Starting /dee2/code/volunteer_pipeline.sh SRR7171483 current disk space = 3087448784896 free memory = 1430643012 SRR7171483 SRAfilesize 673cd9de430384e1c394f69e27f43f21 SRR7171483.sra SRR7171483.sra file validated SRR7171483 is paired end SRR7171483 is conventional basespace SRR7171483 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171483_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.65475 32.0 18.0 33.0 18.0 33.0 2 30.90725 32.0 31.0 33.0 27.0 33.0 3 31.972 33.0 32.0 33.0 30.0 34.0 4 32.5075 33.0 33.0 33.0 32.0 34.0 5 32.824 33.0 33.0 34.0 32.0 34.0 6 37.07325 38.0 37.0 38.0 36.0 38.0 7 37.458 38.0 38.0 38.0 37.0 38.0 8 37.575 38.0 38.0 38.0 38.0 38.0 9 37.54875 38.0 38.0 38.0 38.0 38.0 10-14 37.579150000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.58795 38.0 38.0 38.0 38.0 38.0 20-24 37.567350000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.4908 38.0 38.0 38.0 38.0 38.0 30-34 37.410399999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.358850000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.38719999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.46505 38.0 38.0 38.0 37.8 38.0 50-54 37.4151 38.0 38.0 38.0 37.2 38.0 55-59 37.285700000000006 38.0 38.0 38.0 36.8 38.0 60-64 37.23055 38.0 38.0 38.0 36.8 38.0 65-69 37.2183 38.0 38.0 38.0 36.8 38.0 70-74 37.248149999999995 38.0 38.0 38.0 36.8 38.0 75-79 37.2505 38.0 38.0 38.0 37.0 38.0 80-84 37.21785 38.0 38.0 38.0 36.2 38.0 85-89 37.12275 38.0 38.0 38.0 36.2 38.0 90-94 37.0111 38.0 38.0 38.0 36.0 38.0 95-99 36.9396 38.0 38.0 38.0 35.6 38.0 100-104 36.82845 38.0 38.0 38.0 35.0 38.0 105-109 36.8277 38.0 38.0 38.0 35.2 38.0 110-114 36.6216 38.0 38.0 38.0 34.2 38.0 115-119 36.4487 38.0 38.0 38.0 34.0 38.0 120-124 36.3154 38.0 37.8 38.0 33.6 38.0 125-129 36.20465 38.0 37.2 38.0 33.4 38.0 130-134 36.147549999999995 38.0 37.0 38.0 33.0 38.0 135-139 35.94625 38.0 36.2 38.0 32.2 38.0 140-144 35.6354 38.0 36.0 38.0 31.0 38.0 145-149 35.38605 38.0 35.8 38.0 29.8 38.0 150-151 33.38225 36.5 32.0 38.0 21.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 3.0 24 6.0 25 7.0 26 6.0 27 16.0 28 19.0 29 29.0 30 28.0 31 44.0 32 62.0 33 78.0 34 126.0 35 219.0 36 591.0 37 2764.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.133467134972406 11.51530356246864 11.690918213748118 38.660311088810836 2 20.599999999999998 13.15 33.575 32.675 3 19.0 18.75 26.724999999999998 35.525 4 23.799999999999997 25.25 22.975 27.975 5 22.900000000000002 30.099999999999998 25.224999999999998 21.775 6 19.525000000000002 34.875 24.45 21.15 7 14.2 26.875 40.275 18.65 8 17.05 25.8 32.175 24.975 9 16.35 25.674999999999997 35.15 22.825 10-14 18.935 29.695 27.41 23.96 15-19 20.13 27.944999999999997 27.77 24.154999999999998 20-24 19.98 28.585 27.6 23.835 25-29 19.577936690503574 28.679301895284294 27.16407461119168 24.578686803020453 30-34 19.33756942012308 28.328413468754693 28.068244358833244 24.26577275228899 35-39 19.33837145288024 27.541164105900606 28.72228617186327 24.39817826935589 40-44 19.802871866713364 28.328413468754693 28.38845249412118 23.480262170410768 45-49 19.575766671669417 28.38060933513432 27.525138826354496 24.518485166841764 50-54 19.365 28.244999999999997 28.265 24.125 55-59 19.235 28.549999999999997 28.38 23.835 60-64 20.135 27.265 27.77 24.83 65-69 19.695 28.749999999999996 27.865000000000002 23.69 70-74 19.439999999999998 28.37 28.265 23.925 75-79 20.265 27.54 27.74 24.455 80-84 20.015 27.79 27.91 24.285 85-89 20.07100355017751 28.151407570378517 27.43637181859093 24.341217060853044 90-94 