Starting /dee2/code/volunteer_pipeline.sh SRR7171487 current disk space = 3087612293120 free memory = 1541061056 SRR7171487 SRAfilesize e14acf91302ddd9f727ed783e7726383 SRR7171487.sra SRR7171487.sra file validated SRR7171487 is paired end SRR7171487 is conventional basespace SRR7171487 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171487_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.879 33.0 31.0 33.0 25.0 34.0 2 30.857 31.0 31.0 33.0 28.0 33.0 3 31.7835 33.0 32.0 33.0 30.0 33.0 4 32.612 33.0 33.0 33.0 32.0 34.0 5 32.85025 33.0 33.0 34.0 32.0 34.0 6 36.8235 38.0 37.0 38.0 35.0 38.0 7 37.28325 38.0 38.0 38.0 36.0 38.0 8 37.44725 38.0 38.0 38.0 37.0 38.0 9 37.55675 38.0 38.0 38.0 38.0 38.0 10-14 37.5406 38.0 38.0 38.0 38.0 38.0 15-19 37.5166 38.0 38.0 38.0 38.0 38.0 20-24 37.5181 38.0 38.0 38.0 38.0 38.0 25-29 37.46065 38.0 38.0 38.0 37.4 38.0 30-34 37.46385 38.0 38.0 38.0 37.4 38.0 35-39 37.416000000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.36655 38.0 38.0 38.0 37.0 38.0 45-49 37.40304999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.35335 38.0 38.0 38.0 37.0 38.0 55-59 37.323 38.0 38.0 38.0 37.0 38.0 60-64 37.237950000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.1304 38.0 38.0 38.0 36.0 38.0 70-74 37.07335 38.0 38.0 38.0 36.0 38.0 75-79 37.044050000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.017900000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.06 38.0 38.0 38.0 36.0 38.0 90-94 37.0077 38.0 38.0 38.0 36.0 38.0 95-99 36.89684999999999 38.0 38.0 38.0 35.6 38.0 100-104 36.7655 38.0 38.0 38.0 35.0 38.0 105-109 36.6782 38.0 38.0 38.0 35.0 38.0 110-114 36.71405 38.0 38.0 38.0 34.6 38.0 115-119 36.57025 38.0 38.0 38.0 34.2 38.0 120-124 36.54795 38.0 38.0 38.0 34.0 38.0 125-129 36.40675 38.0 38.0 38.0 34.0 38.0 130-134 36.27915 38.0 37.6 38.0 33.6 38.0 135-139 36.150549999999996 38.0 36.6 38.0 33.2 38.0 140-144 36.084399999999995 38.0 36.2 38.0 33.0 38.0 145-149 35.7969 38.0 36.0 38.0 31.8 38.0 150-151 33.968 37.0 33.5 38.0 23.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 2.0 23 5.0 24 4.0 25 10.0 26 11.0 27 14.0 28 22.0 29 20.0 30 37.0 31 44.0 32 53.0 33 73.0 34 103.0 35 210.0 36 502.0 37 2887.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.31770045385779 12.581946545637923 8.547655068078669 38.552697932425616 2 21.675 14.649999999999999 33.375 30.3 3 20.025000000000002 20.65 25.650000000000002 33.675 4 23.825 27.325 21.525 27.325 5 23.1 32.725 23.200000000000003 20.974999999999998 6 19.85 33.375 26.450000000000003 20.325 7 14.025000000000002 27.400000000000002 40.1 18.475 8 18.35 25.624999999999996 30.8 25.224999999999998 9 17.424999999999997 24.175 34.825 23.575 10-14 20.44 29.165000000000003 26.575 23.82 15-19 20.45 28.060000000000002 27.52 23.97 20-24 20.225 28.015 27.465 24.295 25-29 20.424999999999997 28.499999999999996 27.589999999999996 23.485 30-34 20.080000000000002 27.694999999999997 28.465 23.76 35-39 19.916991699169916 28.082808280828083 28.052805280528055 23.94739473947395 40-44 20.365 28.144999999999996 28.025 23.465 45-49 20.345 28.38 27.575 23.7 50-54 20.095 28.52 27.52 23.865 55-59 19.96 28.310000000000002 27.485 24.245 60-64 19.689999999999998 28.24 27.810000000000002 24.26 65-69 20.235 28.215 27.905 23.645 70-74 19.935 27.685 27.884999999999998 24.495 75-79 20.255000000000003 27.605 27.38 24.759999999999998 80-84 20.255000000000003 28.095 27.465 24.185000000000002 85-89 20.375 28.050000000000004 27.284999999999997 24.29 90-94 21.01 27.88 