Starting /dee2/code/volunteer_pipeline.sh SRR7171485 current disk space = 3087474323456 free memory = 1446348576 SRR7171485 SRAfilesize dbb4a75f215e8ec1b8b532e72a8a3e79 SRR7171485.sra SRR7171485.sra file validated SRR7171485 is paired end SRR7171485 is conventional basespace SRR7171485 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171485_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.6925 32.0 25.0 33.0 18.0 34.0 2 31.2095 32.0 32.0 33.0 27.0 33.0 3 32.493 33.0 33.0 33.0 32.0 34.0 4 32.606 33.0 33.0 34.0 32.0 34.0 5 32.8405 33.0 33.0 34.0 32.0 34.0 6 36.916 38.0 37.0 38.0 36.0 38.0 7 37.353 38.0 38.0 38.0 37.0 38.0 8 37.489 38.0 38.0 38.0 37.0 38.0 9 37.5095 38.0 38.0 38.0 38.0 38.0 10-14 37.5438 38.0 38.0 38.0 38.0 38.0 15-19 37.6112 38.0 38.0 38.0 38.0 38.0 20-24 37.52525 38.0 38.0 38.0 38.0 38.0 25-29 37.3642 38.0 38.0 38.0 37.4 38.0 30-34 37.312 38.0 38.0 38.0 37.0 38.0 35-39 37.25005 38.0 38.0 38.0 37.0 38.0 40-44 37.3033 38.0 38.0 38.0 37.0 38.0 45-49 37.379200000000004 38.0 38.0 38.0 37.6 38.0 50-54 37.32705 38.0 38.0 38.0 37.0 38.0 55-59 37.19675 38.0 38.0 38.0 36.8 38.0 60-64 37.10305 38.0 38.0 38.0 36.2 38.0 65-69 37.148450000000004 38.0 38.0 38.0 36.2 38.0 70-74 37.1554 38.0 38.0 38.0 36.2 38.0 75-79 37.137299999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.11030000000001 38.0 38.0 38.0 36.0 38.0 85-89 37.072950000000006 38.0 38.0 38.0 36.0 38.0 90-94 37.01855 38.0 38.0 38.0 36.0 38.0 95-99 36.867000000000004 38.0 38.0 38.0 35.4 38.0 100-104 36.74715 38.0 38.0 38.0 34.8 38.0 105-109 36.70285 38.0 38.0 38.0 34.8 38.0 110-114 36.5961 38.0 38.0 38.0 34.0 38.0 115-119 36.3161 38.0 38.0 38.0 33.8 38.0 120-124 36.22135 38.0 37.6 38.0 33.4 38.0 125-129 36.1285 38.0 37.8 38.0 33.0 38.0 130-134 36.0983 38.0 37.0 38.0 33.0 38.0 135-139 35.7953 38.0 36.2 38.0 31.8 38.0 140-144 35.57285 38.0 36.0 38.0 31.0 38.0 145-149 35.25385 38.0 35.4 38.0 28.6 38.0 150-151 33.165 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 1.0 20 1.0 21 4.0 22 1.0 23 6.0 24 5.0 25 6.0 26 10.0 27 17.0 28 26.0 29 19.0 30 38.0 31 39.0 32 63.0 33 103.0 34 124.0 35 226.0 36 555.0 37 2754.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.033099297893685 13.089267803410232 12.788365095285858 38.08926780341023 2 22.275 15.325 31.5 30.9 3 20.225 19.025 26.174999999999997 34.575 4 22.1 26.150000000000002 23.35 28.4 5 20.825 31.55 25.324999999999996 22.3 6 18.224999999999998 35.325 26.25 20.200000000000003 7 14.499999999999998 28.749999999999996 39.1 17.65 8 16.525000000000002 28.225 30.975 24.275 9 16.55 27.775 33.900000000000006 21.775 10-14 18.365000000000002 31.55 27.46 22.625 15-19 18.66 29.62 27.915 23.805 20-24 19.05 29.799999999999997 27.55 23.599999999999998 25-29 18.321832183218323 30.653065306530653 27.797779777977798 23.22732273227323 30-34 19.310620841462807 29.791385261894042 27.420081044574516 23.477912852068638 35-39 19.014014014014013 30.305305305305307 27.152152152152155 23.52852852852853 40-44 19.32062634448947 30.546800740407225 26.934814147781278 23.19775876732203 45-49 19.66688340919322 29.220227079477816 27.40959335767519 23.70329615365378 50-54 19.425 