27.296377826696016 20.97258355013008 35-39 23.248136847896763 28.439953983894362 27.604661631571048 20.707247536637823 40-44 23.587690768076058 28.011008256192145 27.400550412809604 21.000750562922192 45-49 23.937953465098825 27.52064048036027 27.745809357017766 20.79559669752314 50-54 23.487312947299934 27.62624493268605 27.651268705270006 21.235173414744008 55-59 23.433433433433436 28.02802802802803 27.53753753753754 21.001001001001 60-64 23.877683799609628 27.791401831740153 27.50613082428307 20.824783544367147 65-69 24.304443554843875 27.19175340272218 27.692153722978386 20.811649319455565 70-74 23.605343473257616 27.803071996797918 27.823085005253418 20.76849952469105 75-79 24.241060265066267 27.526881720430108 27.741935483870968 20.49012253063266 80-84 24.23105776444111 27.976994248562143 27.211802950737685 20.580145036259065 85-89 24.1532843063685 28.330581820001 27.119915953774576 20.39621791985592 90-94 24.54841130848136 27.995996997748314 27.36052039029272 20.095071303477607 95-99 24.191772595335802 27.950155139625664 27.74997497747973 20.108097287558802 100-104 24.962458704575035 28.271098208028832 26.969666633296622 19.79677645409951 105-109 24.09511889862328 28.16520650813517 27.364205256570713 20.375469336670836 110-114 24.844813776531836 28.123748498197838 26.757108530236284 20.274329195034042 115-119 24.744693632358832 27.25270324389267 27.943532238686426 20.059070885062074 120-124 25.068815374605872 27.56618787848456 27.055702917771885 20.30929382913768 125-129 25.135108086469177 27.762209767814248 26.976581265012012 20.126100880704563 130-134 24.668501376032022 27.160370277708278 27.795846885163872 20.37528146109582 135-139 25.00375281461096 27.950963222416814 27.56067050287716 19.484613460095073 140-144 25.485582699239085 28.25390468562275 26.72206647977573 19.538446135362435 145-149 25.478025828411255 28.531384522975273 26.584242666933626 19.40634698167985 150-151 26.351351351351347 28.053053053053052 26.176176176176174 19.41941941941942 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 1.5 22 1.0 23 0.5 24 1.0 25 0.5 26 2.0 27 4.0 28 5.0 29 6.0 30 12.0 31 12.5 32 11.5 33 23.0 34 37.0 35 49.0 36 61.0 37 89.5 38 122.5 39 156.5 40 197.0 41 222.5 42 234.0 43 270.0 44 310.0 45 308.0 46 294.5 47 269.5 48 240.0 49 209.5 50 173.5 51 133.5 52 117.0 53 101.0 54 76.0 55 64.0 56 42.0 57 30.5 58 19.5 59 13.5 60 15.5 61 12.5 62 9.0 63 8.0 64 7.0 65 4.0 66 1.5 67 3.0 68 2.5 69 1.0 70 1.0 71 1.0 72 2.5 73 1.5 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.075 3 0.075 4 0.075 5 0.075 6 0.1 7 0.075 8 0.075 9 0.1 10-14 0.09 15-19 0.09 20-24 0.1 25-29 0.08 30-34 0.06 35-39 0.034999999999999996 40-44 0.075 45-49 0.075 50-54 0.095 55-59 0.1 60-64 0.095 65-69 0.08 70-74 0.065 75-79 0.025 80-84 0.025 85-89 0.055 90-94 0.075 95-99 0.09 100-104 0.11 105-109 0.125 110-114 0.12 115-119 0.12 120-124 0.095 125-129 0.08 130-134 0.075 135-139 0.075 140-144 0.12 145-149 0.11 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4023133014835303 0.8 3 0.050289162685441285 0.15 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.487500000000001 0.0 0.0 0.0 0.0 128-129 4.9125 0.0 0.0 0.0 0.0 130-131 5.35 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.275 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138-139 7.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAGA 10 0.006815089 145.08861 6 AACTGAT 10 0.006815089 145.08861 3 GAACTGA 10 0.006815089 145.08861 2 ATTCGGT 10 0.006815089 145.08861 1 >>END_MODULE Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973046 spots for SRR7171481.sra Written 973046 spots for SRR7171481.sra Read 973051 spots for SRR7171481.sra Written 973051 spots for SRR7171481.sra SRR ids: ['SRR7171481.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mrgy5pnw SRR7171481.sra spots: 19460925 blocks: [[1, 973046], [973047, 1946092], [1946093, 2919138], [2919139, 3892184], [3892185, 4865230], [4865231, 5838276], [5838277, 6811322], [6811323, 7784368], [7784369, 8757414], [8757415, 9730460], [9730461, 10703506], [10703507, 11676552], [11676553, 12649598], [12649599, 13622644], [13622645, 14595690], [14595691, 15568736], [15568737, 16541782], [16541783, 17514828], [17514829, 18487874], [18487875, 19460925]] SRR7171481 file size 6572968 SRR7171481 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171481 SRR7171481_1.fastq SRR7171481_2.fastq Input file: SRR7171481_1.fastq Paired file: SRR7171481_2.fastq trimmed: SRR7171481-trimmed-pair1.fastq, SRR7171481-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:45:22 2025 >> started Thu Feb 13 19:45:44 2025 >> done (21.843s) 19460925 read pairs processed; of these: 1022 ( 0.01%) short read pairs filtered out after trimming by size control 3284 ( 0.02%) empty read pairs filtered out after trimming by size control 19456619 (99.98%) read pairs available; of these: 2431260 (12.50%) trimmed read pairs available after processing 17025359 (87.