Starting /dee2/code/volunteer_pipeline.sh SRR7171492 current disk space = 3087593865216 free memory = 1450111100 SRR7171492 SRAfilesize 080bdbea0502c2c801a52e2763ac5dd9 SRR7171492.sra SRR7171492.sra file validated SRR7171492 is paired end SRR7171492 is conventional basespace SRR7171492 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171492_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.482 33.0 32.0 34.0 28.0 34.0 2 32.2815 33.0 33.0 34.0 29.0 34.0 3 32.889 33.0 33.0 34.0 32.0 34.0 4 32.8405 33.0 33.0 34.0 32.0 34.0 5 33.0235 34.0 33.0 34.0 32.0 34.0 6 36.81925 38.0 37.0 38.0 35.0 38.0 7 37.11225 38.0 38.0 38.0 36.0 38.0 8 37.44275 38.0 38.0 38.0 37.0 38.0 9 37.4445 38.0 38.0 38.0 37.0 38.0 10-14 37.494550000000004 38.0 38.0 38.0 37.6 38.0 15-19 37.5265 38.0 38.0 38.0 38.0 38.0 20-24 37.5042 38.0 38.0 38.0 38.0 38.0 25-29 37.4594 38.0 38.0 38.0 37.6 38.0 30-34 37.452999999999996 38.0 38.0 38.0 37.4 38.0 35-39 37.431700000000006 38.0 38.0 38.0 37.2 38.0 40-44 37.3875 38.0 38.0 38.0 37.0 38.0 45-49 37.36415 38.0 38.0 38.0 37.0 38.0 50-54 37.37735000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.2712 38.0 38.0 38.0 37.0 38.0 60-64 37.22395 38.0 38.0 38.0 37.0 38.0 65-69 37.15025 38.0 38.0 38.0 36.0 38.0 70-74 37.099149999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.0168 38.0 38.0 38.0 36.0 38.0 80-84 37.016650000000006 38.0 38.0 38.0 36.0 38.0 85-89 37.067699999999995 38.0 38.0 38.0 36.0 38.0 90-94 37.07655 38.0 38.0 38.0 36.0 38.0 95-99 36.90125 38.0 38.0 38.0 35.6 38.0 100-104 36.701249999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.71515 38.0 38.0 38.0 34.6 38.0 110-114 36.69165 38.0 38.0 38.0 34.4 38.0 115-119 36.549350000000004 38.0 38.0 38.0 34.2 38.0 120-124 36.465599999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.34965 38.0 38.0 38.0 34.0 38.0 130-134 36.29395 38.0 37.6 38.0 33.6 38.0 135-139 36.043200000000006 38.0 36.6 38.0 32.6 38.0 140-144 35.99785 38.0 36.4 38.0 33.0 38.0 145-149 35.75605 38.0 36.0 38.0 31.6 38.0 150-151 33.7375 37.0 33.5 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 4.0 24 5.0 25 10.0 26 15.0 27 8.0 28 15.0 29 29.0 30 30.0 31 44.0 32 66.0 33 91.0 34 110.0 35 209.0 36 474.0 37 2887.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.97903510987623 12.654710785551906 10.911846425865116 39.454407678706744 2 21.275 14.674999999999999 34.025 30.025000000000002 3 19.75 20.225 26.224999999999998 33.800000000000004 4 23.175 27.325 23.400000000000002 26.1 5 21.825 32.625 24.15 21.4 6 18.825 36.275 24.5 20.4 7 14.000000000000002 27.05 41.075 17.875 8 18.775 25.324999999999996 30.2 25.7 9 17.925 23.674999999999997 34.275 24.125 10-14 19.5 29.895 27.045 23.56 15-19 19.48 28.565 27.87 24.085 20-24 20.075000000000003 27.62 28.13 24.175 25-29 19.650000000000002 28.875 28.084999999999997 23.39 30-34 20.24 28.63 27.85 23.28 35-39 20.155 28.63 27.68 23.535 40-44 20.085 28.09 27.955000000000002 23.87 45-49 19.77 28.735 26.974999999999998 24.52 50-54 19.66 28.615000000000002 28.02 23.705000000000002 55-59 19.875 29.285 27.334999999999997 23.505000000000003 60-64 19.455 28.994999999999997 27.455000000000002 24.095 65-69 20.135 28.105000000000004 27.544999999999998 24.215 70-74 20.335 28.09 27.534999999999997 24.04 75-79 20.375 28.044999999999998 27.02 24.560000000000002 80-84 19.905 28.015 27.925 24.154999999999998 85-89 20.349999999999998 27.85 28.235 23.565 90-94 20.225 28.125 