Starting /dee2/code/volunteer_pipeline.sh SRR7171490 current disk space = 3112078446592 free memory = 1570658888 SRR7171490 SRAfilesize c5134d683b85c3093fafb800a2d5cade SRR7171490.sra SRR7171490.sra file validated SRR7171490 is paired end SRR7171490 is conventional basespace SRR7171490 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171490_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.9505 32.0 30.0 33.0 18.0 34.0 2 31.6165 33.0 32.0 33.0 27.0 34.0 3 32.54875 33.0 33.0 33.0 32.0 34.0 4 32.59175 33.0 33.0 34.0 32.0 34.0 5 32.92125 33.0 33.0 34.0 32.0 34.0 6 36.818 38.0 37.0 38.0 35.0 38.0 7 37.34925 38.0 38.0 38.0 37.0 38.0 8 37.48825 38.0 38.0 38.0 37.0 38.0 9 37.52325 38.0 38.0 38.0 38.0 38.0 10-14 37.57705 38.0 38.0 38.0 38.0 38.0 15-19 37.59375 38.0 38.0 38.0 38.0 38.0 20-24 37.54915 38.0 38.0 38.0 38.0 38.0 25-29 37.449549999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.32125 38.0 38.0 38.0 37.0 38.0 35-39 37.2806 38.0 38.0 38.0 37.0 38.0 40-44 37.36715 38.0 38.0 38.0 37.0 38.0 45-49 37.44255 38.0 38.0 38.0 37.0 38.0 50-54 37.4063 38.0 38.0 38.0 37.0 38.0 55-59 37.21975 38.0 38.0 38.0 36.8 38.0 60-64 37.14485 38.0 38.0 38.0 36.6 38.0 65-69 37.22345 38.0 38.0 38.0 36.6 38.0 70-74 37.2569 38.0 38.0 38.0 36.8 38.0 75-79 37.2043 38.0 38.0 38.0 36.8 38.0 80-84 37.17425000000001 38.0 38.0 38.0 36.4 38.0 85-89 37.11165 38.0 38.0 38.0 36.0 38.0 90-94 37.072500000000005 38.0 38.0 38.0 36.0 38.0 95-99 36.8793 38.0 38.0 38.0 35.2 38.0 100-104 36.80595 38.0 38.0 38.0 35.2 38.0 105-109 36.698699999999995 38.0 38.0 38.0 34.6 38.0 110-114 36.53625 38.0 38.0 38.0 34.0 38.0 115-119 36.2961 38.0 37.8 38.0 33.6 38.0 120-124 36.257799999999996 38.0 37.8 38.0 33.8 38.0 125-129 36.2351 38.0 37.4 38.0 33.6 38.0 130-134 36.1045 38.0 37.2 38.0 33.0 38.0 135-139 35.8942 38.0 36.4 38.0 32.0 38.0 140-144 35.627449999999996 38.0 36.0 38.0 31.0 38.0 145-149 35.3752 38.0 35.8 38.0 29.4 38.0 150-151 33.313125 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 4.0 23 3.0 24 4.0 25 6.0 26 8.0 27 16.0 28 18.0 29 30.0 30 32.0 31 49.0 32 69.0 33 78.0 34 137.0 35 223.0 36 525.0 37 2795.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45381526104418 12.248995983935743 11.495983935742972 37.8012048192771 2 23.025000000000002 14.875 32.175 29.925 3 20.1 19.175 26.150000000000002 34.575 4 22.6 27.725 23.35 26.325 5 22.575 30.875000000000004 23.95 22.6 6 20.075000000000003 34.949999999999996 24.775 20.200000000000003 7 15.299999999999999 26.325 41.025 17.349999999999998 8 17.775 27.875 30.925000000000004 23.425 9 16.1 25.674999999999997 35.825 22.400000000000002 10-14 19.54 30.495 27.750000000000004 22.215 15-19 19.46 28.95 28.055000000000003 23.535 20-24 19.225 29.74 27.765 23.27 25-29 19.415 29.575000000000003 27.400000000000002 23.61 30-34 19.525000000000002 29.925 27.284999999999997 23.265 35-39 19.74 29.43 27.165 23.665 40-44 19.36 28.849999999999998 28.005000000000003 23.785 45-49 19.27 29.104999999999997 27.73 23.895 50-54 19.67 29.085 27.694999999999997 23.549999999999997 55-59 19.79 29.49 27.275 23.445 60-64 19.695 28.794999999999998 27.779999999999998 23.73 65-69 19.845 28.455000000000002 27.93 23.77 70-74 19.8 28.95 27.445000000000004 23.805 75-79 19.57 28.38 28.17 23.880000000000003 80-84 20.195 28.185 27.525 24.095 85-89 19.905 28.74 27.279999999999998 24.075 90-94 20.235 28.835 27.339999999999996 23.59 95-99 20.165 27.49 28.18 24.165 100-104 20.5 28.199999999999996 27.400000000000002 23.9 105-109 21.285 27.810000000000002 27.345000000000002 23.56 110-114 20.7 28.08 27.11 24.11 115-119 20.830000000000002 28.29 26.93 23.95 120-124 20.849999999999998 28.360000000000003 26.674999999999997 24.115000000000002 125-129 21.165 28.1 26.58 24.154999999999998 130-134 20.61 28.22 26.87 24.3 135-139 21.02 28.405 26.595000000000002 23.98 140-144 21.605 27.35 26.384999999999998 24.66 145-149 21.11 28.26 26.02 24.610000000000003 150-151 20.4125 29.7875 25.4875 24.