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 0 0.00% 29 5 0.00% 30 2 0.00% 31 1 0.00% 32 1 0.00% 33 3 0.00% 34 6 0.00% 35 3 0.00% 36 0 0.00% 37 3 0.00% 38 2 0.00% 39 5 0.00% 40 2 0.00% 41 6 0.00% 42 9 0.00% 43 3 0.00% 44 6 0.00% 45 2 0.00% 46 14 0.00% 47 14 0.00% 48 10 0.00% 49 12 0.00% 50 21 0.00% 51 19 0.00% 52 22 0.00% 53 28 0.00% 54 42 0.00% 55 36 0.00% 56 44 0.00% 57 53 0.00% 58 70 0.00% 59 79 0.00% 60 77 0.00% 61 99 0.00% 62 115 0.00% 63 165 0.00% 64 178 0.00% 65 223 0.00% 66 233 0.00% 67 260 0.00% 68 306 0.00% 69 334 0.00% 70 441 0.00% 71 511 0.00% 72 665 0.00% 73 761 0.00% 74 882 0.00% 75 873 0.00% 76 1086 0.01% 77 1254 0.01% 78 1431 0.01% 79 1484 0.01% 80 1752 0.01% 81 2081 0.01% 82 2368 0.01% 83 2763 0.01% 84 3108 0.02% 85 3544 0.02% 86 3738 0.02% 87 4280 0.02% 88 4598 0.02% 89 5143 0.03% 90 5791 0.03% 91 6449 0.03% 92 7080 0.04% 93 7894 0.04% 94 8646 0.04% 95 9474 0.05% 96 10200 0.05% 97 10717 0.06% 98 11320 0.06% 99 12129 0.06% 100 13142 0.07% 101 14270 0.07% 102 15401 0.08% 103 16652 0.09% 104 17650 0.09% 105 18788 0.10% 106 19618 0.10% 107 20562 0.11% 108 21376 0.11% 109 21979 0.11% 110 23279 0.12% 111 24876 0.13% 112 25947 0.13% 113 27297 0.14% 114 29711 0.15% 115 31629 0.16% 116 33610 0.17% 117 37626 0.19% 118 38022 0.20% 119 36041 0.19% 120 35713 0.18% 121 37435 0.19% 122 38754 0.20% 123 41125 0.21% 124 43227 0.22% 125 44098 0.23% 126 46131 0.24% 127 46962 0.24% 128 47985 0.25% 129 48542 0.25% 130 49442 0.25% 131 50785 0.26% 132 52407 0.27% 133 54479 0.28% 134 56661 0.29% 135 59064 0.30% 136 60001 0.31% 137 60612 0.31% 138 61652 0.32% 139 62425 0.32% 140 63798 0.33% 141 69813 0.36% 142 72986 0.38% 143 69980 0.36% 144 73397 0.38% 145 78666 0.40% 146 72928 0.37% 147 78428 0.40% 148 75955 0.39% 149 76042 0.39% 150 79298 0.41% 151 17025359 87.50% 19456619 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=20 prefix-density=0.92 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=17.13 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.1 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTAGTCCCGCCTG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=20 prefix-density=0.82 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=24 fanout-score=21.28 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=8.1 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171481 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:46:29 Started mapping on | Feb 13 19:46:29 Finished on | Feb 13 19:49:24 Mapping speed, Million of reads per hour | 400.25 Number of input reads | 19456619 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17437713 Uniquely mapped reads % | 89.62% Average mapped length | 295.12 Number of splices: Total | 16401257 Number of splices: Annotated (sjdb) | 16087819 Number of splices: GT/AG | 16155006 Number of splices: GC/AG | 189592 Number of splices: AT/AC | 13095 Number of splices: Non-canonical | 43564 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414304 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 314990 % of reads mapped to too many loci | 1.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.22% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1604602 1604602 1604602 N_multimapping 414304 414304 414304 N_noFeature 434529 17265565 498169 N_ambiguous 198982 1121 89789 UnstrandedReadsAssigned:16804202 PositiveStrandReadsAssigned:171027 NegativeStrandReadsAssigned:16849755 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171481 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171481-trimmed-pair1.fastq SRR7171481-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,456,619 reads, 17,150,238 reads pseudoaligned [quant] estimated average fragment length: 226.773 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR7171481.ke.tsv 34699 SRR7171481.se.tsv 87100 total ==> SRR7171481.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.23 2579 71.2983 Potri.005G024800.1.v4.1 1035 809.227 2243 137.335 Potri.004G059700.1.v4.1 961 735.241 38 2.56079 Potri.007G009000.2.v4.1 1416 1190.23 0 0 Potri.003G141000.2.v4.1 2943 2717.23 944 17.2134 Potri.016G087400.1.v4.1 270 83.7657 1261.38 746.104 Potri.015G069301.1.v4.1 564 340.588 0 0 Potri.010G195200.1.v4.1 1773 1547.23 542 17.3567 Potri.012G127500.1.v4.1 977 751.236 8942 589.764 ==> SRR7171481.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 102 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 571 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 229 SRR7171481 completed mapping pipeline successfully