19.595000000000002 28.21 27.355 24.84 95-99 20.044999999999998 28.134999999999998 28.07 23.75 100-104 19.98 27.85 27.810000000000002 24.36 105-109 20.365 28.005000000000003 28.050000000000004 23.580000000000002 110-114 20.119999999999997 27.839999999999996 28.305000000000003 23.735 115-119 20.615 28.110000000000003 27.215 24.060000000000002 120-124 20.465 27.839999999999996 27.565 24.13 125-129 20.465 28.384999999999998 27.169999999999998 23.98 130-134 20.805 28.395 26.38 24.42 135-139 20.805 27.575 27.55 24.07 140-144 20.48 28.144999999999996 26.735 24.64 145-149 20.555 28.64 26.545 24.26 150-151 21.1875 27.437499999999996 26.174999999999997 25.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 3.0 25 3.5 26 3.5 27 5.5 28 7.5 29 10.0 30 14.0 31 24.0 32 34.5 33 40.0 34 46.5 35 60.0 36 79.0 37 103.5 38 124.0 39 141.5 40 185.5 41 229.0 42 246.5 43 270.5 44 283.0 45 282.5 46 273.0 47 254.5 48 242.0 49 214.0 50 174.5 51 146.0 52 122.0 53 93.5 54 69.0 55 48.0 56 40.0 57 35.0 58 21.5 59 16.0 60 13.0 61 7.0 62 5.0 63 3.5 64 4.5 65 5.5 66 2.5 67 2.0 68 2.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.065 35-39 0.095 40-44 0.065 45-49 0.055 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.4 0.0 0.0 0.0 0.0 118-119 3.975 0.0 0.0 0.0 0.0 120-121 4.6125 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.85 0.0 0.0 0.0 0.0 126-127 6.5 0.0 0.0 0.0 0.0 128-129 7.074999999999999 0.0 0.0 0.0 0.0 130-131 7.75 0.0 0.0 0.0 0.0 132-133 8.3875 0.0 0.0 0.0 0.0 134-135 9.0375 0.0 0.0 0.0 0.0 136-137 9.8 0.0 0.0 0.0 0.0 138-139 10.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATGCT 10 0.006830828 145.0 8 ATACCTG 10 0.006830828 145.0 3 GTTAATA 10 0.006830828 145.0 4 AAAAAAA 30 0.0014437955 24.166668 65-69 >>END_MODULE SRR7171483 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171483_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95875 33.0 33.0 34.0 32.0 34.0 2 32.99025 34.0 33.0 34.0 32.0 34.0 3 33.0205 34.0 33.0 34.0 32.0 34.0 4 32.92425 34.0 33.0 34.0 32.0 34.0 5 32.938 34.0 33.0 34.0 32.0 34.0 6 37.07725 38.0 38.0 38.0 37.0 38.0 7 37.03375 38.0 38.0 38.0 37.0 38.0 8 37.013 38.0 38.0 38.0 36.0 38.0 9 37.02925 38.0 38.0 38.0 36.0 38.0 10-14 37.0066 38.0 38.0 38.0 36.6 38.0 15-19 36.9867 38.0 38.0 38.0 36.4 38.0 20-24 37.0192 38.0 38.0 38.0 36.8 38.0 25-29 37.00155 38.0 38.0 38.0 36.6 38.0 30-34 37.0625 38.0 38.0 38.0 37.0 38.0 35-39 37.11625 38.0 38.0 38.0 37.0 38.0 40-44 37.138850000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.016999999999996 38.0 38.0 38.0 36.6 38.0 50-54 37.024350000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.954750000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.80225 38.0 38.0 38.0 35.6 38.0 65-69 36.867399999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.9053 38.0 38.0 38.0 36.0 38.0 75-79 36.96145 38.0 38.0 38.0 36.0 38.0 80-84 36.90435 38.0 38.0 38.0 35.8 38.0 85-89 36.83705 38.0 38.0 38.0 36.0 38.0 90-94 36.75175 38.0 38.0 38.0 35.4 38.0 95-99 36.679199999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.601150000000004 38.0 38.0 38.0 34.6 38.0 105-109 36.465599999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.1966 38.0 38.0 38.0 33.6 38.0 115-119 35.9557 38.0 37.6 38.0 32.2 38.0 120-124 35.82785 38.0 37.0 38.0 31.2 38.0 125-129 35.678549999999994 38.0 37.0 38.0 31.0 38.0 130-134 35.619899999999994 38.0 36.0 38.0 31.0 38.0 135-139 35.404450000000004 38.0 36.0 38.0 29.6 38.0 140-144 35.048950000000005 38.0 35.2 38.0 27.6 38.0 145-149 34.7928 38.0 35.0 38.0 26.0 38.0 150-151 32.513625000000005 36.5 29.5 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 2.