Starting /dee2/code/volunteer_pipeline.sh SRR7171488 current disk space = 3114047725568 free memory = 1571109908 SRR7171488 SRAfilesize da7c3f380aa031a132dd691901890ecb SRR7171488.sra SRR7171488.sra file validated SRR7171488 is paired end SRR7171488 is conventional basespace SRR7171488 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171488_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8485 34.0 33.0 34.0 32.0 34.0 2 33.162 34.0 33.0 34.0 32.0 34.0 3 32.805 33.0 33.0 34.0 31.0 34.0 4 33.04025 33.0 33.0 34.0 32.0 34.0 5 32.94525 33.0 33.0 34.0 32.0 34.0 6 36.77425 38.0 37.0 38.0 35.0 38.0 7 37.34 38.0 38.0 38.0 36.0 38.0 8 37.422 38.0 38.0 38.0 37.0 38.0 9 37.56375 38.0 38.0 38.0 37.0 38.0 10-14 37.53914999999999 38.0 38.0 38.0 37.6 38.0 15-19 37.45365 38.0 38.0 38.0 37.0 38.0 20-24 37.403 38.0 38.0 38.0 37.0 38.0 25-29 37.4394 38.0 38.0 38.0 37.4 38.0 30-34 37.45575 38.0 38.0 38.0 37.2 38.0 35-39 36.25005 38.0 37.6 38.0 31.6 38.0 40-44 36.99405 38.0 38.0 38.0 34.2 38.0 45-49 37.32575 38.0 38.0 38.0 37.0 38.0 50-54 37.2512 38.0 38.0 38.0 36.8 38.0 55-59 37.26565000000001 38.0 38.0 38.0 36.8 38.0 60-64 37.2612 38.0 38.0 38.0 36.6 38.0 65-69 37.231199999999994 38.0 38.0 38.0 36.6 38.0 70-74 34.5406 33.6 33.6 38.0 31.8 38.0 75-79 35.27055 36.2 35.0 38.0 31.8 38.0 80-84 37.0698 38.0 38.0 38.0 36.0 38.0 85-89 37.071200000000005 38.0 38.0 38.0 36.0 38.0 90-94 37.07735 38.0 38.0 38.0 36.0 38.0 95-99 36.9851 38.0 38.0 38.0 35.8 38.0 100-104 36.934200000000004 38.0 38.0 38.0 35.6 38.0 105-109 36.7988 38.0 38.0 38.0 35.0 38.0 110-114 36.639199999999995 38.0 38.0 38.0 34.4 38.0 115-119 36.517849999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.370149999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.1896 38.0 37.6 38.0 33.6 38.0 130-134 36.0751 38.0 37.0 38.0 33.0 38.0 135-139 36.03680000000001 38.0 36.6 38.0 33.0 38.0 140-144 35.9774 38.0 36.0 38.0 33.0 38.0 145-149 35.7556 38.0 36.0 38.0 31.4 38.0 150-151 33.42675 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 2.0 23 3.0 24 4.0 25 15.0 26 7.0 27 17.0 28 24.0 29 26.0 30 37.0 31 45.0 32 65.0 33 86.0 34 124.0 35 239.0 36 730.0 37 2574.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.49256365011344 10.385681875472649 9.780690698260651 41.34106377615326 2 22.45 14.725 34.525 28.299999999999997 3 20.525 18.875 25.624999999999996 34.975 4 22.675 28.449999999999996 22.025 26.85 5 23.150000000000002 30.85 24.474999999999998 21.525 6 18.224999999999998 35.75 25.4 20.625 7 14.625 26.474999999999998 40.525 18.375 8 17.5 26.424999999999997 31.45 24.625 9 17.299999999999997 24.224999999999998 35.9 22.575 10-14 19.3 30.014999999999997 27.389999999999997 23.294999999999998 15-19 19.64 28.415000000000003 27.639999999999997 24.305 20-24 19.63 28.73 27.825 23.815 25-29 19.831983198319833 29.312931293129314 27.447744774477446 23.407340734073408 30-34 18.996648827089484 28.369929475316365 28.46996448757065 24.16345721002351 35-39 19.604703527645732 29.106830122591944 27.695771828871653 23.592694520890667 40-44 19.878975795159032 28.975795159031808 27.645529105821165 23.499699939987998 45-49 20.048019207683073 28.06622649059624 27.85614245698279 24.029611844737893 50-54 20.1020102010201 28.562856285628563 27.53775377537754 23.7973797379738 55-59 20.145 28.64 27.665 23.549999999999997 60-64 20.375 27.735 27.810000000000002 24.08 65-69 19.165 28.985 27.83 24.02 70-74 20.599999999999998 28.854999999999997 26.41 24.135 75-79 20.31 28.255000000000003 27.665 23.77 80-84 20.13 28.77 27.644999999999996 23.455000000000002 85-89 20.200000000000003 