29.799999999999997 27.089999999999996 23.685000000000002 55-59 19.395 29.42 27.384999999999998 23.799999999999997 60-64 19.23 29.29 27.529999999999998 23.95 65-69 18.815 29.555 27.37 24.26 70-74 19.415 28.744999999999997 27.775 24.065 75-79 19.2 29.044999999999998 27.57 24.185000000000002 80-84 20.09 28.994999999999997 27.215 23.7 85-89 19.68098404920246 29.086454322716136 27.2163608180409 24.016200810040502 90-94 19.625 28.595 27.42 24.36 95-99 19.62 28.865000000000002 26.905 24.610000000000003 100-104 19.945 29.189999999999998 26.775 24.09 105-109 19.975 29.09 26.66 24.275 110-114 20.0 28.875 26.69 24.435000000000002 115-119 20.044999999999998 28.27 27.18 24.505 120-124 20.02 28.87 26.3 24.81 125-129 20.565 28.435 26.450000000000003 24.55 130-134 20.580000000000002 28.59 26.3 24.529999999999998 135-139 20.45 28.560000000000002 26.38 24.610000000000003 140-144 21.015 27.889999999999997 25.985000000000003 25.11 145-149 20.395 28.24 25.72 25.645 150-151 20.0125 27.975 26.0125 26.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.5 14 1.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 2.0 22 1.5 23 1.0 24 1.5 25 4.5 26 8.5 27 10.5 28 12.5 29 21.0 30 27.5 31 40.5 32 58.0 33 60.0 34 73.0 35 97.0 36 108.5 37 122.0 38 148.5 39 178.5 40 201.0 41 216.5 42 225.0 43 227.0 44 234.0 45 267.5 46 270.5 47 224.5 48 201.5 49 181.5 50 155.5 51 131.0 52 111.5 53 99.0 54 70.0 55 46.5 56 35.5 57 25.5 58 18.5 59 16.0 60 14.0 61 9.5 62 7.0 63 7.0 64 5.5 65 2.0 66 3.0 67 3.0 68 2.5 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.055 35-39 0.1 40-44 0.055 45-49 0.034999999999999996 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.9750000000000001 0.0 0.0 0.0 0.0 96-97 1.275 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.825 0.0 0.0 0.0 0.0 108-109 3.475 0.0 0.0 0.0 0.0 110-111 4.0375 0.0 0.0 0.0 0.0 112-113 4.5 0.0 0.0 0.0 0.0 114-115 5.2125 0.0 0.0 0.0 0.0 116-117 5.7125 0.0 0.0 0.0 0.0 118-119 6.125 0.0 0.0 0.0 0.0 120-121 6.7875 0.0 0.0 0.0 0.0 122-123 7.512499999999999 0.0 0.0 0.0 0.0 124-125 8.2 0.0 0.0 0.0 0.0 126-127 8.850000000000001 0.0 0.0 0.0 0.0 128-129 9.575 0.0 0.0 0.0 0.0 130-131 10.65 0.0 0.0 0.0 0.0 132-133 11.4625 0.0 0.0 0.0 0.0 134-135 12.325 0.0 0.0 0.0 0.0 136-137 13.3625 0.0 0.0 0.0 0.0 138-139 14.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAATTT 10 0.006830828 145.0 3 ATAAAAC 10 0.006830828 145.0 8 ATATAAA 10 0.006830828 145.0 6 >>END_MODULE SRR7171485 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171485_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01225 34.0 33.0 34.0 32.0 34.0 2 33.00075 34.0 33.0 34.0 32.0 34.0 3 33.026 34.0 33.0 34.0 32.0 34.0 4 32.8865 34.0 33.0 34.0 32.0 34.0 5 32.8955 34.0 33.0 34.0 32.0 34.0 6 37.063 38.0 38.0 38.0 37.0 38.0 7 36.9525 38.0 38.0 38.0 37.0 38.0 8 37.0255 38.0 38.0 38.0 37.0 38.0 9 36.98525 38.0 38.0 38.0 37.0 38.0 10-14 37.002649999999996 38.0 38.0 38.0 36.8 38.0 15-19 36.953050000000005 38.0 38.0 38.0 36.4 38.0 20-24 36.957350000000005 38.0 38.0 38.0 36.6 38.0 25-29 37.0057 38.0 38.0 38.0 36.8 38.0 30-34 37.09695 38.0 38.0 38.0 37.0 38.0 35-39 37.15 38.0 38.0 38.0 37.0 38.0 40-44 