Starting /dee2/code/volunteer_pipeline.sh SRR7171486 current disk space = 3087622590464 free memory = 1536064164 SRR7171486 SRAfilesize 63073e73761e825fad00096ff1e8779d SRR7171486.sra SRR7171486.sra file validated SRR7171486 is paired end SRR7171486 is conventional basespace SRR7171486 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171486_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.058 33.0 32.0 33.0 25.0 34.0 2 31.11775 33.0 31.0 33.0 28.0 33.0 3 31.844 33.0 32.0 33.0 30.0 33.0 4 32.69125 33.0 33.0 33.0 32.0 34.0 5 32.931 33.0 33.0 34.0 32.0 34.0 6 36.63 38.0 37.0 38.0 34.0 38.0 7 37.26 38.0 38.0 38.0 36.0 38.0 8 37.3375 38.0 38.0 38.0 37.0 38.0 9 37.524 38.0 38.0 38.0 37.0 38.0 10-14 37.5287 38.0 38.0 38.0 38.0 38.0 15-19 37.526650000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.499700000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.463150000000006 38.0 38.0 38.0 37.8 38.0 30-34 37.4436 38.0 38.0 38.0 38.0 38.0 35-39 37.3968 38.0 38.0 38.0 37.0 38.0 40-44 37.414049999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.42985 38.0 38.0 38.0 37.0 38.0 50-54 37.36415 38.0 38.0 38.0 37.0 38.0 55-59 37.2978 38.0 38.0 38.0 37.0 38.0 60-64 37.22705 38.0 38.0 38.0 36.8 38.0 65-69 37.158899999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.0869 38.0 38.0 38.0 36.0 38.0 75-79 37.0342 38.0 38.0 38.0 36.0 38.0 80-84 37.033100000000005 38.0 38.0 38.0 36.0 38.0 85-89 37.044 38.0 38.0 38.0 36.0 38.0 90-94 37.0268 38.0 38.0 38.0 36.0 38.0 95-99 36.86025 38.0 38.0 38.0 35.0 38.0 100-104 36.71635 38.0 38.0 38.0 34.8 38.0 105-109 36.705949999999994 38.0 38.0 38.0 35.0 38.0 110-114 36.7154 38.0 38.0 38.0 34.8 38.0 115-119 36.58245 38.0 38.0 38.0 34.2 38.0 120-124 36.4873 38.0 38.0 38.0 34.0 38.0 125-129 36.4591 38.0 38.0 38.0 34.0 38.0 130-134 36.336600000000004 38.0 38.0 38.0 33.8 38.0 135-139 36.074 38.0 37.2 38.0 33.0 38.0 140-144 35.9837 38.0 36.2 38.0 33.0 38.0 145-149 35.79005 38.0 36.0 38.0 31.4 38.0 150-151 33.937375 37.0 33.5 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 2.0 23 3.0 24 5.0 25 12.0 26 10.0 27 14.0 28 20.0 29 28.0 30 30.0 31 47.0 32 63.0 33 62.0 34 115.0 35 219.0 36 463.0 37 2904.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.86429112964367 12.635835228708617 9.299974728329543 37.19989891331817 2 22.775000000000002 14.000000000000002 32.775 30.45 3 21.45 18.4 24.5 35.65 4 23.1 25.85 22.05 28.999999999999996 5 22.425 31.0 23.5 23.075000000000003 6 20.5 33.425 24.275 21.8 7 14.899999999999999 28.349999999999998 38.9 17.849999999999998 8 17.375 27.05 31.825 23.75 9 17.299999999999997 25.95 34.375 22.375 10-14 19.52 30.455 27.02 23.005 15-19 20.085 29.21 27.705000000000002 23.0 20-24 19.775000000000002 29.085 27.884999999999998 23.255 25-29 19.5 29.409999999999997 27.189999999999998 23.9 30-34 19.755 29.189999999999998 27.389999999999997 23.665 35-39 19.759999999999998 28.92 27.63 23.69 40-44 19.885 29.215000000000003 26.765 24.135 45-49 20.115 29.5 26.375 24.01 50-54 20.150000000000002 29.01 27.055 23.785 55-59 20.349999999999998 28.79 26.88 23.98 60-64 19.61 28.754999999999995 27.49 24.145 65-69 20.145 28.535 27.3 24.02 70-74 19.634999999999998 28.23 27.565 24.57 75-79 20.305 28.63 26.669999999999998 24.395 80-84 20.285 28.49 27.22 24.005000000000003 85-89 20.330000000000002 28.18 27.615000000000002 23.875 90-94 20.335 28.12 27.389999999999997 24.154999999999998 95-99 20.415 28.595 26.784999999999997 24.205 100-104 20.115 28.050000000000004 27.99 23.845 105-109 20.45 26.825 27.794999999999998 24.93 110-114 20.905 27.82 27.150000000000002 24.125 115-119 20.86 27.68 27.445000000000004 24.015 120-124 21.07 28.305000000000003 26.669999999999998 23.955000000000002 125-129 20.849999999999998 27.595 27.16 24.395 130-134 21.23 27.83 26.76 24.18 135-139 20.765 28.299999999999997 26.650000000000002 24.285 140-144 21.37 27.839999999999996 26.1 24.69 145-149 21.349999999999998 28.28 26.31 24.060000000000002 150-151 21.1375 28.325 25.674999999999997 24.