27.22 23.89 95-99 20.485 28.03 27.279999999999998 24.205 100-104 20.1 28.275 27.705000000000002 23.919999999999998 105-109 20.435 27.02 27.839999999999996 24.705 110-114 20.52 27.495000000000005 27.544999999999998 24.44 115-119 20.93 27.935 27.425 23.71 120-124 20.91 27.694999999999997 27.279999999999998 24.115000000000002 125-129 20.885 27.43 27.025 24.66 130-134 21.375 27.76 26.845000000000002 24.02 135-139 20.775 27.91 26.99 24.325 140-144 20.845 27.384999999999998 27.51 24.26 145-149 21.355 28.060000000000002 26.435 24.15 150-151 20.7625 28.199999999999996 26.525 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.5 26 2.0 27 2.5 28 6.5 29 10.5 30 12.0 31 16.5 32 20.5 33 30.0 34 50.0 35 69.0 36 86.0 37 105.5 38 121.5 39 129.0 40 158.5 41 210.5 42 261.5 43 270.5 44 271.5 45 282.5 46 275.0 47 265.5 48 236.5 49 204.0 50 188.5 51 158.0 52 119.5 53 97.5 54 83.5 55 74.0 56 53.5 57 33.0 58 25.0 59 18.5 60 11.5 61 5.5 62 3.5 63 5.5 64 5.0 65 4.5 66 4.5 67 2.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.7999999999999998 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.9625 0.0 0.0 0.0 0.0 116-117 3.3125 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.449999999999999 0.0 0.0 0.0 0.0 124-125 4.824999999999999 0.0 0.0 0.0 0.0 126-127 5.1875 0.0 0.0 0.0 0.0 128-129 5.5625 0.0 0.0 0.0 0.0 130-131 6.1125 0.0 0.0 0.0 0.0 132-133 6.4625 0.0 0.0 0.0 0.0 134-135 7.012499999999999 0.0 0.0 0.0 0.0 136-137 7.5125 0.0 0.0 0.0 0.0 138-139 8.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTGT 10 0.006832588 144.9875 7 TCACCCA 10 0.006832588 144.9875 8 TCTTTTG 10 0.006832588 144.9875 6 >>END_MODULE SRR7171487 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171487_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9515 33.0 33.0 34.0 32.0 34.0 2 33.04425 34.0 33.0 34.0 32.0 34.0 3 33.05425 34.0 33.0 34.0 32.0 34.0 4 32.976 34.0 33.0 34.0 32.0 34.0 5 33.111 34.0 33.0 34.0 33.0 34.0 6 37.2095 38.0 38.0 38.0 37.0 38.0 7 37.165 38.0 38.0 38.0 37.0 38.0 8 37.24475 38.0 38.0 38.0 37.0 38.0 9 37.254 38.0 38.0 38.0 37.0 38.0 10-14 37.1896 38.0 38.0 38.0 37.0 38.0 15-19 37.13645 38.0 38.0 38.0 37.0 38.0 20-24 37.182 38.0 38.0 38.0 37.0 38.0 25-29 37.129 38.0 38.0 38.0 37.0 38.0 30-34 37.12835 38.0 38.0 38.0 37.0 38.0 35-39 37.1096 38.0 38.0 38.0 37.0 38.0 40-44 36.52865 37.8 37.4 38.0 33.8 38.0 45-49 36.99275 38.0 38.0 38.0 36.0 38.0 50-54 37.044650000000004 38.0 38.0 38.0 36.0 38.0 55-59 37.0156 38.0 38.0 38.0 36.0 38.0 60-64 36.999700000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.93755 38.0 38.0 38.0 36.0 38.0 70-74 36.93605 38.0 38.0 38.0 36.0 38.0 75-79 36.94095 38.0 38.0 38.0 36.0 38.0 80-84 36.94154999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.828649999999996 38.0 38.0 38.0 35.6 38.0 90-94 36.698750000000004 38.0 38.0 38.0 34.8 38.0 95-99 36.63975000000001 38.0 38.0 38.0 35.0 38.0 100-104 36.5895 38.0 38.0 38.0 34.8 38.0 105-109 36.4967 38.0 38.0 38.0 34.2 38.0 110-114 36.42295 38.0 38.0 38.0 34.0 38.0 115-119 36.3067 38.0 38.0 38.0 33.8 38.0 120-124 36.19664999999999 38.0 38.0 38.0 33.8 38.0 125-129 36.069399999999995 38.0 37.8 38.0 33.0 38.0 130-134 35.9665 38.0 37.0 38.0 33.0 38.0 135-139 35.76225 38.0 36.0 38.0 31.0 38.0 140-144 35.47535 38.0 36.0 38.0 30.0 38.0 145-149 35.31035 38.0 36.0 38.0 29.2 38.0 150-151 32.874125 35.5 31.0 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 2.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 5.0 18 4.0 19 4.0 20 5.0 21 6.0 22 3.0 23 3.0 24 20.0 25 18.0 26 24.0 27 26.0 28 23.0 29 29.0 30 33.0 31 45.0 32 68.0 33 73.0 34 110.0 35 210.0 36 429.0 37 2856.