37.13629999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.0486 38.0 38.0 38.0 36.8 38.0 50-54 36.96995 38.0 38.0 38.0 36.6 38.0 55-59 36.93425 38.0 38.0 38.0 36.0 38.0 60-64 36.7941 38.0 38.0 38.0 36.0 38.0 65-69 36.844 38.0 38.0 38.0 35.8 38.0 70-74 36.8938 38.0 38.0 38.0 36.0 38.0 75-79 36.888099999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.869749999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.780899999999995 38.0 38.0 38.0 35.6 38.0 90-94 36.73885 38.0 38.0 38.0 35.4 38.0 95-99 36.6715 38.0 38.0 38.0 35.4 38.0 100-104 36.5118 38.0 38.0 38.0 34.4 38.0 105-109 36.366299999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.21325 38.0 38.0 38.0 33.8 38.0 115-119 35.93485 38.0 38.0 38.0 32.0 38.0 120-124 35.7913 38.0 37.2 38.0 31.2 38.0 125-129 35.68805 38.0 37.0 38.0 31.0 38.0 130-134 35.6367 38.0 36.0 38.0 31.0 38.0 135-139 35.45035 38.0 36.0 38.0 29.6 38.0 140-144 35.03060000000001 38.0 35.6 38.0 26.6 38.0 145-149 34.79945 38.0 35.0 38.0 25.2 38.0 150-151 32.432125 36.5 29.0 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 1.0 14 1.0 15 2.0 16 1.0 17 8.0 18 6.0 19 9.0 20 5.0 21 0.0 22 15.0 23 8.0 24 15.0 25 11.0 26 26.0 27 26.0 28 30.0 29 30.0 30 30.0 31 46.0 32 67.0 33 76.0 34 130.0 35 203.0 36 468.0 37 2778.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.375 20.8 16.375 25.45 2 28.979694158937075 25.770869892203557 27.500626723489596 17.748809225369765 3 22.592778335005015 27.557673019057173 29.187562688064194 20.661985957873622 4 24.37923250564334 32.95711060948081 23.426134938550288 19.237521946325558 5 25.752256770310932 34.60381143430291 22.69307923771314 16.95085255767302 6 22.853566958698373 35.24405506883605 24.105131414267834 17.797246558197745 7 23.107769423558896 22.280701754385966 35.46365914786968 19.147869674185465 8 22.62590829366074 26.55975945878226 26.083688298672016 24.730643948884993 9 23.57805061388123 24.981207717364068 31.01979453770985 20.42094713104485 10-14 24.917293233082706 28.75689223057644 25.664160401002505 20.661654135338345 15-19 24.884723336006413 28.338011226944666 26.658981555733764 20.118283881315158 20-24 24.363344696210145 28.07800280729898 27.431321435732908 20.12733106075797 25-29 24.71943887775551 28.241482965931862 26.843687374749496 20.195390781563127 30-34 24.078894673608332 28.19883860632759 27.553063676411693 20.169203043652384 35-39 24.886130436958805 28.11452024625857 27.133490164672907 19.865859152109717 40-44 25.121401752190238 27.2090112640801 27.274092615769714 20.395494367959948 45-49 24.208258167969532 28.1870114251353 27.199839647223893 20.404890759671275 50-54 24.47987165989873 27.758560184488896 27.48784278337595 20.273725372236427 55-59 24.838337761291292 28.211940448142762 26.61286280014036 20.336858990425586 60-64 24.60651629072682 27.79949874686717 27.348370927318292 20.24561403508772 65-69 24.88347616899714 27.068611236405555 28.07597854959154 19.971934045005764 70-74 24.899879855826992 27.422907488986787 28.183820584701643 19.493392070484582 75-79 24.62738821646494 27.768330499149744 27.70831249374812 19.89596879063719 80-84 24.084816963392676 27.825565113022606 