28.84 27.49 23.47 90-94 19.845 27.894999999999996 27.875 24.385 95-99 20.14 28.77 27.389999999999997 23.7 100-104 19.814999999999998 28.42 27.950000000000003 23.815 105-109 20.025000000000002 27.88 28.005000000000003 24.09 110-114 20.135 28.52 27.36 23.985 115-119 20.73 27.965 28.095 23.21 120-124 20.3 27.794999999999998 28.175 23.73 125-129 20.76 27.365000000000002 28.16 23.715 130-134 20.669999999999998 28.050000000000004 27.865000000000002 23.415 135-139 20.805 28.23 27.43 23.535 140-144 21.255 28.15 27.12 23.474999999999998 145-149 21.795 27.61 27.35 23.244999999999997 150-151 21.55 27.212500000000002 27.8375 23.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 0.5 26 4.0 27 7.5 28 11.5 29 16.0 30 15.5 31 22.5 32 30.5 33 34.0 34 47.0 35 69.5 36 102.5 37 106.5 38 127.0 39 160.0 40 177.0 41 221.0 42 264.0 43 287.0 44 282.0 45 265.5 46 251.5 47 240.5 48 239.0 49 215.0 50 176.5 51 147.5 52 116.5 53 94.0 54 67.5 55 50.5 56 43.0 57 28.0 58 16.0 59 16.5 60 12.5 61 4.5 62 6.0 63 6.0 64 4.0 65 3.0 66 3.0 67 1.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.034999999999999996 35-39 0.075 40-44 0.02 45-49 0.04 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.7374999999999998 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.9625 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.575 0.0 0.0 0.0 0.0 136-137 4.9125 0.0 0.0 0.0 0.0 138-139 5.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCAAT 10 0.006832588 144.9875 6 CTCATTG 10 0.006832588 144.9875 3 >>END_MODULE SRR7171488 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171488_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87875 33.0 33.0 34.0 32.0 34.0 2 32.8645 34.0 33.0 34.0 32.0 34.0 3 32.9125 34.0 33.0 34.0 32.0 34.0 4 32.9005 34.0 33.0 34.0 32.0 34.0 5 32.941 34.0 33.0 34.0 32.0 34.0 6 37.06175 38.0 38.0 38.0 37.0 38.0 7 37.03875 38.0 38.0 38.0 36.0 38.0 8 37.006 38.0 38.0 38.0 36.0 38.0 9 37.06775 38.0 38.0 38.0 37.0 38.0 10-14 37.0321 38.0 38.0 38.0 36.6 38.0 15-19 36.96845 38.0 38.0 38.0 36.0 38.0 20-24 36.9006 38.0 38.0 38.0 36.0 38.0 25-29 36.9446 38.0 38.0 38.0 36.0 38.0 30-34 36.97805 38.0 38.0 38.0 36.0 38.0 35-39 36.8732 38.0 38.0 38.0 35.8 38.0 40-44 36.6898 38.0 38.0 38.0 35.0 38.0 45-49 36.7946 38.0 38.0 38.0 35.6 38.0 50-54 36.852999999999994 38.0 38.0 38.0 35.8 38.0 55-59 36.806599999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.7512 38.0 38.0 38.0 35.6 38.0 65-69 36.764900000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.742000000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.68315 38.0 38.0 38.0 34.8 38.0 80-84 36.62714999999999 38.0 38.0 38.0 34.4 38.0 85-89 36.58845000000001 38.0 38.0 38.0 34.2 38.0 90-94 36.42415 38.0 38.0 38.0 34.0 38.0 95-99 36.3981 38.0 38.0 38.0 34.0 38.0 100-104 36.3337 38.0 38.0 38.0 34.0 38.0 105-109 36.2599 38.0 38.0 38.0 33.8 38.0 110-114 36.1691 38.0 38.0 38.0 33.4 38.0 115-119 36.07405 38.0 38.0 38.0 33.4 38.0 120-124 35.85235 38.0 37.0 38.0 32.2 38.0 125-129 35.7208 38.0 37.0 38.0 31.0 38.0 130-134 35.696850000000005 38.0 36.4 38.0 31.0 38.0 135-139 35.4296 38.0 36.0 38.0 29.4 38.0 140-144 35.2804 38.0 35.8 38.0 28.4 38.0 145-149 34.917199999999994 38.0 34.8 38.0 27.0 38.0 150-151 32.271875 35.5 28.5 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 1.0 5 0.0 6 1.0 7 1.0 8 1.0 9 3.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 2.0 18 2.0 19 1.0 20 10.0 21 8.0 22 9.0 23 12.0 24 17.0 25 25.0 26 20.0 27 31.0 28 30.0 29 39.0 30 46.0 31 57.0 32 83.0 33 65.0 34 124.0 35 225.0 36 437.0 37 2744.