Starting /dee2/code/volunteer_pipeline.sh SRR7171491 current disk space = 3087593164800 free memory = 1472969080 SRR7171491 SRAfilesize 51865b101a7d9bbb485a3b172e968603 SRR7171491.sra SRR7171491.sra file validated SRR7171491 is paired end SRR7171491 is conventional basespace SRR7171491 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171491_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.955 34.0 33.0 34.0 32.0 34.0 2 33.22225 34.0 33.0 34.0 33.0 34.0 3 32.8945 34.0 33.0 34.0 31.0 34.0 4 32.9755 33.0 33.0 34.0 32.0 34.0 5 33.195 34.0 33.0 34.0 33.0 34.0 6 37.0095 38.0 37.0 38.0 36.0 38.0 7 37.375 38.0 38.0 38.0 37.0 38.0 8 37.562 38.0 38.0 38.0 37.0 38.0 9 37.574 38.0 38.0 38.0 38.0 38.0 10-14 37.59255 38.0 38.0 38.0 38.0 38.0 15-19 37.5387 38.0 38.0 38.0 38.0 38.0 20-24 37.443599999999996 38.0 38.0 38.0 37.2 38.0 25-29 37.45265 38.0 38.0 38.0 37.6 38.0 30-34 37.5127 38.0 38.0 38.0 38.0 38.0 35-39 36.27815 38.0 37.6 38.0 31.6 38.0 40-44 37.06035 38.0 38.0 38.0 34.6 38.0 45-49 37.395300000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.376 38.0 38.0 38.0 37.0 38.0 55-59 37.2755 38.0 38.0 38.0 37.0 38.0 60-64 37.30475 38.0 38.0 38.0 37.0 38.0 65-69 37.248900000000006 38.0 38.0 38.0 37.0 38.0 70-74 34.6075 33.6 33.6 37.8 32.4 38.0 75-79 35.33915 36.2 35.0 38.0 31.8 38.0 80-84 37.12095 38.0 38.0 38.0 36.2 38.0 85-89 37.101099999999995 38.0 38.0 38.0 36.0 38.0 90-94 37.1032 38.0 38.0 38.0 36.0 38.0 95-99 37.00125 38.0 38.0 38.0 36.0 38.0 100-104 36.94455000000001 38.0 38.0 38.0 35.6 38.0 105-109 36.821250000000006 38.0 38.0 38.0 35.0 38.0 110-114 36.6564 38.0 38.0 38.0 34.4 38.0 115-119 36.604549999999996 38.0 38.0 38.0 34.4 38.0 120-124 36.38505 38.0 38.0 38.0 34.0 38.0 125-129 36.233399999999996 38.0 37.6 38.0 33.4 38.0 130-134 36.11155 38.0 37.2 38.0 33.0 38.0 135-139 36.13155 38.0 37.0 38.0 33.0 38.0 140-144 35.994550000000004 38.0 36.4 38.0 32.8 38.0 145-149 35.812200000000004 38.0 36.0 38.0 32.2 38.0 150-151 33.46075 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 3.0 21 1.0 22 1.0 23 2.0 24 6.0 25 5.0 26 8.0 27 9.0 28 22.0 29 29.0 30 40.0 31 39.0 32 60.0 33 102.0 34 116.0 35 224.0 36 689.0 37 2643.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.8493323255228 13.101536911060721 9.800957420005039 35.24817334341144 2 21.8 14.825 33.225 30.15 3 20.025000000000002 20.3 26.625 33.050000000000004 4 23.225 25.6 24.075 27.1 5 22.875 29.25 25.275 22.6 6 20.25 34.125 24.55 21.075 7 15.475 26.075 40.25 18.2 8 17.875 26.85 30.775000000000002 24.5 9 16.425 24.875 34.025 24.675 10-14 19.465 29.685 27.26 23.59 15-19 19.165 28.57 28.185 24.08 20-24 19.855 27.93 28.01 24.205 25-29 19.535 28.044999999999998 28.305000000000003 24.115000000000002 30-34 20.164032806561313 27.620524104820966 28.080616123224644 24.134826965393078 35-39 20.59426742033915 29.198139162623182 26.466910109549296 23.740683307488368 40-44 20.577057705770578 28.797879787978797 27.04270427042704 23.582358235823584 45-49 19.513902780556112 28.600720144028806 27.530506101220244 24.35487097419484 50-54 20.14 28.144999999999996 27.725 23.990000000000002 55-59 20.185 28.73 27.375 23.71 60-64 19.81 27.955000000000002 27.68 24.555 65-69 19.865 27.834999999999997 27.74 24.560000000000002 70-74 20.815 28.96 25.745 24.48 75-79 20.16 28.055000000000003 27.694999999999997 24.09 80-84 20.97 27.73 27.145000000000003 24.154999999999998 85-89 20.615 27.839999999999996 27.485 24.060000000000002 90-94 19.82 28.415000000000003 27.639999999999997 24.125 95-99 19.900000000000002 27.985 27.785 24.33 100-104 20.395 