27.450000000000003 24.2 95-99 19.845 28.07 27.975 24.11 100-104 20.1 28.345 27.810000000000002 23.745 105-109 20.41 28.46 26.979999999999997 24.15 110-114 20.630000000000003 28.275 27.065 24.03 115-119 20.41 28.244999999999997 27.82 23.525 120-124 20.89 28.065 27.589999999999996 23.455000000000002 125-129 20.48 27.485 27.589999999999996 24.445 130-134 20.585 28.110000000000003 27.205000000000002 24.099999999999998 135-139 20.34 28.505000000000003 27.6 23.555 140-144 20.65 27.615000000000002 27.175 24.560000000000002 145-149 21.305 27.825 27.195000000000004 23.674999999999997 150-151 21.3875 27.6625 26.8375 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 3.5 25 4.5 26 3.5 27 5.5 28 7.0 29 9.0 30 13.5 31 20.5 32 27.0 33 42.5 34 53.5 35 64.5 36 81.0 37 106.0 38 137.0 39 174.0 40 203.0 41 211.5 42 245.5 43 266.0 44 264.5 45 283.5 46 275.0 47 245.5 48 215.5 49 196.5 50 171.0 51 132.5 52 117.0 53 111.5 54 90.5 55 56.0 56 39.5 57 31.0 58 22.5 59 14.0 60 10.5 61 8.5 62 5.5 63 5.5 64 5.5 65 4.5 66 3.5 67 3.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.9749999999999996 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.5375 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.675000000000001 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCATCG 10 0.006830828 145.0 6 TCCACTT 10 0.006830828 145.0 7 >>END_MODULE SRR7171492 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171492_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99625 33.0 33.0 34.0 32.0 34.0 2 33.11325 34.0 33.0 34.0 32.0 34.0 3 33.10725 34.0 33.0 34.0 32.0 34.0 4 33.0385 34.0 33.0 34.0 32.0 34.0 5 33.0905 34.0 33.0 34.0 32.0 34.0 6 37.19725 38.0 38.0 38.0 37.0 38.0 7 37.196 38.0 38.0 38.0 37.0 38.0 8 37.1365 38.0 38.0 38.0 37.0 38.0 9 37.20375 38.0 38.0 38.0 37.0 38.0 10-14 37.153200000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.0851 38.0 38.0 38.0 37.0 38.0 20-24 37.07735 38.0 38.0 38.0 37.0 38.0 25-29 37.104499999999994 38.0 38.0 38.0 36.8 38.0 30-34 37.11255 38.0 38.0 38.0 37.0 38.0 35-39 37.0831 38.0 38.0 38.0 36.6 38.0 40-44 36.4628 37.8 37.4 38.0 33.8 38.0 45-49 36.982949999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.9639 38.0 38.0 38.0 36.0 38.0 55-59 36.9606 38.0 38.0 38.0 36.0 38.0 60-64 36.93185 38.0 38.0 38.0 35.8 38.0 65-69 36.9137 38.0 38.0 38.0 36.0 38.0 70-74 36.90625 38.0 38.0 38.0 36.0 38.0 75-79 36.91275 38.0 38.0 38.0 36.0 38.0 80-84 36.8521 38.0 38.0 38.0 35.8 38.0 85-89 36.79365 38.0 38.0 38.0 35.4 38.0 90-94 36.63635000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.568 38.0 38.0 38.0 34.6 38.0 100-104 36.482 38.0 38.0 38.0 34.2 38.0 105-109 36.392950000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.24635000000001 38.0 38.0 38.0 33.8 38.0 115-119 36.18085 38.0 38.0 38.0 33.4 38.0 120-124 35.99355 38.0 37.6 38.0 32.4 38.0 125-129 35.9145 38.0 37.0 38.0 32.2 38.0 130-134 35.72945 38.0 36.6 38.0 31.0 38.0 135-139 35.6355 38.0 36.0 38.0 31.0 38.0 140-144 35.3255 38.0 36.0 38.0 28.8 38.0 145-149 35.1156 38.0 35.4 38.0 28.0 38.0 150-151 32.642125 35.5 30.0 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 3.0 16 1.0 17 3.0 18 3.0 19 2.0 20 5.0 21 7.0 22 8.0 23 15.0 24 11.0 25 15.0 26 20.0 27 25.0 28 34.0 29 34.0 30 45.0 31 52.0 32 59.0 33 81.0 34 127.0 35 211.0 36 450.0 37 2785.