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.211211211211214 19.71971971971972 14.93993993993994 29.129129129129126 2 27.58707090954648 26.359308443998998 28.96517163618141 17.088449010273116 3 20.19038076152305 30.38577154308617 29.63426853707415 19.789579158316634 4 23.640010027575833 34.394585109049885 23.163700175482578 18.8017046878917 5 24.79318124843319 36.45023815492605 22.06066683379293 16.69591376284783 6 21.58976930792377 37.512537612838514 23.294884653961887 17.60280842527583 7 20.787362086258774 20.762286860581742 38.18956870611835 20.260782347041122 8 21.93532213587365 25.169215342191027 27.550764602657306 25.344697919278016 9 21.369450714823177 25.608226736894906 30.825181840983195 22.197140707298722 10-14 23.571607725106595 29.0694757963381 26.084775520441433 21.274140958113872 15-19 23.230499122146977 28.17155756207675 27.705041384499623 20.89290193127665 20-24 23.116661651118466 29.220583809810414 26.97863376467048 20.68412077440064 25-29 23.476909191194906 28.00481371909943 27.312841598555888 21.205435491149778 30-34 22.97480086168028 28.435449125795305 27.44852462301488 21.141225389509543 35-39 23.317981577893473 28.524229074889867 27.077492991589907 21.08029635562675 40-44 23.22027954511297 28.380341666249187 27.573768849256048 20.825609939381795 45-49 23.42057761732852 27.93822703569996 27.702567188126753 20.938628158844764 50-54 23.169508525576727 28.079237713139417 27.768304914744235 20.98294884653962 55-59 23.60435371419973 28.359331895470735 27.265887545769175 20.770426844560365 60-64 23.691998996739404 27.62478053674442 28.146476047153246 20.53674441936293 65-69 23.840328970462863 28.428865152198984 27.125018805476152 20.605787071861993 70-74 23.2860934448395 27.873203465371326 27.888226751464774 20.952476338324402 75-79 23.654192515509305 27.871723033820295 28.01180708425055 20.46227736641985 80-84 23.58089522380595 28.257064266066518 27.79194798699675 20.370092523130783 85-89 23.46463786976325 28.424846088392812 27.588968416837677 20.521547625006257 90-94 24.043715846994534 28.14458314533514 28.179676141775705 19.63202486589462 95-99 24.174942321195704 28.232520814525024 27.52532851840706 20.067208345872203 100-104 24.10817319753148 28.508353820681346 27.37945913401234 20.004013847774825 105-109 23.57397280890985 28.400140470576428 27.642602719109018 20.383284001404707 110-114 23.99277507400532 27.981536300235817 27.78586122121319 20.239827404545682 115-119 23.74836961974516 28.08768937493729 27.49573592856426 20.668205076753285 120-124 24.37189709643448 28.027681660899656 27.300536582919616 20.29988465974625 125-129 24.329876246304924 27.967333032717068 27.666716769377224 20.036073951600784 130-134 23.925243010321676 27.913618599058022 28.389618198216255 19.77152019240405 135-139 25.41998896745399 27.195225916453538 27.435936011233135 19.948849104859335 140-144 25.247102503637546 28.016657468265514 27.11354171893031 19.622698309166626 145-149 25.788971953238672 27.780843911494657 27.5450303547238 18.885153780542872 150-151 25.79957356076759 28.082277687194278 26.47685940047661 19.641289351561518 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 0.5 26 1.5 27 2.0 28 4.0 29 6.5 30 11.0 31 14.5 32 17.0 33 24.5 34 38.5 35 53.5 36 78.0 37 117.5 38 149.0 39 164.5 40 196.0 41 246.0 42 265.0 43 275.0 44 282.0 45 296.0 46 286.0 47 260.0 48 247.0 49 197.0 50 155.5 51 139.0 52 115.5 53 89.5 54 72.5 55 51.0 56 30.0 57 21.5 58 20.0 59 15.0 60 10.5 61 9.0 62 8.0 63 7.0 64 3.5 65 1.5 66 0.0 67 0.0 68 1.0 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.22499999999999998 3 0.2 4 0.27499999999999997 5 0.27499999999999997 6 0.3 7 0.3 8 0.27499999999999997 9 0.325 10-14 0.325 15-19 0.325 20-24 0.31 25-29 0.28500000000000003 30-34 0.19499999999999998 35-39 0.12 40-44 0.19499999999999998 45-49 0.27999999999999997 50-54 0.3 55-59 0.315 60-64 0.325 65-69 0.295 70-74 0.155 75-79 0.06 80-84 0.025 85-89 0.105 90-94 0.265 95-99 0.31 100-104 0.345 105-109 0.335 110-114 0.345 115-119 0.33 120-124 0.295 125-129 0.20500000000000002 130-134 0.21 135-139 0.295 140-144 0.345 145-149 0.345 150-151 0.