28.235647129425885 19.853970794158833 85-89 24.494494494494496 27.53253253253253 27.24724724724725 20.725725725725724 90-94 24.251227086046278 27.596914755083642 28.5184814184113 19.63337674045878 95-99 24.49000050122801 28.103854443386293 27.93343692045511 19.47270813493058 100-104 24.768112308849336 27.269992479318123 28.067184758084736 19.89471045374781 105-109 24.83329155176736 27.310102782652297 28.037102030584105 19.819503634996238 110-114 24.61268488342943 27.71621960391075 28.257708698922034 19.41338681373778 115-119 24.875921191156564 27.773600040106285 27.69338747681356 19.6570912919236 120-124 25.345829991980757 27.44587008821171 28.202686447473933 19.0056134723336 125-129 25.680953334668537 27.568596034448227 27.82395353494893 18.92649709593431 130-134 26.07541689618909 27.662877460063097 27.612799839751617 18.648905803996193 135-139 25.940961258958552 27.634942113967824 27.82538966571443 18.598706961359195 140-144 26.467786412634748 27.65104036099273 26.999247931812487 18.88192529456004 145-149 27.069440962647278 27.23489596390073 27.275006267234897 18.4206568062171 150-151 26.372524442216093 26.761093005765858 27.93933316620707 18.927049385810978 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 2.0 26 2.0 27 1.0 28 4.0 29 7.0 30 6.0 31 11.0 32 19.5 33 24.0 34 34.0 35 50.0 36 72.5 37 97.0 38 123.5 39 149.5 40 177.5 41 218.5 42 252.5 43 260.0 44 259.5 45 303.0 46 319.0 47 270.5 48 242.0 49 221.0 50 185.5 51 158.0 52 126.0 53 100.0 54 71.0 55 45.0 56 40.0 57 31.5 58 23.0 59 19.5 60 17.5 61 9.5 62 7.0 63 7.5 64 5.0 65 2.5 66 0.5 67 0.5 68 2.5 69 2.5 70 1.5 71 1.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.3 4 0.325 5 0.3 6 0.125 7 0.25 8 0.22499999999999998 9 0.22499999999999998 10-14 0.25 15-19 0.24 20-24 0.26 25-29 0.2 30-34 0.12 35-39 0.105 40-44 0.125 45-49 0.22 50-54 0.265 55-59 0.255 60-64 0.25 65-69 0.23500000000000001 70-74 0.12 75-79 0.03 80-84 0.02 85-89 0.1 90-94 0.16999999999999998 95-99 0.245 100-104 0.27499999999999997 105-109 0.27499999999999997 110-114 0.27499999999999997 115-119 0.265 120-124 0.24 125-129 0.13999999999999999 130-134 0.155 135-139 0.23500000000000001 140-144 0.27499999999999997 145-149 0.27499999999999997 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6499999999999999 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.05 0.0 0.0 0.0 0.0 96-97 1.3875 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.15 0.0 0.0 0.0 0.0 104-105 2.4749999999999996 0.0 0.0 0.0 0.0 106-107 2.9124999999999996 0.0 0.0 0.0 0.0 108-109 3.5625 0.0 0.0 0.0 0.0 110-111 4.1375 0.0 0.0 0.0 0.0 112-113 4.6875 0.0 0.0 0.0 0.0 114-115 5.4 0.0 0.0 0.0 0.0 116-117 5.9 0.0 0.0 0.0 0.0 118-119 6.3125 0.0 0.0 0.0 0.0 120-121 6.975 0.0 0.0 0.0 0.0 122-123 7.675 0.0 0.0 0.0 0.0 124-125 8.3125 0.0 0.0 0.0 0.0 126-127 9.024999999999999 0.0 0.0 0.0 0.0 128-129 9.7625 0.0 0.0 0.0 0.0 130-131 10.85 0.0 0.0 0.0 0.0 132-133 11.7125 0.0 0.0 0.0 0.0 134-135 12.6125 0.0 0.0 0.0 0.0 136-137 13.6375 0.0 0.0 0.0 0.0 138-139 14.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880292 spots for SRR7171485.sra Written 880292 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra Read 880277 spots for SRR7171485.sra Written 880277 spots for SRR7171485.sra SRR ids: ['SRR7171485.