28.225 27.715 23.665 105-109 20.485 27.605 28.01 23.9 110-114 20.16 27.944999999999997 27.750000000000004 24.145 115-119 20.965 27.445000000000004 27.83 23.76 120-124 20.53 28.26 27.395000000000003 23.815 125-129 21.175 27.865000000000002 26.924999999999997 24.035 130-134 20.855 27.92 27.43 23.794999999999998 135-139 20.875 27.97 27.525 23.630000000000003 140-144 21.165 27.495000000000005 27.189999999999998 24.15 145-149 20.95 27.63 27.05 24.37 150-151 20.724999999999998 28.787499999999998 26.137500000000003 24.349999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.5 25 2.5 26 3.0 27 3.5 28 6.5 29 11.5 30 15.0 31 21.0 32 28.0 33 36.0 34 49.5 35 61.0 36 74.5 37 98.0 38 125.0 39 160.0 40 184.0 41 216.5 42 259.5 43 260.5 44 271.0 45 283.0 46 259.0 47 234.5 48 229.0 49 225.0 50 186.0 51 139.0 52 112.0 53 101.5 54 77.5 55 52.0 56 46.0 57 42.5 58 33.0 59 22.5 60 14.0 61 10.5 62 9.5 63 4.5 64 6.0 65 6.0 66 3.5 67 1.5 68 2.0 69 2.0 70 0.5 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.02 35-39 0.045 40-44 0.01 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.4874999999999998 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.9000000000000004 0.0 0.0 0.0 0.0 122-123 3.4 0.0 0.0 0.0 0.0 124-125 3.7125000000000004 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.2 0.0 0.0 0.0 0.0 134-135 5.675 0.0 0.0 0.0 0.0 136-137 6.362500000000001 0.0 0.0 0.0 0.0 138-139 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171491 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171491_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95275 33.0 33.0 34.0 32.0 34.0 2 33.0325 34.0 33.0 34.0 32.0 34.0 3 33.059 34.0 33.0 34.0 32.0 34.0 4 33.06775 34.0 33.0 34.0 33.0 34.0 5 33.0615 34.0 33.0 34.0 33.0 34.0 6 37.225 38.0 38.0 38.0 37.0 38.0 7 37.1405 38.0 38.0 38.0 37.0 38.0 8 37.08125 38.0 38.0 38.0 37.0 38.0 9 37.13325 38.0 38.0 38.0 37.0 38.0 10-14 37.14755 38.0 38.0 38.0 37.0 38.0 15-19 37.12525000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.05825 38.0 38.0 38.0 36.6 38.0 25-29 37.0894 38.0 38.0 38.0 36.8 38.0 30-34 37.08445 38.0 38.0 38.0 36.8 38.0 35-39 37.01174999999999 38.0 38.0 38.0 36.2 38.0 40-44 36.82535 38.0 38.0 38.0 35.8 38.0 45-49 36.91205 38.0 38.0 38.0 36.0 38.0 50-54 36.97425 38.0 38.0 38.0 36.0 38.0 55-59 36.89425 38.0 38.0 38.0 36.0 38.0 60-64 36.88215 38.0 38.0 38.0 36.0 38.0 65-69 36.8343 38.0 38.0 38.0 36.0 38.0 70-74 36.793600000000005 38.0 38.0 38.0 35.6 38.0 75-79 36.78735 38.0 38.0 38.0 35.0 38.0 80-84 36.73625 38.0 38.0 38.0 35.4 38.0 85-89 36.69435 38.0 38.0 38.0 35.0 38.0 90-94 36.44595 38.0 38.0 38.0 34.2 38.0 95-99 36.539100000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.43365 38.0 38.0 38.0 34.0 38.0 105-109 36.37605 38.0 38.0 38.0 34.0 38.0 110-114 36.2023 38.0 38.0 38.0 33.8 38.0 115-119 36.14405000000001 38.0 38.0 38.0 33.6 38.0 120-124 35.9883 38.0 37.6 38.0 32.8 38.0 125-129 35.90070000000001 38.0 37.2 38.0 32.2 38.0 130-134 35.7863 38.0 36.8 38.0 31.4 38.0 135-139 35.580799999999996 38.0 36.0 38.0 30.4 38.0 140-144 35.3602 38.0 35.8 38.0 29.4 38.0 145-149 35.015699999999995 38.0 35.4 38.0 27.6 38.0 150-151 32.266 35.5 28.5 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 4.0 18 5.0 19 7.0 20 7.0 21 5.0 22 14.0 23 14.0 24 10.0 25 20.0 26 15.0 27 17.0 28 29.0 29 34.0 30 41.0 31 53.0 32 68.0 33 78.0 34 142.0 35 192.0 36 436.0 37 2801.