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.625 20.025000000000002 16.25 29.099999999999998 2 25.86293146573287 26.588294147073537 30.665332666333168 16.883441720860432 3 20.8656492369277 29.572179134350762 30.97322992244183 18.58894170627971 4 22.892169126845133 34.475856892669505 23.492619464598448 19.139354515886914 5 24.412206103051524 35.56778389194598 22.586293146573286 17.433716858429214 6 20.931397095643465 36.30445668502754 23.38507761642464 19.379068602904358 7 18.87831747621432 22.233350025037556 39.509263895843766 19.379068602904358 8 22.408612919379067 24.086129193790686 27.491236855282924 26.01402103154732 9 22.383575363044567 24.71206810215323 29.369053580370558 23.535302954431646 10-14 23.597475455820476 29.262672811059907 26.422560609096372 20.71729112402324 15-19 23.825738607911866 27.546319479218827 27.781672508763144 20.84626940410616 20-24 22.986778846153847 27.804487179487182 28.03485576923077 21.173878205128204 25-29 24.07666900210189 28.270443399059154 27.184466019417474 20.468421579421477 30-34 23.37935174069628 27.916166466586635 27.69107643057223 21.01340536214486 35-39 23.897169150745224 28.918675602680803 26.693007902370713 20.491147344203263 40-44 23.744246547928757 27.78166900140084 27.351410846507907 21.122673604162497 45-49 23.335669236159777 28.211032135348884 27.57533286615277 20.877965762338572 50-54 24.02243028087919 28.58358784358884 27.30686426676013 20.08711760877184 55-59 23.86579869804707 27.250876314471707 28.037055583375064 20.84626940410616 60-64 23.824545591107103 27.885433879124733 27.695157979069652 20.59486255069851 65-69 23.891502352116905 27.82003803423081 27.855069562606342 20.43339005104594 70-74 24.20484096819364 28.060612122424484 27.425485097019404 20.309061812362472 75-79 23.57 27.884999999999998 27.72 20.825 80-84 23.765 27.71 27.76 20.765 85-89 24.324864972994597 27.870574114822965 27.580516103220642 20.224044808961793 90-94 24.015413101135966 27.143071610869242 28.138918080368313 20.702597207626482 95-99 24.059886835912074 27.670121676430824 27.845375794902612 20.424615692754493 100-104 24.211000901713255 27.4972447650536 28.19857729686404 20.0931770363691 105-109 24.479062312161894 27.810058104588258 27.860148266880387 19.850731316369465 110-114 24.2811341548943 27.757739705440336 27.712654042681095 20.248472096984273 115-119 24.4866272663528 27.3464890313533 28.022638485425222 20.14424521686868 120-124 24.545682102628284 27.424280350438046 27.489361702127656 20.540675844806007 125-129 24.096867807465223 27.7944561192835 28.204743320324226 19.903932752927048 130-134 24.70735367683842 27.373686843421712 27.763881940970485 20.155077538769383 135-139 25.203984582269612 28.077288882214546 27.47659808780097 19.242128447714872 140-144 25.34562211981567 28.000400721298334 27.20897615708275 19.44500100180325 145-149 25.18284741007915 27.988177537320908 26.90612163109909 19.922853421500854 150-151 25.839178356713425 26.903807615230463 27.45490981963928 19.802104208416836 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 2.5 28 5.0 29 7.0 30 8.0 31 13.0 32 17.0 33 24.0 34 38.5 35 54.5 36 68.0 37 100.0 38 125.5 39 156.0 40 210.5 41 238.5 42 261.5 43 296.0 44 314.0 45 301.5 46 262.5 47 251.5 48 239.0 49 196.5 50 161.5 51 142.5 52 131.5 53 102.5 54 66.0 55 42.5 56 33.0 57 28.5 58 22.5 59 14.0 60 13.5 61 11.5 62 8.5 63 7.0 64 5.0 65 3.5 66 2.0 67 1.0 68 1.