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77420973406925 99.425 2 0.1254390366281987 0.25 3 0.07526342197691922 0.22499999999999998 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.025 0.0 110-111 1.0625 0.0 0.0 0.025 0.0 112-113 1.275 0.0 0.0 0.025 0.0 114-115 1.5 0.0 0.0 0.025 0.0 116-117 1.7875 0.0 0.0 0.025 0.0 118-119 1.9375 0.0 0.0 0.025 0.0 120-121 2.1500000000000004 0.0 0.0 0.025 0.0 122-123 2.3499999999999996 0.0 0.0 0.025 0.0 124-125 2.6125 0.0 0.0 0.025 0.0 126-127 3.0125 0.0 0.0 0.025 0.0 128-129 3.3625 0.0 0.0 0.025 0.0 130-131 3.7249999999999996 0.0 0.0 0.025 0.0 132-133 4.175 0.0 0.0 0.025 0.0 134-135 4.5625 0.0 0.0 0.025 0.0 136-137 4.9 0.0 0.0 0.025 0.0 138-139 5.475 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAGAC 10 0.0068062083 145.15189 8 >>END_MODULE Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791209 spots for SRR7171488.sra Written 791209 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra Read 791202 spots for SRR7171488.sra Written 791202 spots for SRR7171488.sra SRR ids: ['SRR7171488.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ccs5h95f SRR7171488.sra spots: 15824047 blocks: [[1, 791202], [791203, 1582404], [1582405, 2373606], [2373607, 3164808], [3164809, 3956010], [3956011, 4747212], [4747213, 5538414], [5538415, 6329616], [6329617, 7120818], [7120819, 7912020], [7912021, 8703222], [8703223, 9494424], [9494425, 10285626], [10285627, 11076828], [11076829, 11868030], [11868031, 12659232], [12659233, 13450434], [13450435, 14241636], [14241637, 15032838], [15032839, 15824047]] SRR7171488 file size 5340549 SRR7171488 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171488 SRR7171488_1.fastq SRR7171488_2.fastq Input file: SRR7171488_1.fastq Paired file: SRR7171488_2.fastq trimmed: SRR7171488-trimmed-pair1.fastq, SRR7171488-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:36:35 2025 >> started Fri Feb 14 11:36:52 2025 >> done (16.461s) 15824047 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 895 ( 0.01%) empty read pairs filtered out after trimming by size control 15823130 (99.99%) read pairs available; of these: 1560883 ( 9.86%) trimmed read pairs available after processing 14262247 (90.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 2 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 2 0.00% 31 4 0.00% 32 1 0.00% 33 2 0.00% 34 2 0.00% 35 1 0.00% 36 2 0.00% 37 5 0.00% 38 4 0.00% 39 2 0.00% 40 6 0.00% 41 8 0.00% 42 6 0.00% 43 5 0.00% 44 9 0.00% 45 3 0.00% 46 6 0.00% 47 7 0.00% 48 11 0.00% 49 7 0.00% 50 15 0.00% 51 17 0.00% 52 18 0.00% 53 18 0.00% 54 24 0.00% 55 28 0.00% 56 30 0.00% 57 33 0.00% 58 42 0.00% 59 42 0.00% 60 46 0.00% 61 64 0.00% 62 82 0.00% 63 120 0.00% 64 133 0.00% 65 108 0.00% 66 124 0.00% 67 192 0.00% 68 182 0.00% 69 262 0.00% 70 251 0.00% 71 298 0.00% 72 382 0.00% 73 414 0.00% 74 504 0.00% 75 549 0.00% 76 663 0.00% 77 738 0.00% 78 863 0.01% 79 902 0.01% 80 1101 0.01% 81 1230 0.01% 82 1443 0.01% 83 1630 0.01% 84 1908 0.01% 85 2106 0.01% 86 2263 0.01% 87 2473 0.02% 88 2756 0.02% 89 3103 