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 2.0 21 3.0 22 2.5 23 2.0 24 1.5 25 2.0 26 3.0 27 4.0 28 6.5 29 12.5 30 21.5 31 24.5 32 30.5 33 44.0 34 60.5 35 84.5 36 83.5 37 92.5 38 133.5 39 151.0 40 178.0 41 218.0 42 238.5 43 242.0 44 257.5 45 271.0 46 260.0 47 246.5 48 223.5 49 208.5 50 170.0 51 146.5 52 139.5 53 102.5 54 79.0 55 56.0 56 42.0 57 38.0 58 30.0 59 20.5 60 11.0 61 8.5 62 12.0 63 10.0 64 4.0 65 3.0 66 3.5 67 2.5 68 1.5 69 2.0 70 1.0 71 1.0 72 1.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.15 0.0 0.0 0.0 0.0 108-109 2.5999999999999996 0.0 0.0 0.0 0.0 110-111 2.8625 0.0 0.0 0.0 0.0 112-113 3.3375000000000004 0.0 0.0 0.0 0.0 114-115 3.8625 0.0 0.0 0.0 0.0 116-117 4.2125 0.0 0.0 0.0 0.0 118-119 4.8375 0.0 0.0 0.0 0.0 120-121 5.45 0.0 0.0 0.0 0.0 122-123 6.025 0.0 0.0 0.0 0.0 124-125 6.7 0.0 0.0 0.0 0.0 126-127 7.4 0.0 0.0 0.0 0.0 128-129 8.1375 0.0 0.0 0.0 0.0 130-131 8.6375 0.0 0.0 0.0 0.0 132-133 9.375 0.0 0.0 0.0 0.0 134-135 10.1125 0.0 0.0 0.0 0.0 136-137 11.1125 0.0 0.0 0.0 0.0 138-139 12.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGTCA 10 0.006830828 145.0 145 >>END_MODULE SRR7171486 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171486_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00725 33.0 33.0 34.0 32.0 34.0 2 33.09375 34.0 33.0 34.0 32.0 34.0 3 33.1265 34.0 33.0 34.0 33.0 34.0 4 33.047 34.0 33.0 34.0 33.0 34.0 5 33.2095 34.0 33.0 34.0 33.0 34.0 6 37.22075 38.0 38.0 38.0 37.0 38.0 7 37.2625 38.0 38.0 38.0 37.0 38.0 8 37.28225 38.0 38.0 38.0 37.0 38.0 9 37.20825 38.0 38.0 38.0 37.0 38.0 10-14 37.1661 38.0 38.0 38.0 37.0 38.0 15-19 37.1352 38.0 38.0 38.0 37.0 38.0 20-24 37.19225 38.0 38.0 38.0 37.0 38.0 25-29 37.1631 38.0 38.0 38.0 37.0 38.0 30-34 37.16855 38.0 38.0 38.0 37.0 38.0 35-39 37.13975000000001 38.0 38.0 38.0 37.0 38.0 40-44 36.5935 37.8 37.4 38.0 34.4 38.0 45-49 37.051050000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.0749 38.0 38.0 38.0 37.0 38.0 55-59 37.01215 38.0 38.0 38.0 36.4 38.0 60-64 36.9822 38.0 38.0 38.0 36.2 38.0 65-69 36.96419999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.9862 38.0 38.0 38.0 36.0 38.0 75-79 36.959050000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.91515 38.0 38.0 38.0 35.8 38.0 85-89 36.862350000000006 38.0 38.0 38.0 35.8 38.0 90-94 36.77205 38.0 38.0 38.0 35.2 38.0 95-99 36.706450000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.575 38.0 38.0 38.0 34.6 38.0 105-109 36.528800000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.4283 38.0 38.0 38.0 34.0 38.0 115-119 36.354200000000006 38.0 38.0 38.0 34.0 38.0 120-124 36.20375 38.0 38.0 38.0 33.6 38.0 125-129 36.1506 38.0 38.0 38.0 33.0 38.0 130-134 35.9599 38.0 37.0 38.0 33.0 38.0 135-139 35.8849 38.0 36.8 38.0 32.2 38.0 140-144 35.47279999999999 38.0 36.0 38.0 30.0 38.0 145-149 35.2815 38.0 36.0 38.0 29.0 38.0 150-151 32.841625 35.5 31.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 4.0 18 4.0 19 5.0 20 4.0 21 4.0 22 11.0 23 8.0 24 17.0 25 15.0 26 18.0 27 20.0 28 26.0 29 25.0 30 42.0 31 44.0 32 65.0 33 76.0 34 105.0 35 184.0 36 430.0 37 2887.