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jdegje7l SRR7171485.sra spots: 17605555 blocks: [[1, 880277], [880278, 1760554], [1760555, 2640831], [2640832, 3521108], [3521109, 4401385], [4401386, 5281662], [5281663, 6161939], [6161940, 7042216], [7042217, 7922493], [7922494, 8802770], [8802771, 9683047], [9683048, 10563324], [10563325, 11443601], [11443602, 12323878], [12323879, 13204155], [13204156, 14084432], [14084433, 14964709], [14964710, 15844986], [15844987, 16725263], [16725264, 17605555]] SRR7171485 file size 5944244 SRR7171485 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171485 SRR7171485_1.fastq SRR7171485_2.fastq Input file: SRR7171485_1.fastq Paired file: SRR7171485_2.fastq trimmed: SRR7171485-trimmed-pair1.fastq, SRR7171485-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:55:53 2025 >> started Thu Feb 13 19:56:13 2025 >> done (19.658s) 17605555 read pairs processed; of these: 571 ( 0.00%) short read pairs filtered out after trimming by size control 9455 ( 0.05%) empty read pairs filtered out after trimming by size control 17595529 (99.94%) read pairs available; of these: 3812524 (21.67%) trimmed read pairs available after processing 13783005 (78.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 6 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 0 0.00% 28 5 0.00% 29 1 0.00% 30 4 0.00% 31 3 0.00% 32 1 0.00% 33 2 0.00% 34 3 0.00% 35 0 0.00% 36 6 0.00% 37 5 0.00% 38 5 0.00% 39 9 0.00% 40 9 0.00% 41 9 0.00% 42 7 0.00% 43 10 0.00% 44 10 0.00% 45 14 0.00% 46 19 0.00% 47 17 0.00% 48 28 0.00% 49 22 0.00% 50 37 0.00% 51 30 0.00% 52 53 0.00% 53 48 0.00% 54 65 0.00% 55 67 0.00% 56 58 0.00% 57 98 0.00% 58 106 0.00% 59 119 0.00% 60 176 0.00% 61 223 0.00% 62 240 0.00% 63 279 0.00% 64 331 0.00% 65 362 0.00% 66 442 0.00% 67 470 0.00% 68 531 0.00% 69 696 0.00% 70 813 0.00% 71 934 0.01% 72 1155 0.01% 73 1358 0.01% 74 1561 0.01% 75 1733 0.01% 76 1957 0.01% 77 2239 0.01% 78 2599 0.01% 79 3009 0.02% 80 3486 0.02% 81 3970 0.02% 82 4729 0.03% 83 5570 0.03% 84 6228 0.04% 85 6783 0.04% 86 7480 0.04% 87 8256 0.05% 88 9135 0.05% 89 9896 0.06% 90 10981 0.06% 91 12349 0.07% 92 13713 0.08% 93 15242 0.09% 94 17280 0.10% 95 18386 0.10% 96 19678 0.11% 97 20553 0.12% 98 21655 0.12% 99 23017 0.13% 100 24949 0.14% 101 26837 0.15% 102 29107 0.17% 103 31195 0.18% 104 32815 0.19% 105 35019 0.20% 106 36986 0.21% 107 37706 0.21% 108 39130 0.22% 109 40782 0.23% 110 42441 0.24% 111 44421 0.25% 112 46558 0.26% 113 49081 0.28% 114 52480 0.30% 115 54666 0.31% 116 56075 0.32% 117 60721 0.35% 118 61424 0.35% 119 61409 0.35% 120 61026 0.35% 121 62900 0.36% 122 64377 0.37% 123 67755 0.39% 124 70461 0.40% 125 72018 0.41% 126 74287 0.42% 127 75987 0.43% 128 76033 0.43% 129 76616 0.44% 130 77801 0.44% 131 78739 0.45% 132 81633 0.46% 133 84262 0.48% 134 86031 0.49% 135 88708 0.50% 136 91044 0.52% 137 90690 0.52% 138 91520 0.52% 139 91631 0.52% 140 92176 0.52% 141 99268 0.56% 142 96452 0.55% 143 103194 0.59% 144 103668 0.59% 145 103917 0.59% 146 103472 0.59% 147 