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 1.5 22 2.5 23 3.0 24 4.5 25 4.0 26 8.0 27 10.0 28 9.5 29 19.5 30 26.0 31 28.5 32 37.5 33 52.5 34 67.0 35 80.5 36 93.0 37 105.0 38 130.0 39 163.5 40 202.0 41 231.5 42 248.5 43 272.5 44 263.5 45 255.5 46 251.5 47 236.0 48 221.5 49 189.0 50 167.0 51 137.0 52 103.5 53 81.5 54 61.0 55 51.0 56 43.5 57 30.5 58 26.0 59 19.5 60 10.0 61 7.0 62 7.5 63 7.5 64 6.0 65 5.0 66 4.5 67 3.0 68 2.0 69 2.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.4874999999999998 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.275 0.0 0.0 0.0 0.0 116-117 3.7 0.0 0.0 0.0 0.0 118-119 4.0125 0.0 0.0 0.0 0.0 120-121 4.512499999999999 0.0 0.0 0.0 0.0 122-123 5.0375 0.0 0.0 0.0 0.0 124-125 5.625 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.9875 0.0 0.0 0.0 0.0 130-131 7.5875 0.0 0.0 0.0 0.0 132-133 8.3375 0.0 0.0 0.0 0.0 134-135 8.975 0.0 0.0 0.0 0.0 136-137 9.8375 0.0 0.0 0.0 0.0 138-139 10.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGAT 10 0.006830828 145.0 1 CCCACAA 10 0.006830828 145.0 8 >>END_MODULE SRR7171490 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171490_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97575 33.0 33.0 34.0 32.0 34.0 2 32.98475 34.0 33.0 34.0 32.0 34.0 3 33.054 34.0 33.0 34.0 32.0 34.0 4 32.93775 34.0 33.0 34.0 32.0 34.0 5 32.9115 34.0 33.0 34.0 32.0 34.0 6 37.01225 38.0 38.0 38.0 36.0 38.0 7 37.0165 38.0 38.0 38.0 37.0 38.0 8 37.04475 38.0 38.0 38.0 37.0 38.0 9 37.00875 38.0 38.0 38.0 37.0 38.0 10-14 36.9794 38.0 38.0 38.0 36.6 38.0 15-19 36.919650000000004 38.0 38.0 38.0 36.2 38.0 20-24 36.9265 38.0 38.0 38.0 36.2 38.0 25-29 36.973699999999994 38.0 38.0 38.0 36.6 38.0 30-34 37.079350000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.1229 38.0 38.0 38.0 37.0 38.0 40-44 37.138149999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.07185 38.0 38.0 38.0 36.8 38.0 50-54 37.00325 38.0 38.0 38.0 36.6 38.0 55-59 36.947 38.0 38.0 38.0 36.2 38.0 60-64 36.71255 38.0 38.0 38.0 35.0 38.0 65-69 36.79185 38.0 38.0 38.0 35.6 38.0 70-74 36.8735 38.0 38.0 38.0 36.0 38.0 75-79 36.8611 38.0 38.0 38.0 35.8 38.0 80-84 36.82645 38.0 38.0 38.0 35.6 38.0 85-89 36.77415 38.0 38.0 38.0 35.2 38.0 90-94 36.7142 38.0 38.0 38.0 35.0 38.0 95-99 36.7004 38.0 38.0 38.0 35.0 38.0 100-104 36.5151 38.0 38.0 38.0 34.2 38.0 105-109 36.392100000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.19085 38.0 38.0 38.0 33.4 38.0 115-119 35.98075 38.0 38.0 38.0 32.2 38.0 120-124 35.80795 38.0 37.2 38.0 31.2 38.0 125-129 35.73725 38.0 37.0 38.0 31.0 38.0 130-134 35.59055 38.0 36.2 38.0 31.0 38.0 135-139 35.39165 38.0 36.0 38.0 29.0 38.0 140-144 34.9591 38.0 35.2 38.0 26.6 38.0 145-149 34.7752 38.0 35.0 38.0 24.2 38.0 150-151 32.505875 36.5 29.0 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 3.0 16 6.0 17 10.0 18 9.0 19 6.0 20 4.0 21 9.0 22 4.0 23 10.0 24 16.0 25 12.0 26 15.0 27 20.0 28 33.0 29 33.0 30 41.0 31 64.0 32 58.0 33 93.0 34 129.0 35 219.0 36 453.0 37 2751.