Starting /dee2/code/volunteer_pipeline.sh SRR7171489 current disk space = 3114805489664 free memory = 1332813552 SRR7171489 SRAfilesize 1b4d624c4eade7cc7829065c18d0dc65 SRR7171489.sra SRR7171489.sra file validated SRR7171489 is paired end SRR7171489 is conventional basespace SRR7171489 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171489_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91875 34.0 33.0 34.0 32.0 34.0 2 33.1715 34.0 33.0 34.0 33.0 34.0 3 32.8135 33.0 33.0 34.0 32.0 34.0 4 32.75725 33.0 33.0 34.0 32.0 34.0 5 33.096 34.0 33.0 34.0 32.0 34.0 6 36.77525 38.0 37.0 38.0 34.0 38.0 7 37.24525 38.0 38.0 38.0 36.0 38.0 8 37.4395 38.0 38.0 38.0 37.0 38.0 9 37.49925 38.0 38.0 38.0 37.0 38.0 10-14 37.494 38.0 38.0 38.0 37.8 38.0 15-19 37.39975 38.0 38.0 38.0 37.2 38.0 20-24 37.55039999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.54365 38.0 38.0 38.0 38.0 38.0 30-34 37.57085 38.0 38.0 38.0 38.0 38.0 35-39 37.50075 38.0 38.0 38.0 38.0 38.0 40-44 37.4286 38.0 38.0 38.0 37.6 38.0 45-49 37.3322 38.0 38.0 38.0 37.0 38.0 50-54 37.173 38.0 38.0 38.0 36.8 38.0 55-59 37.22945 38.0 38.0 38.0 36.6 38.0 60-64 37.30095000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.26985 38.0 38.0 38.0 36.8 38.0 70-74 37.252300000000005 38.0 38.0 38.0 36.8 38.0 75-79 37.1902 38.0 38.0 38.0 36.2 38.0 80-84 37.200649999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.97515 38.0 38.0 38.0 35.6 38.0 90-94 36.9021 38.0 38.0 38.0 35.8 38.0 95-99 36.87985 38.0 38.0 38.0 35.2 38.0 100-104 36.84495 38.0 38.0 38.0 35.0 38.0 105-109 36.647149999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.50365 38.0 38.0 38.0 34.0 38.0 115-119 36.351 38.0 38.0 38.0 34.0 38.0 120-124 36.3648 38.0 37.8 38.0 34.0 38.0 125-129 36.26055 38.0 37.8 38.0 33.6 38.0 130-134 36.04375 38.0 37.0 38.0 33.0 38.0 135-139 35.86295 38.0 36.2 38.0 31.8 38.0 140-144 35.431400000000004 38.0 36.0 38.0 29.6 38.0 145-149 35.219 38.0 35.8 38.0 29.6 38.0 150-151 32.547375 35.5 30.0 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 3.0 24 7.0 25 10.0 26 10.0 27 18.0 28 12.0 29 25.0 30 29.0 31 43.0 32 71.0 33 85.0 34 145.0 35 200.0 36 533.0 37 2803.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.85800604229607 11.555891238670695 10.548841893252769 41.037260825780464 2 21.525 14.000000000000002 33.85 30.625000000000004 3 20.575 18.575 24.3 36.55 4 23.849999999999998 26.474999999999998 21.85 27.825 5 22.125 32.625 22.900000000000002 22.35 6 18.85 35.925000000000004 25.374999999999996 19.85 7 13.575000000000001 27.35 41.775 17.299999999999997 8 17.849999999999998 25.55 32.25 24.349999999999998 9 18.425 23.425 34.35 23.799999999999997 10-14 19.5 29.9 27.525 23.075000000000003 15-19 19.185 27.755000000000003 28.68 24.38 20-24 19.405 29.415000000000003 27.975 23.205000000000002 25-29 19.415 28.115000000000002 28.470000000000002 24.0 30-34 19.92599629981499 28.86644332216611 27.471373568678437 23.736186809340467 35-39 19.755926778033412 28.83865159547864 27.72331699509853 23.682104631389418 40-44 19.17883576715343 28.900780156031207 28.005601120224043 23.914782956591317 45-49 19.611961196119612 28.557855785578557 27.672767276727672 24.157415741574155 50-54 19.39 28.83 27.775 24.005000000000003 55-59 19.165 29.035 27.994999999999997 23.805 60-64 20.41 27.925 27.99 23.674999999999997 65-69 19.74 28.58 27.975 23.705000000000002 70-74 19.575 28.599999999999998 27.839999999999996 23.985 75-79 19.98 28.13 27.93 23.96 80-84 19.645000000000003 28.54 