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.0 20.4 13.700000000000001 26.900000000000002 2 26.376376376376378 26.826826826826828 29.47947947947948 17.31731731731732 3 20.995995995995994 29.629629629629626 29.27927927927928 20.095095095095093 4 23.823823823823822 34.25925925925926 22.67267267267267 19.244244244244243 5 24.94994994994995 35.53553553553554 21.57157157157157 17.942942942942945 6 22.372372372372375 36.186186186186184 22.42242242242242 19.01901901901902 7 20.52052052052052 21.57157157157157 37.73773773773774 20.17017017017017 8 22.822822822822822 24.174174174174173 27.87787787787788 25.125125125125123 9 22.42242242242242 23.6986986986987 30.03003003003003 23.84884884884885 10-14 24.05487957538431 29.06214010314957 26.26808872865655 20.614891592809574 15-19 23.455492139781718 28.421948533093023 27.265445078602184 20.85711424852308 20-24 23.722024733390075 28.618635157462574 26.96640464627247 20.692935462874882 25-29 23.613613613613612 28.43843843843844 27.112112112112115 20.835835835835837 30-34 23.372529397047785 28.506379784838632 27.415561671253442 20.705529146860144 35-39 23.771885942971487 27.828914457228613 27.023511755877937 21.375687843921963 40-44 23.976578921028928 27.96516865178661 27.609848863977582 20.448403563206885 45-49 24.07907907907908 27.812812812812815 27.27727727727728 20.83083083083083 50-54 23.34067474221644 28.206026629292218 27.02973270597657 21.42356592251477 55-59 23.43843843843844 27.95795795795796 27.837837837837835 20.765765765765764 60-64 23.583583583583582 28.093093093093092 27.997997997998 20.325325325325323 65-69 24.75975975975976 27.93793793793794 27.067067067067068 20.235235235235237 70-74 23.797139141742523 28.11343403020906 27.588276482944885 20.50115034510353 75-79 24.12 27.689999999999998 27.905 20.285 80-84 24.169999999999998 27.72 27.345000000000002 20.765 85-89 24.31972789115646 27.791116446578634 27.561024409763906 20.328131252501 90-94 24.74974974974975 27.67267267267267 26.84184184184184 20.735735735735737 95-99 24.2965855612296 27.79112846700711 26.894963452488234 21.01732251927506 100-104 24.37888198757764 28.35604087357243 26.79823682628732 20.466840312562613 105-109 24.633107938893062 27.778612572001 27.402955171550214 20.18532431755572 110-114 24.123597756410255 27.794471153846157 27.428886217948715 20.653044871794872 115-119 25.433062981876443 27.941323720837087 26.619605487133274 20.006007810153196 120-124 24.58704575032536 28.426268895785363 27.054760236259884 19.931925117629394 125-129 25.01626382425061 27.468348095881503 26.922884451784018 20.592503628083872 130-134 24.67597457839163 28.59430515938548 26.717710053545513 20.012010208677374 135-139 24.734734734734733 27.91791791791792 27.762762762762762 19.584584584584587 140-144 25.658487731597397 27.68652979469204 26.870305458187282 19.784677015523286 145-149 25.325586054898817 28.01041875375676 27.01362452414346 19.65037066720096 150-151 25.707488104182318 26.68419734535437 27.39794640621087 20.210368144252442 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 2.0 25 1.0 26 1.0 27 1.5 28 1.5 29 1.5 30 5.5 31 10.5 32 16.0 33 25.5 34 34.5 35 40.5 36 68.0 37 99.5 38 126.5 39 160.5 40 188.5 41 221.5 42 247.5 43 279.5 44 309.0 45 303.0 46 275.5 47 274.5 48 252.5 49 206.0 50 172.5 51 142.0 52 123.0 53 94.0 54 78.0 55 67.5 56 45.5 57 28.0 58 20.5 59 15.5 60 12.5 61 12.5 62 8.0 63 6.0 64 4.5 65 1.0 66 0.5 67 2.0 68 2.