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.55 20.549999999999997 16.325 25.575 2 26.45145145145145 26.876876876876878 29.179179179179176 17.49249249249249 3 21.051314142678347 28.56070087609512 29.912390488110134 20.475594493116393 4 24.67434869739479 33.31663326653307 22.344689378757515 19.664328657314627 5 26.164246369554334 33.60040060090135 21.707561342013022 18.5277916875313 6 20.78019504876219 36.83420855213804 24.406101525381345 17.97949487371843 7 21.285642821410704 21.96098049024512 36.643321660830416 20.110055027513756 8 23.036518259129565 24.68734367183592 27.613806903451728 24.662331165582792 9 22.63631815907954 25.337668834417208 29.289644822411205 22.736368184092047 10-14 24.4759093410717 28.608595587131635 25.82678741181768 21.088707659978986 15-19 24.109465679407645 28.096858114868922 26.91114668801281 20.882529517710626 20-24 23.68394715772618 28.732986389111286 26.8464771817454 20.736589271417134 25-29 24.22089940473213 27.962583162423087 26.802060927417337 21.014456505427443 30-34 24.137413741374136 27.96279627962796 27.032703270327037 20.86708670867087 35-39 23.68 27.82 27.505000000000003 20.995 40-44 24.53613403350838 27.80195048762191 26.886721680420106 20.775193798449614 45-49 24.414648789273564 27.84170502301381 27.06623974384631 20.67740644386632 50-54 23.97417934347478 28.442754203362693 26.761409127301842 20.821657325860688 55-59 24.392074452116482 27.559291504052837 26.84379065345742 21.204843390373263 60-64 23.80166116281397 28.084659261483036 27.214049834884417 20.899629740818572 65-69 23.76688344172086 27.533766883441718 27.748874437218607 20.95047523761881 70-74 24.69870480572086 27.414112116817524 27.389108366254938 20.498074711206684 75-79 23.98 27.650000000000002 27.32 21.05 80-84 23.990000000000002 28.455000000000002 27.155 20.4 85-89 24.23121156057803 27.646382319115958 27.66638331916596 20.456022801140055 90-94 24.18467386954782 27.681072428971586 27.871148459383754 20.263105242096838 95-99 24.349609765859515 27.86171703021813 27.54652791675005 20.242145287172303 100-104 24.623392222611482 27.636254441719633 27.871477904008806 19.868875431660076 105-109 24.528301886792452 28.1517441569491 27.62624493268605 19.693709023572396 110-114 24.354354354354353 27.67267267267267 28.1981981981982 19.774774774774777 115-119 24.866136215783417 27.64850122604214 27.553420407346245 19.931942150828206 120-124 24.68481088653192 27.9217530518311 27.631578947368425 19.76185711426856 125-129 24.75742722816845 28.20846253876163 27.588276482944885 19.44583375012504 130-134 25.252575772731824 27.993398019405824 27.488246473942183 19.265779733920176 135-139 25.64038423053832 27.98679207524515 27.256353812287372 19.116469881929156 140-144 26.086086086086084 27.72272272272272 26.771771771771775 19.41941941941942 145-149 26.51151151151151 28.32832832832833 26.351351351351347 18.80880880880881 150-151 27.43993993993994 28.52852852852853 25.563063063063062 18.46846846846847 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.0 24 1.0 25 1.0 26 1.0 27 3.0 28 5.0 29 4.5 30 7.5 31 15.5 32 17.5 33 22.5 34 33.5 35 42.5 36 54.0 37 72.0 38 112.0 39 156.5 40 183.0 41 207.5 42 234.0 43 277.5 44 307.5 45 309.0 46 298.5 47 282.0 48 250.5 49 204.0 50 168.0 51 148.5 52 138.0 53 112.5 54 83.0 55 59.0 56 41.0 57 35.0 58 28.0 59 15.5 60 12.0 61 10.5 62 6.5 63 8.5 64 8.5 65 3.5 66 2.0 67 1.5 68 1.5 69 1.0 70 0.5 71 3.0 72 3.