28.29 23.525 85-89 20.015 28.675 27.52 23.79 90-94 19.935 28.505000000000003 27.255000000000003 24.305 95-99 20.435 27.87 27.779999999999998 23.915 100-104 20.64 27.634999999999998 28.23 23.494999999999997 105-109 20.22 27.794999999999998 28.000000000000004 23.985 110-114 20.29 28.549999999999997 27.485 23.674999999999997 115-119 20.565 27.834999999999997 27.700000000000003 23.9 120-124 20.24 28.24 27.595 23.925 125-129 20.335 28.645 27.175 23.845 130-134 20.31 27.755000000000003 27.700000000000003 24.235 135-139 20.29 28.139999999999997 27.810000000000002 23.76 140-144 20.64 27.62 27.445000000000004 24.295 145-149 20.74 27.925 27.450000000000003 23.885 150-151 20.0125 28.299999999999997 26.650000000000002 25.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 2.0 23 1.5 24 1.5 25 1.5 26 2.5 27 5.0 28 9.5 29 13.0 30 21.0 31 29.0 32 33.5 33 45.0 34 51.5 35 65.5 36 90.5 37 112.5 38 139.0 39 168.5 40 189.5 41 214.5 42 245.0 43 258.0 44 268.0 45 278.0 46 279.0 47 271.5 48 246.0 49 206.0 50 165.0 51 129.0 52 111.0 53 88.0 54 60.5 55 48.0 56 35.5 57 26.0 58 19.5 59 13.0 60 8.5 61 9.5 62 11.5 63 8.0 64 5.0 65 3.0 66 0.5 67 0.5 68 1.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.03 40-44 0.02 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.5 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.1625 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 6.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAATCC 10 0.006830828 145.0 3 GCACTGT 10 0.006830828 145.0 1 >>END_MODULE SRR7171489 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171489_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08125 34.0 33.0 34.0 32.0 34.0 2 33.1755 34.0 33.0 34.0 33.0 34.0 3 33.1665 34.0 33.0 34.0 33.0 34.0 4 33.16725 34.0 33.0 34.0 33.0 34.0 5 33.14275 34.0 33.0 34.0 33.0 34.0 6 37.352 38.0 38.0 38.0 38.0 38.0 7 37.36075 38.0 38.0 38.0 37.0 38.0 8 37.303 38.0 38.0 38.0 37.0 38.0 9 37.264 38.0 38.0 38.0 37.0 38.0 10-14 37.2245 38.0 38.0 38.0 37.0 38.0 15-19 37.27975 38.0 38.0 38.0 37.0 38.0 20-24 37.28995 38.0 38.0 38.0 37.0 38.0 25-29 37.278200000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.297000000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.25285 38.0 38.0 38.0 37.0 38.0 40-44 37.18835 38.0 38.0 38.0 37.0 38.0 45-49 37.13725 38.0 38.0 38.0 37.0 38.0 50-54 37.099000000000004 38.0 38.0 38.0 36.6 38.0 55-59 37.08669999999999 38.0 38.0 38.0 36.6 38.0 60-64 37.086 38.0 38.0 38.0 36.4 38.0 65-69 37.119299999999996 38.0 38.0 38.0 36.8 38.0 70-74 37.00145 38.0 38.0 38.0 36.0 38.0 75-79 37.04015 38.0 38.0 38.0 36.0 38.0 80-84 37.05355 38.0 38.0 38.0 36.0 38.0 85-89 36.93915 38.0 38.0 38.0 36.0 38.0 90-94 36.78685 38.0 38.0 38.0 35.8 38.0 95-99 36.7045 38.0 38.0 38.0 35.0 38.0 100-104 36.613 38.0 38.0 38.0 34.8 38.0 105-109 36.54445 38.0 38.0 38.0 34.6 38.0 110-114 36.37505 38.0 38.0 38.0 34.0 38.0 115-119 36.23915 38.0 38.0 38.0 33.6 38.0 120-124 36.16844999999999 38.0 38.0 38.0 33.4 38.0 125-129 36.0102 38.0 37.4 38.0 33.0 38.0 130-134 35.923199999999994 38.0 37.2 38.0 32.6 38.0 135-139 35.50195 38.0 36.2 38.0 31.0 38.0 140-144 35.21745 38.0 36.0 38.0 28.6 38.0 145-149 34.89265 38.0 34.8 38.0 28.0 38.0 150-151 32.274249999999995 35.5 29.5 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 7.0 18 2.0 19 3.0 20 4.0 21 5.0 22 5.0 23 8.0 24 11.0 25 18.0 26 13.0 27 16.0 28 20.0 29 32.0 30 32.0 31 58.0 32 57.0 33 76.0 34 114.0 35 198.0 36 469.0 37 2844.