0.02% 90 3429 0.02% 91 3652 0.02% 92 4155 0.03% 93 4538 0.03% 94 5021 0.03% 95 5602 0.04% 96 5858 0.04% 97 6328 0.04% 98 6546 0.04% 99 7335 0.05% 100 7695 0.05% 101 8308 0.05% 102 9029 0.06% 103 9719 0.06% 104 10376 0.07% 105 11163 0.07% 106 12008 0.08% 107 12449 0.08% 108 12731 0.08% 109 13397 0.08% 110 13813 0.09% 111 14814 0.09% 112 15403 0.10% 113 16444 0.10% 114 17669 0.11% 115 18676 0.12% 116 20015 0.13% 117 23588 0.15% 118 24900 0.16% 119 22868 0.14% 120 22144 0.14% 121 22800 0.14% 122 23552 0.15% 123 24910 0.16% 124 26614 0.17% 125 27143 0.17% 126 28132 0.18% 127 29311 0.19% 128 29903 0.19% 129 30715 0.19% 130 30945 0.20% 131 32175 0.20% 132 33491 0.21% 133 34801 0.22% 134 35970 0.23% 135 37396 0.24% 136 38987 0.25% 137 39929 0.25% 138 40785 0.26% 139 41219 0.26% 140 42698 0.27% 141 48073 0.30% 142 47614 0.30% 143 49661 0.31% 144 49572 0.31% 145 52118 0.33% 146 49528 0.31% 147 51080 0.32% 148 53845 0.34% 149 52455 0.33% 150 58531 0.37% 151 14262247 90.14% 15823130 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=3.5 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=22.63 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=4.1 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=29 prefix-density=0.41 prefix-fanout=2.1 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=31.32 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=9.9 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7171488 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:37:38 Started mapping on | Feb 14 11:37:38 Finished on | Feb 14 11:39:33 Mapping speed, Million of reads per hour | 495.33 Number of input reads | 15823130 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14835248 Uniquely mapped reads % | 93.76% Average mapped length | 296.60 Number of splices: Total | 14452313 Number of splices: Annotated (sjdb) | 14167090 Number of splices: GT/AG | 14222276 Number of splices: GC/AG | 181542 Number of splices: AT/AC | 11221 Number of splices: Non-canonical | 37274 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 400664 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 39486 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.38% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 587218 587218 587218 N_multimapping 400664 400664 400664 N_noFeature 408383 14700743 457506 N_ambiguous 159955 788 74292 UnstrandedReadsAssigned:14266910 PositiveStrandReadsAssigned:133717 NegativeStrandReadsAssigned:14303450 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171488 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171488-trimmed-pair1.fastq SRR7171488-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,823,130 reads, 14,287,867 reads pseudoaligned [quant] estimated average fragment length: 234.698 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR7171488.ke.tsv 34699 SRR7171488.se.tsv 87100 total ==> SRR7171488.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.3 1245 46.8304 Potri.005G024800.1.v4.1 1035 801.302 201 16.8355 Potri.004G059700.1.v4.1 961 727.312 67 6.18274 Potri.007G009000.2.v4.1 1416 1182.3 0 0 Potri.003G141000.2.v4.1 2943 2709.3 555 13.7487 Potri.016G087400.1.v4.1 270 78.8355 1024.8 872.459 Potri.015G069301.1.v4.1 564 333.3 0 0 Potri.010G195200.1.v4.1 1773 1539.3 349 15.217 Potri.012G127500.1.v4.1 977 743.302 4686 423.12 ==> SRR7171488.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 57 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 497 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 243 SRR7171488 completed mapping pipeline successfully