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 3.0 18 3.0 19 7.0 20 7.0 21 4.0 22 4.0 23 15.0 24 10.0 25 19.0 26 20.0 27 25.0 28 20.0 29 40.0 30 42.0 31 55.0 32 64.0 33 93.0 34 117.0 35 217.0 36 522.0 37 2705.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.8 20.549999999999997 15.35 26.3 2 26.22745490981964 26.427855711422843 30.26052104208417 17.084168336673347 3 21.654135338345863 28.496240601503757 29.624060150375943 20.225563909774436 4 23.734335839598998 33.934837092731826 23.383458646616543 18.947368421052634 5 24.912280701754387 35.739348370927324 22.807017543859647 16.541353383458645 6 21.011770598547457 37.69095917856248 22.839969947407965 18.457300275482094 7 20.490981963927858 21.117234468937877 38.75250501002004 19.639278557114228 8 22.945891783567134 23.997995991983966 27.83066132264529 25.225450901803608 9 22.24448897795591 25.701402805611224 29.283567134268534 22.77054108216433 10-14 24.338677354709418 29.068136272545093 25.37575150300601 21.217434869739478 15-19 23.72244488977956 28.241482965931862 27.309619238476955 20.726452905811623 20-24 23.451903807615228 28.777555110220444 27.46492985971944 20.305611222444888 25-29 24.021842593056462 28.240068132859076 27.313260858674415 20.424828415410047 30-34 24.00861205687963 28.079311035449628 27.55357500500701 20.35850190266373 35-39 23.66748410990441 28.622191081527454 27.41104048846404 20.2992843201041 40-44 23.981968444778364 28.034059604307537 27.523165539694467 20.460806411219636 45-49 24.342467812233856 27.80922799458945 27.613847001653223 20.234457191523468 50-54 23.942885771543086 28.321643286573146 27.53507014028056 20.20040080160321 55-59 24.32865731462926 27.289579158316634 27.820641282565127 20.561122244488978 60-64 24.27855711422846 28.15130260521042 27.640280561122243 19.929859719438877 65-69 24.203406813627254 28.687374749499 26.77855711422846 20.33066132264529 70-74 24.480496720244354 28.180862250262884 27.164388363126534 20.17425266636623 75-79 24.014605842336934 28.366346538615446 27.145858343337338 20.473189275710286 80-84 23.93837843245136 28.024808683039065 27.81473515730506 20.22207772720452 85-89 24.466913604965463 27.805586144759236 27.104815296826505 20.622684953448793 90-94 24.261096082556858 28.073339344755034 27.241759342751227 20.42380522993688 95-99 24.263527054108216 28.421843687374746 27.194388777555112 20.12024048096192 100-104 24.458917835671343 28.256513026052104 27.595190380761526 19.68937875751503 105-109 24.4188376753507 27.890781563126254 27.685370741482966 20.00501002004008 110-114 24.32865731462926 28.582164328657317 27.25450901803607 19.834669338677354 115-119 24.544088176352705 28.251503006012022 27.5250501002004 19.67935871743487 120-124 25.335671342685373 28.00100200400802 27.144288577154306 19.519038076152302 125-129 24.770871938698853 27.946111083287423 27.705714428807532 19.57730254920619 130-134 25.853951717920467 27.96253631172994 26.740458779925874 19.44305319042372 135-139 25.66633266533066 28.021042084168336 27.149298597194388 19.163326653306616 140-144 26.172344689378757 28.53206412825651 26.713426853707418 18.582164328657313 145-149 26.93386773547094 27.955911823647295 26.377755511022045 18.73246492985972 150-151 27.542585170340683 27.229458917835668 26.214929859719437 19.01302605210421 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 0.0 26 1.5 27 1.5 28 3.0 29 10.0 30 13.0 31 12.5 32 19.5 33 24.0 34 30.0 35 47.0 36 67.0 37 94.0 38 134.0 39 157.0 40 184.5 41 232.5 42 259.0 43 276.5 44 297.5 45 304.0 46 300.5 47 284.0 48 249.0 49 207.0 50 163.0 51 140.0 52 123.0 53 90.5 54 65.5 55 50.5 56 32.5 57 27.0 58 24.5 59 15.5 60 11.5 61 7.5 62 6.0 63 4.5 64 3.5 65 3.5 66 3.0 67 3.5 68 2.0 69 1.