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.65 19.425 16.075 27.85 2 26.126126126126124 25.125125125125123 32.65765765765766 16.09109109109109 3 20.62062062062062 28.453453453453452 30.055055055055057 20.87087087087087 4 23.617713284963724 33.62521891418564 24.718538904178132 18.038528896672503 5 25.2002002002002 36.186186186186184 20.72072072072072 17.892892892892892 6 21.296296296296298 38.11311311311311 24.1991991991992 16.39139139139139 7 19.66966966966967 22.047047047047048 38.86386386386386 19.41941941941942 8 21.52152152152152 25.3003003003003 28.72872872872873 24.44944944944945 9 23.623623623623622 24.474474474474476 29.77977977977978 22.12212212212212 10-14 23.833833833833832 29.284284284284283 26.546546546546544 20.335335335335337 15-19 23.59595555110622 28.37621383521874 27.60036039643608 20.427470217238962 20-24 23.183183183183186 28.638638638638636 27.85785785785786 20.32032032032032 25-29 23.187027676292477 28.587157799909914 27.77138281367299 20.454431710124616 30-34 23.123874324594755 28.552131278767263 28.121873123874323 20.20212127276366 35-39 23.589153492095257 28.812287372423455 27.28637182309386 20.312187312387433 40-44 23.51734147440068 28.427005655372607 27.88649216755918 20.169160702667536 45-49 23.73873873873874 27.47747747747748 28.563563563563566 20.22022022022022 50-54 23.54678816402143 28.833925799829768 27.472087317879136 20.147198718269664 55-59 23.825973765895665 27.410633823971164 28.10153199158907 20.661860418544105 60-64 24.148978774529436 28.213856627953543 27.17761313576292 20.459551461754106 65-69 23.873873873873876 28.573573573573576 27.55255255255255 20.0 70-74 23.71515788420157 28.048841515287993 27.913726667667515 20.322273932842915 75-79 23.490872718179546 27.616904226056516 28.57214303575894 20.320080020005 80-84 23.407340734073408 28.06280628062806 27.752775277527753 20.77707770777078 85-89 24.662263584509155 27.644351045732012 27.679375562894027 20.014009806864806 90-94 24.13913913913914 28.313313313313316 27.602602602602605 19.944944944944947 95-99 24.113581730769234 28.31530448717949 27.453926282051285 20.1171875 100-104 23.773490353294914 27.712352793786017 28.198446504635427 20.315710348283638 105-109 23.94888499123027 28.00801804059133 27.84765722876472 20.195439739413683 110-114 24.541445324245764 27.969329457752835 27.36293474992483 20.126290468076576 115-119 24.142077050247984 28.40539051149742 27.483593006362405 19.968939431892192 120-124 23.87461819638476 27.61003455009764 28.3661308897902 20.149216363727405 125-129 24.345562840983032 28.199609590069574 27.939336303118274 19.51549126582912 130-134 24.7997997997998 28.223223223223222 27.44744744744745 19.52952952952953 135-139 24.629481273783295 28.009212898057278 27.41838574003605 19.942920088123373 140-144 25.112736747169055 28.214249924842168 27.202124461368875 19.4708888666199 145-149 24.764434643143545 27.360665597433844 27.435846030473137 20.43905372894948 150-151 26.36591478696742 27.39348370927318 27.017543859649123 19.223057644110277 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 2.5 27 3.5 28 6.0 29 6.0 30 10.0 31 20.5 32 27.5 33 38.5 34 47.5 35 50.5 36 77.5 37 114.5 38 147.5 39 181.5 40 210.5 41 248.0 42 260.0 43 264.5 44 289.5 45 285.0 46 267.0 47 252.5 48 220.0 49 191.0 50 168.0 51 146.0 52 120.5 53 90.0 54 70.0 55 52.5 56 31.5 57 18.0 58 16.5 59 18.5 60 16.0 61 7.5 62 3.5 63 2.0 64 1.0 65 1.5 66 2.