Starting /dee2/code/volunteer_pipeline.sh SRR7171484 current disk space = 3087639150592 free memory = 1534689256 SRR7171484 SRAfilesize 8a0ff7fd85edab658ee31a148e7c5dcd SRR7171484.sra SRR7171484.sra file validated SRR7171484 is paired end SRR7171484 is conventional basespace SRR7171484 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171484_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.615 33.0 33.0 34.0 32.0 34.0 2 32.28625 33.0 32.0 34.0 30.0 34.0 3 32.17175 33.0 32.0 33.0 31.0 34.0 4 32.65975 33.0 33.0 33.0 32.0 34.0 5 33.1735 33.0 33.0 34.0 33.0 34.0 6 37.01525 38.0 37.0 38.0 35.0 38.0 7 37.367 38.0 38.0 38.0 36.0 38.0 8 37.4355 38.0 38.0 38.0 37.0 38.0 9 37.657 38.0 38.0 38.0 38.0 38.0 10-14 37.694 38.0 38.0 38.0 38.0 38.0 15-19 37.65835 38.0 38.0 38.0 38.0 38.0 20-24 37.639050000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.6272 38.0 38.0 38.0 38.0 38.0 30-34 37.630399999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.63705 38.0 38.0 38.0 38.0 38.0 40-44 37.606100000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.5868 38.0 38.0 38.0 38.0 38.0 50-54 37.5381 38.0 38.0 38.0 38.0 38.0 55-59 37.5303 38.0 38.0 38.0 37.2 38.0 60-64 37.514849999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.45605 38.0 38.0 38.0 37.0 38.0 70-74 37.367900000000006 38.0 38.0 38.0 37.0 38.0 75-79 37.33455 38.0 38.0 38.0 37.0 38.0 80-84 37.255199999999995 38.0 38.0 38.0 36.8 38.0 85-89 37.271 38.0 38.0 38.0 36.6 38.0 90-94 37.18095 38.0 38.0 38.0 36.2 38.0 95-99 37.0762 38.0 38.0 38.0 36.0 38.0 100-104 37.02935 38.0 38.0 38.0 36.0 38.0 105-109 36.9711 38.0 38.0 38.0 35.8 38.0 110-114 36.85815 38.0 38.0 38.0 35.0 38.0 115-119 36.84605 38.0 38.0 38.0 35.0 38.0 120-124 36.63395 38.0 38.0 38.0 34.2 38.0 125-129 36.49465 38.0 38.0 38.0 34.0 38.0 130-134 36.4022 38.0 37.8 38.0 34.0 38.0 135-139 36.16025 38.0 37.0 38.0 33.2 38.0 140-144 35.921350000000004 38.0 36.0 38.0 32.2 38.0 145-149 35.70145000000001 38.0 36.0 38.0 31.4 38.0 150-151 33.15475 35.5 32.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 2.0 24 3.0 25 2.0 26 6.0 27 6.0 28 13.0 29 14.0 30 19.0 31 36.0 32 33.0 33 78.0 34 111.0 35 171.0 36 543.0 37 2961.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.61256544502618 12.670157068062826 9.973821989528796 38.7434554973822 2 21.425 15.0 32.175 31.4 3 19.950000000000003 18.55 26.075 35.425000000000004 4 24.05 24.15 23.575 28.225 5 23.65 29.625 24.375 22.35 6 20.674999999999997 32.824999999999996 25.1 21.4 7 15.75 26.150000000000002 40.45 17.65 8 17.974999999999998 26.275 32.324999999999996 23.425 9 17.599999999999998 25.25 32.7 24.45 10-14 19.650000000000002 29.555 27.29 23.505000000000003 15-19 20.23 28.275 28.050000000000004 23.445 20-24 20.105 28.415000000000003 28.415000000000003 23.064999999999998 25-29 19.865 28.655 27.750000000000004 23.73 30-34 19.88 28.955 27.565 23.599999999999998 35-39 20.990000000000002 27.529999999999998 27.43 24.05 40-44 20.36 27.73 28.035 23.875 45-49 19.905 28.29 28.055000000000003 23.75 50-54 20.419999999999998 27.939999999999998 27.685 23.955000000000002 55-59 20.150000000000002 28.605000000000004 27.48 23.765 60-64 20.665 27.74 27.67 23.925 