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.145 15-19 0.13 20-24 0.135 25-29 0.1 30-34 0.075 35-39 0.05 40-44 0.09 45-49 0.1 50-54 0.11 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.03 75-79 0.0 80-84 0.0 85-89 0.04 90-94 0.1 95-99 0.13 100-104 0.18 105-109 0.17500000000000002 110-114 0.16 115-119 0.13 120-124 0.11 125-129 0.08499999999999999 130-134 0.08499999999999999 135-139 0.1 140-144 0.15 145-149 0.18 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.7999999999999998 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.2875 0.0 0.0 0.0 0.0 118-119 3.5875000000000004 0.0 0.0 0.0 0.0 120-121 4.05 0.0 0.0 0.0 0.0 122-123 4.449999999999999 0.0 0.0 0.0 0.0 124-125 4.824999999999999 0.0 0.0 0.0 0.0 126-127 5.1625 0.0 0.0 0.0 0.0 128-129 5.5375 0.0 0.0 0.0 0.0 130-131 6.0625 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.475 0.0 0.0 0.0 0.0 138-139 8.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGTA 10 0.006692141 145.97469 7 TCAGGAC 10 0.006692141 145.97469 7 CCTCTTT 10 0.0069519696 144.15001 3 TCACTTA 10 0.0069519696 144.15001 4 >>END_MODULE Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752467 spots for SRR7171487.sra Written 752467 spots for SRR7171487.sra Read 752475 spots for SRR7171487.sra Written 752475 spots for SRR7171487.sra SRR ids: ['SRR7171487.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3iuu4ksh SRR7171487.sra spots: 15049348 blocks: [[1, 752467], [752468, 1504934], [1504935, 2257401], [2257402, 3009868], [3009869, 3762335], [3762336, 4514802], [4514803, 5267269], [5267270, 6019736], [6019737, 6772203], [6772204, 7524670], [7524671, 8277137], [8277138, 9029604], [9029605, 9782071], [9782072, 10534538], [10534539, 11287005], [11287006, 12039472], [12039473, 12791939], [12791940, 13544406], [13544407, 14296873], [14296874, 15049348]] SRR7171487 file size 5078029 SRR7171487 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171487 SRR7171487_1.fastq SRR7171487_2.fastq Input file: SRR7171487_1.fastq Paired file: SRR7171487_2.fastq trimmed: SRR7171487-trimmed-pair1.fastq, SRR7171487-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:05:38 2025 >> started Thu Feb 13 20:05:53 2025 >> done (14.958s) 15049348 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 1297 ( 0.01%) empty read pairs filtered out after trimming by size control 15048036 (99.99%) read pairs available; of these: 2044873 (13.59%) trimmed read pairs available after processing 13003163 (86.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 1 0.00% 21 4 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 2 0.00% 28 1 0.00% 29 2 0.00% 30 2 0.00% 31 0 0.00% 32 2 0.00% 33 7 0.00% 34 5 0.00% 35 2 0.00% 36 6 0.00% 37 4 0.00% 38 8 0.00% 39 3 0.00% 40 6 0.00% 41 7 0.00% 42 6 0.00% 43 8 0.00% 44 10 0.00% 45 7 0.00% 46 9 0.00% 47 19 0.00% 48 22 0.00% 49 23 0.00% 50 25 0.00% 51 25 0.00% 52 33 0.00% 53 49 0.00% 54 56 0.00% 55 69 0.00% 56 73 0.00% 57 89 0.00% 58 84 0.00% 59 100 0.00% 60 142 0.00% 61 164 0.00% 62 181 0.00% 63 205 0.00% 64 255 0.00% 65 276 0.00% 66 336 0.00% 67 347 0.00% 68 448 0.00% 69 464 0.00% 70 603 0.00% 71 652 0.00% 72 836 0.01% 73 951 0.01% 74 1160 0.01% 75 1163 0.01% 76 1321 0.01% 77 1500 0.01% 78 1681 0.01% 79 1993 0.01% 80 2147 0.01% 81 2579 0.02% 82 2882 0.02% 83 3196 0.02% 84 3716 0.02% 85 4155 0.03% 86 4496 0.03% 87 4884 0.03% 88 5221 0.03% 89 5704 0.04% 90 6249 0.04% 91 6798 0.05% 92 7570 0.05% 93 8342 0.06% 94 9019 0.06% 95 9603 0.06% 96 10342 0.07% 97 10692 