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.075 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.1 15-19 0.11 20-24 0.1 25-29 0.095 30-34 0.06 35-39 0.06 40-44 0.095 45-49 0.1 50-54 0.135 55-59 0.13 60-64 0.12 65-69 0.1 70-74 0.08499999999999999 75-79 0.025 80-84 0.01 85-89 0.06999999999999999 90-94 0.1 95-99 0.16 100-104 0.22499999999999998 105-109 0.22499999999999998 110-114 0.22999999999999998 115-119 0.19499999999999998 120-124 0.145 125-129 0.105 130-134 0.1 135-139 0.13999999999999999 140-144 0.21 145-149 0.24 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 2.9625 0.0 0.0 0.0 0.0 122-123 3.0999999999999996 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.0625 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.825 0.0 0.0 0.0 0.0 134-135 5.2125 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 6.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 801003 spots for SRR7171489.sra Written 801003 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra Read 800999 spots for SRR7171489.sra Written 800999 spots for SRR7171489.sra SRR ids: ['SRR7171489.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z_bkm2lb SRR7171489.sra spots: 16019984 blocks: [[1, 800999], [801000, 1601998], [1601999, 2402997], [2402998, 3203996], [3203997, 4004995], [4004996, 4805994], [4805995, 5606993], [5606994, 6407992], [6407993, 7208991], [7208992, 8009990], [8009991, 8810989], [8810990, 9611988], [9611989, 10412987], [10412988, 11213986], [11213987, 12014985], [12014986, 12815984], [12815985, 13616983], [13616984, 14417982], [14417983, 15218981], [15218982, 16019984]] SRR7171489 file size 5406946 SRR7171489 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171489 SRR7171489_1.fastq SRR7171489_2.fastq Input file: SRR7171489_1.fastq Paired file: SRR7171489_2.fastq trimmed: SRR7171489-trimmed-pair1.fastq, SRR7171489-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:01:50 2025 >> started Fri Feb 14 11:02:12 2025 >> done (21.229s) 16019984 read pairs processed; of these: 96 ( 0.00%) short read pairs filtered out after trimming by size control 676 ( 0.00%) empty read pairs filtered out after trimming by size control 16019212 (100.00%) read pairs available; of these: 1606551 (10.03%) trimmed read pairs available after processing 14412661 (89.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 3 0.00% 32 3 0.00% 33 3 0.00% 34 6 0.00% 35 1 0.00% 36 2 0.00% 37 2 0.00% 38 0 0.00% 39 2 0.00% 40 1 0.00% 41 6 0.00% 42 5 0.00% 43 10 0.00% 44 7 0.00% 45 15 0.00% 46 6 0.00% 47 7 0.00% 48 12 0.00% 49 12 0.00% 50 7 0.00% 51 12 0.00% 52 21 0.00% 53 17 0.00% 54 20 0.00% 55 23 0.00% 56 19 0.00% 57 36 0.00% 58 27 0.00% 59 45 0.00% 60 56 0.00% 61 62 0.00% 62 81 0.00% 63 87 0.00% 64 97 0.00% 65 98 0.00% 66 141 0.00% 67 145 0.00% 68 173 0.00% 69 190 0.00% 70 225 0.00% 71 260 0.00% 72 329 0.00% 73 333 0.00% 74 417 0.00% 75 486 0.00% 76 548 0.00% 77 608 0.00% 78 693 0.00% 79 810 0.01% 80 916 0.01% 81 1079 0.01% 82 1234 0.01% 83 1435 0.01% 84 1673 0.01% 85 1915 0.01% 86 2057 0.01% 87 2209 0.01% 88 2487 0.02% 89 2543 0.02% 90 3010 0.02% 91 3427 0.02% 92 3897 0.02% 93 4219 0.03% 94 4830 0.03% 95 5104 0.03% 96 5651 0.04% 97 6322 0.04% 98 6641 0.04% 99 7123 0.04% 100 7612 0.05% 101 8078 0.05% 102 8874 0.06% 103 9795 0.06% 104 10310 0.06% 105 10983 0.07% 106 11820 0.07% 107 12467 0.08% 108 12924 0.08% 109 13618 0.09% 110 14439 0.09% 111 15204 0.09% 112 15938 0.10% 113 16829 0.11% 114 17864 0.11% 115 18998 0.12% 116 20676 0.13% 117 22495 0.14% 118 23844 0.15% 119 23943 0.15% 120 23132 0.14% 121 23697 0.15% 122 24741 0.15% 123 