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.25 4 0.25 5 0.25 6 0.17500000000000002 7 0.2 8 0.2 9 0.2 10-14 0.2 15-19 0.2 20-24 0.2 25-29 0.19499999999999998 30-34 0.13999999999999999 35-39 0.095 40-44 0.17500000000000002 45-49 0.19499999999999998 50-54 0.2 55-59 0.2 60-64 0.2 65-69 0.2 70-74 0.145 75-79 0.04 80-84 0.034999999999999996 85-89 0.11 90-94 0.19 95-99 0.2 100-104 0.2 105-109 0.2 110-114 0.2 115-119 0.2 120-124 0.2 125-129 0.165 130-134 0.16999999999999998 135-139 0.2 140-144 0.2 145-149 0.2 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.025 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.45 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.6375 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.8 0.0 0.0 0.0 0.0 126-127 6.4375 0.0 0.0 0.0 0.0 128-129 7.0 0.0 0.0 0.0 0.0 130-131 7.65 0.0 0.0 0.0 0.0 132-133 8.275 0.0 0.0 0.0 0.0 134-135 8.9125 0.0 0.0 0.0 0.0 136-137 9.649999999999999 0.0 0.0 0.0 0.0 138-139 10.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGATA 10 0.006830828 145.0 4 >>END_MODULE Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra Read 619084 spots for SRR7171483.sra Written 619084 spots for SRR7171483.sra Read 619083 spots for SRR7171483.sra Written 619083 spots for SRR7171483.sra SRR ids: ['SRR7171483.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e4vk3g85 SRR7171483.sra spots: 12381661 blocks: [[1, 619083], [619084, 1238166], [1238167, 1857249], [1857250, 2476332], [2476333, 3095415], [3095416, 3714498], [3714499, 4333581], [4333582, 4952664], [4952665, 5571747], [5571748, 6190830], [6190831, 6809913], [6809914, 7428996], [7428997, 8048079], [8048080, 8667162], [8667163, 9286245], [9286246, 9905328], [9905329, 10524411], [10524412, 11143494], [11143495, 11762577], [11762578, 12381661]] SRR7171483 file size 4174038 SRR7171483 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171483 SRR7171483_1.fastq SRR7171483_2.fastq Input file: SRR7171483_1.fastq Paired file: SRR7171483_2.fastq trimmed: SRR7171483-trimmed-pair1.fastq, SRR7171483-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:47:30 2025 >> started Thu Feb 13 19:47:51 2025 >> done (20.587s) 12381661 read pairs processed; of these: 360 ( 0.00%) short read pairs filtered out after trimming by size control 1660 ( 0.01%) empty read pairs filtered out after trimming by size control 12379641 (99.98%) read pairs available; of these: 2224388 (17.97%) trimmed read pairs available after processing 10155253 (82.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 2 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 1 0.00% 34 4 0.00% 35 0 0.00% 36 1 0.00% 37 1 0.00% 38 0 0.00% 39 3 0.00% 40 3 0.00% 41 1 0.00% 42 6 0.00% 43 5 0.00% 44 6 0.00% 45 14 0.00% 46 13 0.00% 47 16 0.00% 48 11 0.00% 49 10 0.00% 50 16 0.00% 51 23 0.00% 52 29 0.00% 53 37 0.00% 54 37 0.00% 55 43 0.00% 56 41 0.00% 57 64 0.00% 58 69 0.00% 59 74 0.00% 60 91 0.00% 61 111 0.00% 62 137 0.00% 63 170 0.00% 64 201 0.00% 65 247 0.00% 66 248 0.00% 67 276 0.00% 68 367 0.00% 69 367 0.00% 70 459 0.00% 71 543 0.00% 72 652 0.01% 73 765 0.01% 74 974 0.01% 75 1037 0.01% 76 1160 0.01% 77 1313 0.01% 78 1522 0.01% 79 1816 0.01% 80 2031 0.02% 81 2339 0.02% 82 2686 0.02% 83 3056 0.02% 84 3579 0.03% 85 4020 0.03% 86 4287 0.03% 87 4766 0.04% 88 5005 0.04% 89 5587 0.05% 90 6183 