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.150000000000006 19.8 13.275 26.775 2 25.237618809404704 25.812906453226613 29.889944972486244 19.05952976488244 3 19.959979989995 28.36418209104552 30.265132566283143 21.410705352676338 4 25.437718859429715 32.566283141570786 23.386693346673336 18.609304652326163 5 25.71285642821411 34.667333666833414 22.611305652826413 17.008504252126063 6 22.002503128911137 36.17021276595745 24.180225281602002 17.647058823529413 7 20.450563204005007 21.30162703379224 36.846057571964955 21.401752190237797 8 21.97197197197197 25.625625625625624 27.2022022022022 25.2002002002002 9 22.95369211514393 25.65707133917397 29.011264080100123 22.377972465581976 10-14 24.20251389653964 28.954880064099353 25.329260353548 21.51334568581301 15-19 24.097531667751465 28.45841886546838 26.640965303159263 20.803084163620888 20-24 23.537953134388143 27.87402363308632 27.58361706388944 21.00440616863609 25-29 24.397077954568196 28.32482737916542 26.618633043130192 20.659461623136195 30-34 24.5749149829966 27.825565113022606 27.485497099419888 20.114022804560914 35-39 23.985 27.755000000000003 27.155 21.105 40-44 24.19846946431251 28.28990146551293 26.589306257190014 20.922322812984547 45-49 23.90031526797778 27.513386378421657 27.44833108141921 21.137967272181353 50-54 23.474648380799838 27.969367836228038 27.38875819610591 21.16722558686621 55-59 24.07907907907908 27.60760760760761 27.642642642642645 20.67067067067067 60-64 24.05905905905906 26.636636636636634 27.86786786786787 21.436436436436438 65-69 23.947960970728047 27.480610457843387 27.50562922191644 21.065799349512133 70-74 24.635 27.55 27.22 20.595 75-79 24.52 27.67 27.389999999999997 20.419999999999998 80-84 24.169999999999998 27.625 27.665 20.54 85-89 24.0 28.310000000000002 27.18 20.51 90-94 24.06063941562015 27.768049232000802 27.6329614249262 20.538349927452845 95-99 24.523106193361038 27.211735843388574 27.912682120863163 20.35247584238722 100-104 24.951159645343886 27.480839553173368 27.140209387366625 20.427791414116115 105-109 24.951159645343886 27.84150678755698 27.54596002604819 19.661373541050946 110-114 24.974954918853935 27.664796633941098 27.604688439190543 19.755560008014424 115-119 24.942413620430646 27.566349524286434 26.945418127190784 20.54581872809214 120-124 24.93618299214175 28.049451924520746 27.488863306471796 19.52550177686571 125-129 24.89746924077223 28.05841752525758 27.403220966289886 19.640892267680304 130-134 25.270054010802163 27.580516103220642 27.48049609921984 19.66893378675735 135-139 26.134600950713033 28.231173380035024 26.83512634475857 18.79909932449337 140-144 26.505058599619353 27.9324852248823 26.57517780226385 18.9872783732345 145-149 26.74214718701468 27.859325685085917 26.782225339411852 18.61630178848755 150-151 26.077154308617235 27.655310621242485 27.11673346693387 19.150801603206414 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 1.0 24 0.0 25 0.5 26 1.5 27 2.5 28 2.5 29 4.5 30 6.5 31 6.5 32 11.0 33 21.5 34 35.5 35 46.0 36 56.0 37 80.0 38 118.5 39 152.5 40 179.0 41 212.0 42 252.5 43 281.0 44 304.5 45 297.5 46 277.5 47 271.0 48 238.5 49 219.5 50 201.0 51 154.0 52 124.0 53 106.0 54 83.0 55 60.5 56 42.5 57 32.0 58 27.5 59 20.5 60 11.5 61 11.5 62 10.0 63 6.0 64 5.5 65 5.0 66 3.5 67 2.0 68 0.5 69 1.0 70 1.