25939 0.16% 124 27371 0.17% 125 28244 0.18% 126 29829 0.19% 127 30775 0.19% 128 31420 0.20% 129 32059 0.20% 130 33148 0.21% 131 33895 0.21% 132 35198 0.22% 133 36771 0.23% 134 37551 0.23% 135 39560 0.25% 136 40672 0.25% 137 41210 0.26% 138 42710 0.27% 139 43775 0.27% 140 45021 0.28% 141 47748 0.30% 142 47960 0.30% 143 52071 0.33% 144 52859 0.33% 145 53274 0.33% 146 51474 0.32% 147 53754 0.34% 148 55721 0.35% 149 55025 0.34% 150 59287 0.37% 151 14412661 89.97% 16019212 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=20 prefix-density=0.38 prefix-fanout=2.3 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=99.63 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.4 sequence=CAACATTCTGAACATAAAGACACCAAATACTTAAAAACTACAATAGATGAAAGCCCAAATGACCCATAAAGTATTCAGACCACCCATAATTTAAAGCTGCCAGCCAGGTGCATTGCTTCCGGTTCCCGTCCCTGTAGTATATCCGGTGCCACCAGTCCCAGTGCCAAATGCAGCGTCACCGGCACGCGTATTATGGCCAGTGGTGTCACCTGGAAGCCCACCTGGATGTGTCCTCACCACACCCTCCTCCACTTGCCCACCATATGGCTGTCCGGCTCCATGTCCTGGCATAGCCGACATTTGATGAGTGCCCATGGGGTAACCAGTGACCCCAGTGGCTGAATGGGTGTGGGTGTCATGGCCGCCACTTGTCATGTAACCACCAGTACCTCCAGTTGCTGAAGCAGCATGCTTCGATGCCGCATTGTGCTGTTTTGCCTCTTGTTTATTGAGCTCTGCTTGTGTCATCCTCTCTTGTTTCTTTTCTCTTGCCATTTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=22 prefix-density=0.32 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=86.92 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.2 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCG SRR7171489 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:03:44 Started mapping on | Feb 14 11:03:45 Finished on | Feb 14 11:06:26 Mapping speed, Million of reads per hour | 358.19 Number of input reads | 16019212 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15083195 Uniquely mapped reads % | 94.16% Average mapped length | 296.67 Number of splices: Total | 13826102 Number of splices: Annotated (sjdb) | 13488809 Number of splices: GT/AG | 13600341 Number of splices: GC/AG | 171896 Number of splices: AT/AC | 10513 Number of splices: Non-canonical | 43352 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373656 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 54571 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 562361 562361 562361 N_multimapping 373656 373656 373656 N_noFeature 485664 14931182 546105 N_ambiguous 176021 686 84275 UnstrandedReadsAssigned:14421510 PositiveStrandReadsAssigned:151327 NegativeStrandReadsAssigned:14452815 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171489 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171489-trimmed-pair1.fastq SRR7171489-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,019,212 reads, 14,428,974 reads pseudoaligned [quant] estimated average fragment length: 232.426 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR7171489.ke.tsv 34699 SRR7171489.se.tsv 87100 total ==> SRR7171489.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.57 2019 75.4173 Potri.005G024800.1.v4.1 1035 803.574 4754 394.811 Potri.004G059700.1.v4.1 961 729.574 6 0.54883 Potri.007G009000.2.v4.1 1416 1184.57 0 0 Potri.003G141000.2.v4.1 2943 2711.57 826.455 20.3401 Potri.016G087400.1.v4.1 270 79.0801 1506.65 1271.46 Potri.015G069301.1.v4.1 564 334.873 0 0 Potri.010G195200.1.v4.1 1773 1541.57 809 35.0219 Potri.012G127500.1.v4.1 977 745.574 4161 372.445 ==> SRR7171489.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 358 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 66 SRR7171489 completed mapping pipeline successfully