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.125 4 0.2 5 0.15 6 0.025 7 0.05 8 0.05 9 0.05 10-14 0.065 15-19 0.06 20-24 0.08 25-29 0.045 30-34 0.01 35-39 0.0 40-44 0.025 45-49 0.06 50-54 0.08 55-59 0.06999999999999999 60-64 0.06999999999999999 65-69 0.05 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.04 95-99 0.06 100-104 0.095 105-109 0.095 110-114 0.1 115-119 0.08499999999999999 120-124 0.06 125-129 0.03 130-134 0.03 135-139 0.06 140-144 0.1 145-149 0.1 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.5125000000000002 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 1.975 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.5374999999999996 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.275 0.0 0.0 0.0 0.0 116-117 3.7 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.5625 0.0 0.0 0.0 0.0 122-123 5.075 0.0 0.0 0.0 0.0 124-125 5.65 0.0 0.0 0.0 0.0 126-127 6.3125 0.0 0.0 0.0 0.0 128-129 7.0375 0.0 0.0 0.0 0.0 130-131 7.6 0.0 0.0 0.0 0.0 132-133 8.412500000000001 0.0 0.0 0.0 0.0 134-135 9.075 0.0 0.0 0.0 0.0 136-137 9.925 0.0 0.0 0.0 0.0 138-139 10.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGGGC 10 0.006830828 145.0 145 >>END_MODULE Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873365 spots for SRR7171490.sra Written 873365 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra Read 873352 spots for SRR7171490.sra Written 873352 spots for SRR7171490.sra SRR ids: ['SRR7171490.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c_9kvab_ SRR7171490.sra spots: 17467053 blocks: [[1, 873352], [873353, 1746704], [1746705, 2620056], [2620057, 3493408], [3493409, 4366760], [4366761, 5240112], [5240113, 6113464], [6113465, 6986816], [6986817, 7860168], [7860169, 8733520], [8733521, 9606872], [9606873, 10480224], [10480225, 11353576], [11353577, 12226928], [12226929, 13100280], [13100281, 13973632], [13973633, 14846984], [14846985, 15720336], [15720337, 16593688], [16593689, 17467053]] SRR7171490 file size 5897310 SRR7171490 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171490 SRR7171490_1.fastq SRR7171490_2.fastq Input file: SRR7171490_1.fastq Paired file: SRR7171490_2.fastq trimmed: SRR7171490-trimmed-pair1.fastq, SRR7171490-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:19:55 2025 >> started Fri Feb 14 12:20:22 2025 >> done (27.845s) 17467053 read pairs processed; of these: 595 ( 0.00%) short read pairs filtered out after trimming by size control 4650 ( 0.03%) empty read pairs filtered out after trimming by size control 17461808 (99.97%) read pairs available; of these: 3115388 (17.84%) trimmed read pairs available after processing 14346420 (82.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 4 0.00% 29 1 0.00% 30 1 0.00% 31 5 0.00% 32 3 0.00% 33 3 0.00% 34 4 0.00% 35 1 0.00% 36 3 0.00% 37 1 0.00% 38 0 0.00% 39 4 0.00% 40 8 0.00% 41 6 0.00% 42 7 0.00% 43 4 0.00% 44 12 0.00% 45 15 0.00% 46 8 0.00% 47 17 0.00% 48 14 0.00% 49 22 0.00% 50 28 0.00% 51 36 0.00% 52 35 0.00% 53 42 0.00% 54 48 0.00% 55 75 0.00% 56 59 0.00% 57 82 0.00% 58 94 0.00% 59 154 0.00% 60 135 0.00% 61 186 0.00% 62 211 0.00% 63 240 0.00% 64 278 0.00% 65 327 0.00% 66 341 0.00% 67 412 0.00% 68 475 0.00% 69 578 0.00% 70 645 0.00% 71 738 0.00% 72 904 0.01% 73 1103 0.01% 74 1275 0.01% 75 1444 0.01% 76 1634 0.01% 77 1752 0.01% 78 2083 0.01% 79 2335 0.01% 80 2623 0.02% 81 3180 0.02% 82 3732 0.02% 83 4140 0.02% 84 4795 0.03% 85 5313 0.03% 86 5684 0.03% 87 6355 0.04% 88 6977 0.04% 89 7440 0.04% 90 8533 0.05% 91 9375 0.05% 92 10524 0.06% 93 11710 0.07% 94 12756 0.07% 95 13721 0.08% 96 14891 0.09% 97 15788 0.09% 98 16363 0.09% 99 17553 0.10% 100 18907 0.11% 101 20218 0.12% 102 