0.05% 91 6992 0.06% 92 7677 0.06% 93 8576 0.07% 94 9513 0.08% 95 10374 0.08% 96 10862 0.09% 97 11552 0.09% 98 12197 0.10% 99 13159 0.11% 100 13627 0.11% 101 14641 0.12% 102 16335 0.13% 103 17273 0.14% 104 18573 0.15% 105 19302 0.16% 106 20958 0.17% 107 21016 0.17% 108 22233 0.18% 109 23093 0.19% 110 23917 0.19% 111 25103 0.20% 112 26045 0.21% 113 27692 0.22% 114 29197 0.24% 115 30888 0.25% 116 32270 0.26% 117 35367 0.29% 118 35571 0.29% 119 36006 0.29% 120 34624 0.28% 121 35965 0.29% 122 36885 0.30% 123 38417 0.31% 124 39977 0.32% 125 41488 0.34% 126 42324 0.34% 127 43512 0.35% 128 44271 0.36% 129 44985 0.36% 130 45410 0.37% 131 46385 0.37% 132 47683 0.39% 133 49053 0.40% 134 50394 0.41% 135 51970 0.42% 136 52936 0.43% 137 53761 0.43% 138 54306 0.44% 139 54943 0.44% 140 55725 0.45% 141 60381 0.49% 142 57590 0.47% 143 62558 0.51% 144 62736 0.51% 145 62701 0.51% 146 61682 0.50% 147 63093 0.51% 148 62660 0.51% 149 63257 0.51% 150 66178 0.53% 151 10155253 82.03% 12379641 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=21 prefix-density=0.95 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=12.43 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=4.4 sequence=GTCTTCACAAAAATCTGCAT criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=30 prefix-density=0.76 prefix-fanout=2.5 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=24.22 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=GAACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTTACCTGCAGAAAATGTCTGGCTGTAGCTGTGGCTCTGACTGCAAGTG SRR7171483 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:48:37 Started mapping on | Feb 13 19:48:38 Finished on | Feb 13 19:50:22 Mapping speed, Million of reads per hour | 428.53 Number of input reads | 12379641 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11545365 Uniquely mapped reads % | 93.26% Average mapped length | 292.48 Number of splices: Total | 10771270 Number of splices: Annotated (sjdb) | 10529499 Number of splices: GT/AG | 10597332 Number of splices: GC/AG | 133205 Number of splices: AT/AC | 8815 Number of splices: Non-canonical | 31918 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262280 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 61927 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 571996 571996 571996 N_multimapping 262280 262280 262280 N_noFeature 327273 11430275 371859 N_ambiguous 121069 482 50346 UnstrandedReadsAssigned:11097023 PositiveStrandReadsAssigned:114608 NegativeStrandReadsAssigned:11123160 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171483 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171483-trimmed-pair1.fastq SRR7171483-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,379,641 reads, 11,148,540 reads pseudoaligned [quant] estimated average fragment length: 209.7 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR7171483.ke.tsv 34699 SRR7171483.se.tsv 87100 total ==> SRR7171483.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.3 1586 67.7591 Potri.005G024800.1.v4.1 1035 826.3 1992 186.349 Potri.004G059700.1.v4.1 961 752.3 7 0.719254 Potri.007G009000.2.v4.1 1416 1207.3 0 0 Potri.003G141000.2.v4.1 2943 2734.3 711 20.1001 Potri.016G087400.1.v4.1 270 91.461 1070.43 904.689 Potri.015G069301.1.v4.1 564 357.052 0 0 Potri.010G195200.1.v4.1 1773 1564.3 325 16.0597 Potri.012G127500.1.v4.1 977 768.3 5003 503.355 ==> SRR7171483.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 338 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 252 SRR7171483 completed mapping pipeline successfully