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.75406554916187 22.241681260945708 15.786840130097573 23.217413059794847 2 26.758448060075096 26.733416770963704 28.235294117647058 18.272841051314142 3 21.426783479349186 29.86232790988736 29.737171464330416 18.973717146433042 4 23.078848560700877 36.22027534418022 22.428035043804755 18.272841051314142 5 25.068870523415974 35.111445028800404 21.61282243926872 18.2068620085149 6 22.489356373653894 36.31354871024293 23.766591535186578 17.430503380916605 7 21.23716503881793 21.813173052842476 36.714249937390434 20.235411970949162 8 22.96518908089156 26.120711244678184 25.945404457801153 24.9686952166291 9 22.088655146506387 25.494615577260205 30.102679689456547 22.31404958677686 10-14 24.19839679358717 28.471943887775552 25.89178356713427 21.437875751503004 15-19 23.745115719867748 28.038272718164514 27.366997294860234 20.849614267107505 20-24 23.22027954511297 28.94143579980963 27.22809478483042 20.61018987024698 25-29 24.402704733283244 27.713498622589533 27.658402203856745 20.22539444027047 30-34 24.167792961906194 27.94213345347149 27.386494468638933 20.50357911598338 35-39 23.81643479131218 28.405565008507654 27.28455610049044 20.49344409968972 40-44 23.574468085106385 28.405506883604502 27.27909887359199 20.74092615769712 45-49 24.26503731156408 27.961135874192415 27.164821956227776 20.609004858015727 50-54 23.856749311294767 27.963936889556724 27.50313047833709 20.67618332081142 55-59 23.946696057311758 28.23505836380943 27.423475777766644 20.39476980111217 60-64 24.26595851287704 27.898587032768813 27.758292414069548 20.077162040284595 65-69 24.293728711681027 27.769985974754558 27.579643358044482 20.356641955519937 70-74 23.63863863863864 27.68768768768769 27.64764764764765 21.026026026026027 75-79 23.943380183064072 27.62466863402191 27.59465813034562 20.8372930525684 80-84 24.367436743674368 28.28782878287829 26.992699269926995 20.35203520352035 85-89 24.271990393275292 28.439907935554885 26.84379065345742 20.444311017712398 90-94 24.503079156861762 27.812546938366793 26.851249186401642 20.8331247183698 95-99 24.39879759519038 27.870741482965933 27.284569138276556 20.445891783567134 100-104 24.869661118909164 27.386204130739923 27.66693402847403 20.07720072187688 105-109 24.051521074525134 27.950684107652986 27.660001002355532 20.337793815466345 110-114 24.651489319025174 27.595025574165078 27.509778357235987 20.243706749573764 115-119 24.361030369850656 28.189836624235742 27.122381477398015 20.326751528515587 120-124 24.713248184322563 27.59328825444528 27.402955171550214 20.290508389681943 125-129 24.290362953692117 28.020025031289116 27.50938673341677 20.180225281602002 130-134 24.88486183420104 27.928514217060474 26.937324789747695 20.249299158990787 135-139 24.96493688639551 28.115608094570227 27.2290122219996 19.690442797034663 140-144 24.801925584194162 27.820679971918565 27.053455019556715 20.323939424330558 145-149 25.373508472876765 28.24125137872255 26.646946756241853 19.73829339215883 150-151 26.112016038090463 27.878711940859542 26.475379025184814 19.53389299586518 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 2.0 26 2.0 27 3.0 28 3.0 29 8.0 30 12.0 31 12.5 32 16.0 33 21.5 34 35.5 35 51.0 36 65.0 37 87.0 38 124.5 39 143.0 40 172.5 41 211.0 42 255.5 43 298.5 44 303.0 45 308.0 46 299.5 47 275.0 48 243.0 49 214.0 50 175.5 51 142.0 52 122.0 53 94.0 54 67.5 55 57.5 56 46.5 57 31.0 58 23.0 59 13.5 60 11.5 61 10.5 62 7.0 63 5.0 64 4.0 65 3.0 66 2.0 67 2.