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.05 5 0.05 6 0.125 7 0.125 8 0.1 9 0.125 10-14 0.155 15-19 0.135 20-24 0.13999999999999999 25-29 0.06999999999999999 30-34 0.02 35-39 0.0 40-44 0.034999999999999996 45-49 0.08499999999999999 50-54 0.105 55-59 0.1 60-64 0.1 65-69 0.075 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.065 95-99 0.135 100-104 0.185 105-109 0.185 110-114 0.18 115-119 0.15 120-124 0.105 125-129 0.03 130-134 0.02 135-139 0.075 140-144 0.16999999999999998 145-149 0.19499999999999998 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5542957923910304 1.0999999999999999 3 0.07558578987150416 0.22499999999999998 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.55 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.7625 0.0 0.0 0.0 0.0 112-113 3.275 0.0 0.0 0.0 0.0 114-115 3.8125 0.0 0.0 0.0 0.0 116-117 4.175 0.0 0.0 0.0 0.0 118-119 4.775 0.0 0.0 0.0 0.0 120-121 5.375 0.0 0.0 0.0 0.0 122-123 5.925 0.0 0.0 0.0 0.0 124-125 6.612500000000001 0.0 0.0 0.0 0.0 126-127 7.324999999999999 0.0 0.0 0.0 0.0 128-129 8.0625 0.0 0.0 0.0 0.0 130-131 8.5625 0.0 0.0 0.0 0.0 132-133 9.3125 0.0 0.0 0.0 0.0 134-135 10.05 0.0 0.0 0.0 0.0 136-137 11.0 0.0 0.0 0.0 0.0 138-139 11.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGCT 10 0.006830828 145.0 7 CCAATGC 10 0.006830828 145.0 6 >>END_MODULE Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733578 spots for SRR7171486.sra Written 733578 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra Read 733559 spots for SRR7171486.sra Written 733559 spots for SRR7171486.sra SRR ids: ['SRR7171486.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fa4kh0wz SRR7171486.sra spots: 14671199 blocks: [[1, 733559], [733560, 1467118], [1467119, 2200677], [2200678, 2934236], [2934237, 3667795], [3667796, 4401354], [4401355, 5134913], [5134914, 5868472], [5868473, 6602031], [6602032, 7335590], [7335591, 8069149], [8069150, 8802708], [8802709, 9536267], [9536268, 10269826], [10269827, 11003385], [11003386, 11736944], [11736945, 12470503], [12470504, 13204062], [13204063, 13937621], [13937622, 14671199]] SRR7171486 file size 4949887 SRR7171486 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171486 SRR7171486_1.fastq SRR7171486_2.fastq Input file: SRR7171486_1.fastq Paired file: SRR7171486_2.fastq trimmed: SRR7171486-trimmed-pair1.fastq, SRR7171486-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:03:43 2025 >> started Thu Feb 13 20:03:59 2025 >> done (15.684s) 14671199 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 1079 ( 0.01%) empty read pairs filtered out after trimming by size control 14670107 (99.99%) read pairs available; of these: 2751564 (18.76%) trimmed read pairs available after processing 11918543 (81.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 2 0.00% 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 3 0.00% 32 1 0.00% 33 1 0.00% 34 2 0.00% 35 1 0.00% 36 2 0.00% 37 3 0.00% 38 1 0.00% 39 0 0.00% 40 3 0.00% 41 2 0.00% 42 2 0.00% 43 5 0.00% 44 4 0.00% 45 3 0.00% 46 9 0.00% 47 6 0.00% 48 7 0.00% 49 14 0.00% 50 15 0.00% 51 31 0.00% 52 20 0.00% 53 18 0.00% 54 23 0.00% 55 26 0.00% 56 40 0.00% 57 41 0.00% 58 55 0.00% 59 54 0.00% 60 105 0.00% 61 121 0.00% 62 123 0.00% 63 137 0.00% 64 151 0.00% 65 187 0.00% 66 249 0.00% 67 298 0.00% 68 336 0.00% 69 387 0.00% 70 451 0.00% 71 561 0.00% 72 653 0.00% 73 811 0.01% 74 961 0.01% 75 1049 0.01% 76 1292 0.01% 77 1387 0.01% 78 1646 0.01% 79 1874 0.01% 80 2239 0.02% 81 2607 0.02% 82 2910 0.02% 83 3334 0.02% 84 3864 0.03% 85 4484 0.03% 86 4937 0.03% 87 5439 0.04% 88 5999 0.04% 89 6532 0.04% 90 7195 0.05% 91 8147 0.06% 92 8976 0.06% 93 9982 0.07% 94 11068 0.08% 95 11887 0.08% 96 13029 0.09% 97 13932 0.09% 98 14969 0.10% 99 15770 0.11% 100 16949 0.12% 101 18171 0.12% 102 19481 0.13% 103 20917 0.14% 104 22317 0.15% 105 24028 0.16% 106 25402 0.17% 107 26433 0.18% 108 27663 0.19% 109 28691 0.20% 110 29706 0.20% 111 31400 0.21% 112 32823 0.22% 113 34246 