105472 0.60% 148 105168 0.60% 149 104355 0.59% 150 107683 0.61% 151 13783005 78.33% 17595529 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=19 prefix-density=0.64 prefix-fanout=2.6 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=13.05 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.9 sequence=ATCAAATTACAAGCACGTATGGTCTTGTAATATTTGCAGTAAACCGAGCTTTTTTTTCTAAAAAGGAAGAAAAACAGTAGATGGACATAACCAAACAAGCCACACATCAAGCATCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTCTTTCTCCTTCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATCTTCTCGAG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=22 prefix-density=0.53 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=157.81 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.4 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCG SRR7171485 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:56:56 Started mapping on | Feb 13 19:56:56 Finished on | Feb 13 19:59:04 Mapping speed, Million of reads per hour | 494.87 Number of input reads | 17595529 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16049215 Uniquely mapped reads % | 91.21% Average mapped length | 290.45 Number of splices: Total | 12000051 Number of splices: Annotated (sjdb) | 11704860 Number of splices: GT/AG | 11788444 Number of splices: GC/AG | 149566 Number of splices: AT/AC | 11852 Number of splices: Non-canonical | 50189 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.05% Deletion average length | 2.54 Insertion rate per base | 0.03% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 459208 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 260334 % of reads mapped to too many loci | 1.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.33% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1087106 1087106 1087106 N_multimapping 459208 459208 459208 N_noFeature 445259 15831666 512001 N_ambiguous 224825 1047 73625 UnstrandedReadsAssigned:15379131 PositiveStrandReadsAssigned:216502 NegativeStrandReadsAssigned:15463589 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171485 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171485-trimmed-pair1.fastq SRR7171485-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,595,529 reads, 15,848,742 reads pseudoaligned [quant] estimated average fragment length: 198.811 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,283 rounds 52401 SRR7171485.ke.tsv 34699 SRR7171485.se.tsv 87100 total ==> SRR7171485.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.19 1918 54.4387 Potri.005G024800.1.v4.1 1035 837.189 963 59.4263 Potri.004G059700.1.v4.1 961 763.203 45 3.04613 Potri.007G009000.2.v4.1 1416 1218.19 0 0 Potri.003G141000.2.v4.1 2943 2745.19 684 12.8724 Potri.016G087400.1.v4.1 270 94.6668 1228 670.156 Potri.015G069301.1.v4.1 564 367.01 0 0 Potri.010G195200.1.v4.1 1773 1575.19 426 13.9718 Potri.012G127500.1.v4.1 977 779.198 6974 462.391 ==> SRR7171485.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 128 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 1445 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 452 SRR7171485 completed mapping pipeline successfully