0.07% 98 11319 0.08% 99 12112 0.08% 100 12868 0.09% 101 13783 0.09% 102 14806 0.10% 103 15514 0.10% 104 16597 0.11% 105 17382 0.12% 106 18379 0.12% 107 18985 0.13% 108 19541 0.13% 109 20347 0.14% 110 21002 0.14% 111 21934 0.15% 112 23299 0.15% 113 23846 0.16% 114 25572 0.17% 115 27151 0.18% 116 28216 0.19% 117 29643 0.20% 118 31091 0.21% 119 31060 0.21% 120 30959 0.21% 121 32049 0.21% 122 32976 0.22% 123 34313 0.23% 124 36259 0.24% 125 37096 0.25% 126 38266 0.25% 127 39117 0.26% 128 39705 0.26% 129 40286 0.27% 130 41575 0.28% 131 42049 0.28% 132 43354 0.29% 133 44886 0.30% 134 46099 0.31% 135 47768 0.32% 136 48805 0.32% 137 49698 0.33% 138 50351 0.33% 139 50983 0.34% 140 51846 0.34% 141 53955 0.36% 142 55809 0.37% 143 55427 0.37% 144 60158 0.40% 145 59508 0.40% 146 58034 0.39% 147 60555 0.40% 148 60439 0.40% 149 60361 0.40% 150 64683 0.43% 151 13003163 86.41% 15048036 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=16 prefix-density=0.51 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=11.23 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.8 sequence=GTGATGGTCTTTCC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=17 prefix-density=0.46 prefix-fanout=2.8 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=13.83 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.6 sequence=GATGGAGGGCAAAGAAGAAGATGTTAG SRR7171487 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:06:39 Started mapping on | Feb 13 20:06:40 Finished on | Feb 13 20:09:01 Mapping speed, Million of reads per hour | 384.21 Number of input reads | 15048036 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13801530 Uniquely mapped reads % | 91.72% Average mapped length | 294.58 Number of splices: Total | 13550131 Number of splices: Annotated (sjdb) | 13310293 Number of splices: GT/AG | 13339509 Number of splices: GC/AG | 167756 Number of splices: AT/AC | 10165 Number of splices: Non-canonical | 32701 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386849 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 139430 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.55% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 859657 859657 859657 N_multimapping 386849 386849 386849 N_noFeature 316287 13679705 366472 N_ambiguous 142639 940 70381 UnstrandedReadsAssigned:13342604 PositiveStrandReadsAssigned:120885 NegativeStrandReadsAssigned:13364677 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171487 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171487-trimmed-pair1.fastq SRR7171487-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,048,036 reads, 13,454,305 reads pseudoaligned [quant] estimated average fragment length: 225.348 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 SRR7171487.ke.tsv 34699 SRR7171487.se.tsv 87100 total ==> SRR7171487.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.65 1601.59 59.6174 Potri.005G024800.1.v4.1 1035 810.652 312 25.6968 Potri.004G059700.1.v4.1 961 736.661 23 2.08458 Potri.007G009000.2.v4.1 1416 1191.65 0 0 Potri.003G141000.2.v4.1 2943 2718.65 481 11.8127 Potri.016G087400.1.v4.1 270 85.6466 1153.07 898.882 Potri.015G069301.1.v4.1 564 342.211 0 0 Potri.010G195200.1.v4.1 1773 1548.65 589 25.3934 Potri.012G127500.1.v4.1 977 752.652 7335 650.676 ==> SRR7171487.se.tsv <== Potri.001G166300.v4.1 4 Potri.001G448400.v4.1 28 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 364 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 312 SRR7171487 completed mapping pipeline successfully