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.125 3 0.125 4 0.125 5 0.17500000000000002 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-14 0.2 15-19 0.19 20-24 0.19499999999999998 25-29 0.17500000000000002 30-34 0.11499999999999999 35-39 0.09 40-44 0.125 45-49 0.165 50-54 0.17500000000000002 55-59 0.19499999999999998 60-64 0.21 65-69 0.18 70-74 0.1 75-79 0.034999999999999996 80-84 0.01 85-89 0.06999999999999999 90-94 0.135 95-99 0.2 100-104 0.26 105-109 0.23500000000000001 110-114 0.29 115-119 0.22999999999999998 120-124 0.17500000000000002 125-129 0.125 130-134 0.12 135-139 0.18 140-144 0.29 145-149 0.27 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.1 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.775 0.0 0.0 0.0 0.0 126-127 4.1125 0.0 0.0 0.0 0.0 128-129 4.612500000000001 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.325 0.0 0.0 0.0 0.0 134-135 5.825 0.0 0.0 0.0 0.0 136-137 6.5375 0.0 0.0 0.0 0.0 138-139 7.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCTCA 10 0.006830828 145.0 145 TTTGGCT 10 0.006830828 145.0 9 >>END_MODULE Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787981 spots for SRR7171491.sra Written 787981 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra Read 787964 spots for SRR7171491.sra Written 787964 spots for SRR7171491.sra SRR ids: ['SRR7171491.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eeituhpz SRR7171491.sra spots: 15759297 blocks: [[1, 787964], [787965, 1575928], [1575929, 2363892], [2363893, 3151856], [3151857, 3939820], [3939821, 4727784], [4727785, 5515748], [5515749, 6303712], [6303713, 7091676], [7091677, 7879640], [7879641, 8667604], [8667605, 9455568], [9455569, 10243532], [10243533, 11031496], [11031497, 11819460], [11819461, 12607424], [12607425, 13395388], [13395389, 14183352], [14183353, 14971316], [14971317, 15759297]] SRR7171491 file size 5318608 SRR7171491 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171491 SRR7171491_1.fastq SRR7171491_2.fastq Input file: SRR7171491_1.fastq Paired file: SRR7171491_2.fastq trimmed: SRR7171491-trimmed-pair1.fastq, SRR7171491-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:03:36 2025 >> started Thu Feb 13 20:03:54 2025 >> done (17.925s) 15759297 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 2226 ( 0.01%) empty read pairs filtered out after trimming by size control 15757033 (99.99%) read pairs available; of these: 2006367 (12.73%) trimmed read pairs available after processing 13750666 (87.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 4 0.00% 27 2 0.00% 28 1 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 1 0.00% 34 0 0.00% 35 3 0.00% 36 1 0.00% 37 5 0.00% 38 5 0.00% 39 3 0.00% 40 3 0.00% 41 1 0.00% 42 4 0.00% 43 7 0.00% 44 3 0.00% 45 11 0.00% 46 9 0.00% 47 14 0.00% 48 10 0.00% 49 14 0.00% 50 14 0.00% 51 14 0.00% 52 26 0.00% 53 23 0.00% 54 27 0.00% 55 36 0.00% 56 29 0.00% 57 42 0.00% 58 69 0.00% 59 57 0.00% 60 75 0.00% 61 79 0.00% 62 99 0.00% 63 107 0.00% 64 128 0.00% 65 148 0.00% 66 190 0.00% 67 192 0.00% 68 247 0.00% 69 294 0.00% 70 338 0.00% 71 389 0.00% 72 514 0.00% 73 589 0.00% 74 655 0.00% 75 738 0.00% 76 859 0.01% 77 1011 0.01% 78 1099 0.01% 79 1211 0.01% 80 1408 0.01% 81 1688 0.01% 82 1974 0.01% 83 2143 0.01% 84 2560 0.02% 85 2688 0.02% 86 3037 0.02% 87 3255 0.02% 88 3733 0.02% 89 4059 0.03% 90 4343 0.03% 91 4959 0.03% 92 5544 0.04% 93 6268 0.04% 94 6806 0.04% 95 7481 0.05% 96 7922 0.05% 97 8503 0.05% 98 9040 0.06% 99 9771 0.06% 100 10453 0.07% 101 11255 0.07% 102 12102 0.08% 103 13254 0.08% 104 14007 0.09% 105 15121 0.10% 106 16105 0.10% 107 16397 0.10% 108 16967 0.11% 109 17774 0.11% 110 18652 0.12% 111 19942 0.13% 112 21076 0.13% 113 22449 0.14% 114 23748 0.15% 115 25094 0.16% 116 27010 0.17% 117 30383 0.19% 118 31258 0.20% 119 