65-69 20.535 28.275 27.55 23.64 70-74 20.73 27.38 28.194999999999997 23.695 75-79 20.615 27.355 28.015 24.015 80-84 20.380000000000003 27.505000000000003 28.275 23.84 85-89 20.075000000000003 27.694999999999997 28.33 23.9 90-94 20.305 26.840000000000003 28.34 24.515 95-99 20.945 27.35 28.285 23.419999999999998 100-104 20.911045552277614 28.026401320066004 27.771388569428474 23.291164558227912 105-109 21.554010106569272 27.823085005253418 26.922499624756092 23.700405263421224 110-114 20.91732106237183 28.72005201820637 26.769369279247734 23.593257640174063 115-119 21.281064053202662 27.826391319565978 27.066353317665882 23.826191309565477 120-124 21.165 27.950000000000003 27.105 23.78 125-129 20.925 27.800000000000004 27.36 23.915 130-134 21.195 27.71 27.145000000000003 23.95 135-139 21.41 27.825 27.33 23.435 140-144 21.775 27.51 26.919999999999998 23.794999999999998 145-149 21.21 27.83 26.96 24.0 150-151 21.4 27.3625 26.5125 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.5 24 3.5 25 3.5 26 3.5 27 6.5 28 9.0 29 11.5 30 13.0 31 19.5 32 33.5 33 38.5 34 47.0 35 59.5 36 71.0 37 94.0 38 121.5 39 144.5 40 172.0 41 204.5 42 252.5 43 276.0 44 286.5 45 286.5 46 260.5 47 264.0 48 248.5 49 200.0 50 171.0 51 144.5 52 112.5 53 93.5 54 73.5 55 63.5 56 50.0 57 33.5 58 28.5 59 23.0 60 17.5 61 13.5 62 13.0 63 8.0 64 4.5 65 5.5 66 3.0 67 1.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.065 110-114 0.034999999999999996 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.2875 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 4.0 0.0 0.0 0.0 0.0 122-123 4.300000000000001 0.0 0.0 0.0 0.0 124-125 4.75 0.0 0.0 0.0 0.0 126-127 5.2375 0.0 0.0 0.0 0.0 128-129 5.7875 0.0 0.0 0.0 0.0 130-131 6.2375 0.0 0.0 0.0 0.0 132-133 6.8 0.0 0.0 0.0 0.0 134-135 7.362500000000001 0.0 0.0 0.0 0.0 136-137 7.8875 0.0 0.0 0.0 0.0 138-139 8.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCATC 10 0.0068378756 144.95 6 >>END_MODULE SRR7171484 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171484_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.19 33.0 33.0 34.0 33.0 34.0 2 33.272 34.0 33.0 34.0 33.0 34.0 3 33.28375 34.0 33.0 34.0 33.0 34.0 4 33.24975 34.0 33.0 34.0 33.0 34.0 5 33.3505 34.0 33.0 34.0 33.0 34.0 6 37.52925 38.0 38.0 38.0 38.0 38.0 7 37.55425 38.0 38.0 38.0 38.0 38.0 8 37.5305 38.0 38.0 38.0 38.0 38.0 9 37.4575 38.0 38.0 38.0 38.0 38.0 10-14 37.4716 38.0 38.0 38.0 38.0 38.0 15-19 37.457100000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.47485 38.0 38.0 38.0 38.0 38.0 25-29 37.434349999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.44515 38.0 38.0 38.0 38.0 38.0 35-39 37.3947 38.0 38.0 38.0 38.0 38.0 40-44 37.39975 38.0 38.0 38.0 37.4 38.0 45-49 37.34415 38.0 38.0 38.0 37.2 38.0 50-54 37.31135 38.0 38.0 38.0 37.0 38.0 55-59 37.31660000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.274 38.0 38.0 38.0 37.0 38.0 65-69 37.235150000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.204750000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.1446 38.0 38.0 38.0 36.4 38.0 80-84 37.1117 38.0 38.0 38.0 36.4 38.0 85-89 37.03345 38.0 38.0 38.0 36.0 38.0 90-94 36.89075 38.0 38.0 38.0 35.4 