21823 0.12% 103 23348 0.13% 104 25209 0.14% 105 26776 0.15% 106 27940 0.16% 107 29413 0.17% 108 30478 0.17% 109 31268 0.18% 110 32596 0.19% 111 34222 0.20% 112 35690 0.20% 113 37960 0.22% 114 40563 0.23% 115 42419 0.24% 116 44595 0.26% 117 49152 0.28% 118 49366 0.28% 119 49356 0.28% 120 47858 0.27% 121 49727 0.28% 122 50970 0.29% 123 53706 0.31% 124 56084 0.32% 125 57828 0.33% 126 59993 0.34% 127 61695 0.35% 128 61832 0.35% 129 62710 0.36% 130 63579 0.36% 131 64846 0.37% 132 67043 0.38% 133 68698 0.39% 134 71067 0.41% 135 73176 0.42% 136 75343 0.43% 137 76278 0.44% 138 76527 0.44% 139 77345 0.44% 140 78855 0.45% 141 85963 0.49% 142 82723 0.47% 143 88894 0.51% 144 88967 0.51% 145 88931 0.51% 146 87925 0.50% 147 90662 0.52% 148 89902 0.51% 149 91044 0.52% 150 94564 0.54% 151 14346420 82.16% 17461808 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=15 prefix-density=0.96 prefix-fanout=2.4 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=57.34 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=7.3 sequence=AAATGCTTGAAGCTCATGGCAATGTCATTACCGTCAGGTGACATCAAAAGAAATACAAGGATGGTAAATTATTTGATAAGCCATGCACACGAACACAACGATAATATTAGGCAACAAGAGG criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=13 prefix-density=0.68 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=19 fanout-score=26.59 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=9.6 sequence=TTGGTGCTGAGA SRR7171490 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:21:23 Started mapping on | Feb 14 12:21:23 Finished on | Feb 14 12:24:35 Mapping speed, Million of reads per hour | 327.41 Number of input reads | 17461808 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15586050 Uniquely mapped reads % | 89.26% Average mapped length | 292.53 Number of splices: Total | 12594714 Number of splices: Annotated (sjdb) | 12318386 Number of splices: GT/AG | 12380153 Number of splices: GC/AG | 146946 Number of splices: AT/AC | 10453 Number of splices: Non-canonical | 57162 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455835 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 100349 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.38% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1419923 1419923 1419923 N_multimapping 455835 455835 455835 N_noFeature 385674 15396504 444299 N_ambiguous 212044 1412 80217 UnstrandedReadsAssigned:14988332 PositiveStrandReadsAssigned:188134 NegativeStrandReadsAssigned:15061534 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171490 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171490-trimmed-pair1.fastq SRR7171490-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,461,808 reads, 15,149,194 reads pseudoaligned [quant] estimated average fragment length: 208.396 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,249 rounds 52401 SRR7171490.ke.tsv 34699 SRR7171490.se.tsv 87100 total ==> SRR7171490.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.6 2203 65.7 Potri.005G024800.1.v4.1 1035 827.604 4964 323.88 Potri.004G059700.1.v4.1 961 753.608 4 0.286608 Potri.007G009000.2.v4.1 1416 1208.6 0 0 Potri.003G141000.2.v4.1 2943 2735.6 601 11.863 Potri.016G087400.1.v4.1 270 90.2628 1229 735.22 Potri.015G069301.1.v4.1 564 357.686 0 0 Potri.010G195200.1.v4.1 1773 1565.6 846.888 29.2091 Potri.012G127500.1.v4.1 977 769.604 11200 785.824 ==> SRR7171490.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1266 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 515 SRR7171490 completed mapping pipeline successfully