29731 0.19% 120 29373 0.19% 121 30193 0.19% 122 31618 0.20% 123 33594 0.21% 124 35234 0.22% 125 36431 0.23% 126 37994 0.24% 127 38273 0.24% 128 39260 0.25% 129 39562 0.25% 130 40697 0.26% 131 41555 0.26% 132 43785 0.28% 133 45407 0.29% 134 47295 0.30% 135 49197 0.31% 136 50310 0.32% 137 50560 0.32% 138 51613 0.33% 139 52326 0.33% 140 53333 0.34% 141 58620 0.37% 142 58623 0.37% 143 61056 0.39% 144 61456 0.39% 145 64650 0.41% 146 61885 0.39% 147 63865 0.41% 148 65946 0.42% 149 63632 0.40% 150 69642 0.44% 151 13750666 87.27% 15757033 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=25 prefix-density=0.56 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=23.38 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.5 sequence=AAATAAAGGCACACTACTATTCATTATTGATGTCTGTGATCAAATAACAAAGAGCGTGACGCGACCAAACCCATAGCCACCACCATCTAGTAACAGAACCATATCCTGCAGCCTCTACTGTGGCCTAACCCTATGGCTCAACACCATTTCCCTAAGTTCAGCTGGATCAATCTCTGCTACATAATTAGCAGGCCTGTAATACCCAGTAACTGGATCAGGAGCCCATGCAGAGTAGGCCTCAGAATCTTCTTTGGCCACCGCCCCATCTTCCATTTTCCCTGTCATAGCACTGGTCCTTGACCCACCCCTACCGAAGCTCGCTGTTACAGCAGCACTGATCGGTGCAGCAGCCGCGTAACCTCTCCGGAAAACAGAGAGGGAAAGACCATCAGCAAGAGAAGCGACAAGAAGCTTAGCGTTTGGGAGAGAGCGAGCCATTTTATTTATGGTTTTCGTGTATATATAT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=22 prefix-density=0.48 prefix-fanout=2.9 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=34.32 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=10.9 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7171491 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:04:44 Started mapping on | Feb 13 20:04:44 Finished on | Feb 13 20:07:39 Mapping speed, Million of reads per hour | 324.14 Number of input reads | 15757033 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14079090 Uniquely mapped reads % | 89.35% Average mapped length | 295.12 Number of splices: Total | 13400406 Number of splices: Annotated (sjdb) | 13111297 Number of splices: GT/AG | 13183901 Number of splices: GC/AG | 167743 Number of splices: AT/AC | 10778 Number of splices: Non-canonical | 37984 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 344092 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 113667 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.54% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1333851 1333851 1333851 N_multimapping 344092 344092 344092 N_noFeature 378730 13940628 427446 N_ambiguous 164586 837 74471 UnstrandedReadsAssigned:13535774 PositiveStrandReadsAssigned:137625 NegativeStrandReadsAssigned:13577173 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171491 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171491-trimmed-pair1.fastq SRR7171491-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,757,033 reads, 13,749,203 reads pseudoaligned [quant] estimated average fragment length: 224.001 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7171491.ke.tsv 34699 SRR7171491.se.tsv 87100 total ==> SRR7171491.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795 1697 63.6404 Potri.005G024800.1.v4.1 1035 811.999 1203 99.7299 Potri.004G059700.1.v4.1 961 738.01 30 2.73637 Potri.007G009000.2.v4.1 1416 1193 0 0 Potri.003G141000.2.v4.1 2943 2720 896 22.1745 Potri.016G087400.1.v4.1 270 84.2354 1328 1061.25 Potri.015G069301.1.v4.1 564 343.142 0 0 Potri.010G195200.1.v4.1 1773 1550 645.942 28.0529 Potri.012G127500.1.v4.1 977 754.01 3291 293.81 ==> SRR7171491.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 379 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 84 SRR7171491 completed mapping pipeline successfully