38.0 95-99 36.8657 38.0 38.0 38.0 35.4 38.0 100-104 36.74715 38.0 38.0 38.0 34.8 38.0 105-109 36.6314 38.0 38.0 38.0 34.2 38.0 110-114 36.6219 38.0 38.0 38.0 34.4 38.0 115-119 36.439299999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.24909999999999 38.0 37.6 38.0 33.6 38.0 125-129 36.1534 38.0 37.4 38.0 33.2 38.0 130-134 35.965599999999995 38.0 36.6 38.0 33.0 38.0 135-139 35.655350000000006 38.0 36.0 38.0 31.0 38.0 140-144 35.31869999999999 38.0 35.8 38.0 29.2 38.0 145-149 34.7564 38.0 33.8 38.0 27.2 38.0 150-151 31.989 35.5 28.0 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 1.0 17 4.0 18 5.0 19 5.0 20 4.0 21 4.0 22 8.0 23 4.0 24 8.0 25 6.0 26 4.0 27 12.0 28 24.0 29 18.0 30 22.0 31 34.0 32 51.0 33 62.0 34 119.0 35 220.0 36 559.0 37 2824.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.0 20.7 15.55 26.75 2 25.525 28.875 28.749999999999996 16.85 3 21.349999999999998 30.3 28.749999999999996 19.6 4 23.875 34.075 22.35 19.7 5 25.05 35.15 22.95 16.85 6 21.825 37.574999999999996 21.725 18.875 7 21.875 22.325 35.975 19.825 8 21.4 25.7 27.875 25.025 9 22.275 25.724999999999998 28.675 23.325000000000003 10-14 23.755000000000003 29.035 25.11 22.1 15-19 23.425 28.294999999999998 27.224999999999998 21.055 20-24 23.68 28.04 26.950000000000003 21.33 25-29 23.935000000000002 28.675 26.915 20.474999999999998 30-34 23.43 28.275 27.345000000000002 20.95 35-39 23.635 28.384999999999998 26.46 21.52 40-44 23.875 27.975 27.355 20.794999999999998 45-49 23.544999999999998 28.32 27.26 20.875 50-54 23.815 28.52 27.365000000000002 20.3 55-59 23.66 28.405 26.815 21.12 60-64 23.785 27.744999999999997 27.250000000000004 21.22 65-69 23.400000000000002 27.865000000000002 27.625 21.11 70-74 24.21 28.065 27.07 20.655 75-79 24.044999999999998 27.41 27.62 20.925 80-84 23.86 28.555000000000003 26.529999999999998 21.055 85-89 24.01 27.845 27.365000000000002 20.78 90-94 23.555 28.04 27.485 20.919999999999998 95-99 23.665 28.435 27.200000000000003 20.7 100-104 23.830000000000002 28.360000000000003 26.865 20.945 105-109 23.775 28.144999999999996 27.33 20.75 110-114 24.485 28.050000000000004 27.13 20.335 115-119 24.085 28.035 27.435 20.445 120-124 24.02 28.255000000000003 27.045 20.68 125-129 25.14 28.084999999999997 26.505000000000003 20.27 130-134 25.045 27.46 27.43 20.064999999999998 135-139 25.650000000000002 28.04 26.474999999999998 19.835 140-144 25.695 27.944999999999997 26.595000000000002 19.765 145-149 25.979999999999997 28.23 26.055 19.735 150-151 25.837500000000002 27.500000000000004 26.337500000000002 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.5 19 2.0 20 0.5 21 1.0 22 1.0 23 0.0 24 2.0 25 4.0 26 2.5 27 1.5 28 3.5 29 4.5 30 6.0 31 9.0 32 11.0 33 19.0 34 38.5 35 53.0 36 61.5 37 82.5 38 113.5 39 146.5 40 187.5 41 221.5 42 260.5 43 302.0 44 290.0 45 289.5 46 301.0 47 276.0 48 244.0 49 209.5 50 185.5 51 160.0 52 116.5 53 82.5 54 67.0 55 58.0 56 43.5 57 31.5 58 24.5 59 15.0 60 17.0 61 13.5 62 6.5 63 8.0 64 8.5 65 5.0 66 2.5 67 1.0 68 1.