0.23% 114 36333 0.25% 115 38329 0.26% 116 39327 0.27% 117 41813 0.29% 118 43271 0.29% 119 43466 0.30% 120 43990 0.30% 121 45260 0.31% 122 46648 0.32% 123 48625 0.33% 124 50031 0.34% 125 51641 0.35% 126 53313 0.36% 127 54751 0.37% 128 55821 0.38% 129 57399 0.39% 130 58386 0.40% 131 58789 0.40% 132 60496 0.41% 133 62247 0.42% 134 63130 0.43% 135 64899 0.44% 136 65197 0.44% 137 67260 0.46% 138 68185 0.46% 139 68532 0.47% 140 70054 0.48% 141 72123 0.49% 142 73757 0.50% 143 73494 0.50% 144 77714 0.53% 145 77049 0.53% 146 75781 0.52% 147 77533 0.53% 148 78492 0.54% 149 78138 0.53% 150 81581 0.56% 151 11918543 81.24% 14670107 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=31 prefix-density=0.42 prefix-fanout=2.3 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=44.36 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=12.3 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGTGTCTGAGCTCTCGACCTCCAGAGTGATGGTCTT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=31 prefix-density=0.72 prefix-fanout=2.1 sequence=CTGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=95.17 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.8 sequence=GAAAAATGGCGACTCCAATGAAGTACATTTGCTTGTTTATGTTTCTTGCAATTCTCAGCATTGCTGGGCTCAATCAAGTTGACGGGGCTGGTGAATGTGGGAAAAACACCACTCCTGACATGGAGGCTTTCAAGATGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGGAGCTTATACTTTACCTTGAAGAGTGAAGACCATGAACTGTGCTCGCCCTGTAAAGTACTTTCTATCAACCTGCTGGAGTT SRR7171486 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:04:46 Started mapping on | Feb 13 20:04:46 Finished on | Feb 13 20:07:19 Mapping speed, Million of reads per hour | 345.18 Number of input reads | 14670107 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13199100 Uniquely mapped reads % | 89.97% Average mapped length | 292.14 Number of splices: Total | 11774724 Number of splices: Annotated (sjdb) | 11545612 Number of splices: GT/AG | 11577851 Number of splices: GC/AG | 147410 Number of splices: AT/AC | 9522 Number of splices: Non-canonical | 39941 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.35 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 367482 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 159263 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.18% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1103525 1103525 1103525 N_multimapping 367482 367482 367482 N_noFeature 312889 13055915 366822 N_ambiguous 150759 867 61075 UnstrandedReadsAssigned:12735452 PositiveStrandReadsAssigned:142318 NegativeStrandReadsAssigned:12771203 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171486 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171486-trimmed-pair1.fastq SRR7171486-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,670,107 reads, 12,928,787 reads pseudoaligned [quant] estimated average fragment length: 206.526 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR7171486.ke.tsv 34699 SRR7171486.se.tsv 87100 total ==> SRR7171486.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1812.47 691 24.8078 Potri.005G024800.1.v4.1 1035 829.474 168 13.1792 Potri.004G059700.1.v4.1 961 755.474 26 2.23942 Potri.007G009000.2.v4.1 1416 1210.47 0 0 Potri.003G141000.2.v4.1 2943 2737.47 336 7.98676 Potri.016G087400.1.v4.1 270 91.7802 1256.53 890.851 Potri.015G069301.1.v4.1 564 359.553 0 0 Potri.010G195200.1.v4.1 1773 1567.47 336 13.9483 Potri.012G127500.1.v4.1 977 771.474 4572 385.626 ==> SRR7171486.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 680 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 354 SRR7171486 completed mapping pipeline successfully