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.0250000000000004 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 2.975 0.0 0.0 0.0 0.0 116-117 3.325 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 4.050000000000001 0.0 0.0 0.0 0.0 122-123 4.35 0.0 0.0 0.0 0.0 124-125 4.8 0.0 0.0 0.0 0.0 126-127 5.3125 0.0 0.0 0.0 0.0 128-129 5.8625 0.0 0.0 0.0 0.0 130-131 6.3125 0.0 0.0 0.0 0.0 132-133 6.875 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 8.024999999999999 0.0 0.0 0.0 0.0 138-139 8.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCATG 10 0.006830828 145.0 8 CAGCAGC 20 0.00593511 29.0 30-34 >>END_MODULE Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712921 spots for SRR7171484.sra Written 712921 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra Read 712910 spots for SRR7171484.sra Written 712910 spots for SRR7171484.sra SRR ids: ['SRR7171484.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_asfa1bd5 SRR7171484.sra spots: 14258211 blocks: [[1, 712910], [712911, 1425820], [1425821, 2138730], [2138731, 2851640], [2851641, 3564550], [3564551, 4277460], [4277461, 4990370], [4990371, 5703280], [5703281, 6416190], [6416191, 7129100], [7129101, 7842010], [7842011, 8554920], [8554921, 9267830], [9267831, 9980740], [9980741, 10693650], [10693651, 11406560], [11406561, 12119470], [12119471, 12832380], [12832381, 13545290], [13545291, 14258211]] SRR7171484 file size 4809939 SRR7171484 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171484 SRR7171484_1.fastq SRR7171484_2.fastq Input file: SRR7171484_1.fastq Paired file: SRR7171484_2.fastq trimmed: SRR7171484-trimmed-pair1.fastq, SRR7171484-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:12:22 2025 >> started Thu Feb 13 20:12:37 2025 >> done (15.102s) 14258211 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 1129 ( 0.01%) empty read pairs filtered out after trimming by size control 14257062 (99.99%) read pairs available; of these: 2110744 (14.80%) trimmed read pairs available after processing 12146318 (85.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 1 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 2 0.00% 28 3 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 4 0.00% 33 8 0.00% 34 1 0.00% 35 3 0.00% 36 2 0.00% 37 2 0.00% 38 3 0.00% 39 4 0.00% 40 1 0.00% 41 3 0.00% 42 3 0.00% 43 4 0.00% 44 14 0.00% 45 7 0.00% 46 12 0.00% 47 11 0.00% 48 8 0.00% 49 19 0.00% 50 16 0.00% 51 14 0.00% 52 19 0.00% 53 19 0.00% 54 20 0.00% 55 28 0.00% 56 38 0.00% 57 48 0.00% 58 45 0.00% 59 68 0.00% 60 62 0.00% 61 75 0.00% 62 112 0.00% 63 106 0.00% 64 149 0.00% 65 159 0.00% 66 183 0.00% 67 257 0.00% 68 243 0.00% 69 311 0.00% 70 352 0.00% 71 431 0.00% 72 512 0.00% 73 619 0.00% 74 747 0.01% 75 843 0.01% 76 897 0.01% 77 1048 0.01% 78 1233 0.01% 79 1315 0.01% 80 1623 0.01% 81 1759 0.01% 82 2086 0.01% 83 2522 0.02% 84 2803 0.02% 85 3197 0.02% 86 3630 0.03% 87 3882 0.03% 88 4280 0.03% 89 4743 0.03% 90 5303 0.04% 91 6028 0.04% 92 6644 0.05% 93 7306 0.05% 94 7915 0.06% 95 8894 0.06% 96 9302 0.07% 97 10254 0.07% 98 10753 0.08% 99 11398 0.08% 100 12457 0.09% 101 13260 0.09% 102 14324 0.10% 103 15558 0.11% 104 16494 0.12% 105 17477 0.12% 106 18789 0.13% 107 19545 0.14% 108 20069 0.14% 109 21204 0.15% 110 21990 0.15% 111 22704 0.16% 112 24283 0.17% 113 25619 0.18% 114 27135 0.19% 115 28627 0.20% 116 29546 0.21% 117 30552 0.21% 118 31436 0.22% 119 31841 0.22% 120 32847 0.23% 121 34125 0.24% 122 35254 0.25% 123 36581 0.26% 124 38303 0.27% 125 39398 0.28% 126 40868 0.29% 127 41570 0.29% 128 42236 0.30% 129 43121 0.30% 130 44218 0.31% 131 45420 0.32% 132 46620 0.33% 133 48281 0.34% 134 49365 0.35% 135 50877 0.36% 136 52174 0.37% 137 52918 0.37% 138 54091 0.38% 139 54124 0.38% 140 54667 0.38% 141 56175 0.39% 142 57319 0.40% 143 57524 0.40% 144 59339 0.42% 145 60546 0.42% 146 61402 0.43% 147 62458 0.44% 148 63189 0.44% 149 63635 0.45% 150 64766 0.45% 151 12146318 85.20% 14257062 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=18 prefix-density=0.47 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.18 sequence-density-rank=8 fanout-score=10.52 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=3.0 sequence=TTGCAGCCACTGCC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=21 prefix-density=0.38 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=23.34 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=8.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171484 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:13:21 Started mapping on | Feb 13 20:13:22 Finished on | Feb 13 20:15:29 Mapping speed, Million of reads per hour | 404.14 Number of input reads | 14257062 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13031422 Uniquely mapped reads % | 91.40% Average mapped length | 294.27 Number of splices: Total | 12489719 Number of splices: Annotated (sjdb) | 12261208 Number of splices: GT/AG | 12289492 Number of splices: GC/AG | 157044 Number of splices: AT/AC | 9579 Number of splices: Non-canonical | 33604 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363107 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 55603 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.55% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 862533 862533 862533 N_multimapping 363107 363107 363107 N_noFeature 274398 12903379 326814 N_ambiguous 142857 751 66789 UnstrandedReadsAssigned:12614167 PositiveStrandReadsAssigned:127292 NegativeStrandReadsAssigned:12637819 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171484 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171484-trimmed-pair1.fastq SRR7171484-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,257,062 reads, 12,641,746 reads pseudoaligned [quant] estimated average fragment length: 218.02 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52401 SRR7171484.ke.tsv 34699 SRR7171484.se.tsv 87100 total ==> SRR7171484.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.98 958 39.0959 Potri.005G024800.1.v4.1 1035 817.98 146 13.1185 Potri.004G059700.1.v4.1 961 743.985 21 2.07458 Potri.007G009000.2.v4.1 1416 1198.98 0 0 Potri.003G141000.2.v4.1 2943 2725.98 420 11.324 Potri.016G087400.1.v4.1 270 87.16 1047 882.885 Potri.015G069301.1.v4.1 564 348.78 0 0 Potri.010G195200.1.v4.1 1773 1555.98 403 19.036 Potri.012G127500.1.v4.1 977 759.985 6043 584.416 ==> SRR7171484.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 558 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 315 SRR7171484 completed mapping pipeline successfully