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.075 4 0.075 5 0.05 6 0.15 7 0.15 8 0.15 9 0.15 10-14 0.18 15-19 0.15 20-24 0.16 25-29 0.09 30-34 0.04 35-39 0.03 40-44 0.06 45-49 0.11 50-54 0.135 55-59 0.15 60-64 0.145 65-69 0.09 70-74 0.02 75-79 0.0 80-84 0.0 85-89 0.02 90-94 0.08499999999999999 95-99 0.145 100-104 0.19 105-109 0.18 110-114 0.19 115-119 0.16999999999999998 120-124 0.125 125-129 0.06999999999999999 130-134 0.05 135-139 0.11499999999999999 140-144 0.18 145-149 0.19 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77432296890673 99.47500000000001 2 0.15045135406218654 0.3 3 0.07522567703109327 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.9124999999999999 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.7 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.4 0.0 0.0 0.0 0.0 126-127 3.5875 0.0 0.0 0.0 0.0 128-129 3.8499999999999996 0.0 0.0 0.0 0.0 130-131 4.1625 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800310 spots for SRR7171492.sra Written 800310 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra Read 800305 spots for SRR7171492.sra Written 800305 spots for SRR7171492.sra SRR ids: ['SRR7171492.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rq0vu238 SRR7171492.sra spots: 16006105 blocks: [[1, 800305], [800306, 1600610], [1600611, 2400915], [2400916, 3201220], [3201221, 4001525], [4001526, 4801830], [4801831, 5602135], [5602136, 6402440], [6402441, 7202745], [7202746, 8003050], [8003051, 8803355], [8803356, 9603660], [9603661, 10403965], [10403966, 11204270], [11204271, 12004575], [12004576, 12804880], [12804881, 13605185], [13605186, 14405490], [14405491, 15205795], [15205796, 16006105]] SRR7171492 file size 5402243 SRR7171492 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171492 SRR7171492_1.fastq SRR7171492_2.fastq Input file: SRR7171492_1.fastq Paired file: SRR7171492_2.fastq trimmed: SRR7171492-trimmed-pair1.fastq, SRR7171492-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:02:39 2025 >> started Thu Feb 13 20:02:56 2025 >> done (17.112s) 16006105 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 1054 ( 0.01%) empty read pairs filtered out after trimming by size control 16005032 (99.99%) read pairs available; of these: 1551285 ( 9.69%) trimmed read pairs available after processing 14453747 (90.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 2 0.00% 26 2 0.00% 27 1 0.00% 28 0 0.00% 29 3 0.00% 30 0 0.00% 31 0 0.00% 32 5 0.00% 33 0 0.00% 34 2 0.00% 35 4 0.00% 36 3 0.00% 37 0 0.00% 38 5 0.00% 39 4 0.00% 40 1 0.00% 41 5 0.00% 42 4 0.00% 43 3 0.00% 44 4 0.00% 45 5 0.00% 46 5 0.00% 47 4 0.00% 48 11 0.00% 49 11 0.00% 50 21 0.00% 51 14 0.00% 52 27 0.00% 53 29 0.00% 54 24 0.00% 55 36 0.00% 56 36 0.00% 57 37 0.00% 58 35 0.00% 59 62 0.00% 60 69 0.00% 61 100 0.00% 62 92 0.00% 63 119 0.00% 64 133 0.00% 65 151 0.00% 66 185 0.00% 67 183 0.00% 68 267 0.00% 69 264 0.00% 70 304 0.00% 71 380 0.00% 72 494 0.00% 73 535 0.00% 74 627 0.00% 75 694 0.00% 76 820 0.01% 77 857 0.01% 78 1011 0.01% 79 1155 0.01% 80 1321 0.01% 81 1449 0.01% 82 1763 0.01% 83 1971 0.01% 84 2106 0.01% 85 2474 0.02% 86 2497 0.02% 87 2814 0.02% 88 3128 0.02% 89 3467 0.02% 90 3816 0.02% 91 4244 0.03% 92 4701 0.03% 93 5328 0.03% 94 5688 0.04% 95 6040 0.04% 96 6585 0.04% 97 6823 0.04% 98 7067 0.04% 99 7560 0.05% 100 8342 0.05% 101 8783 0.05% 102 9741 0.06% 103 10189 0.06% 104 11075 0.07% 105 11607 0.07% 106 12147 0.08% 107 12600 0.08% 108 13079 0.08% 109 13581 0.08% 110 14135 0.09% 111 14826 0.09% 112 15932 0.10% 113 16993 0.11% 114 17979 0.11% 115 19140 0.12% 116 19927 0.12% 117 21588 0.13% 118 22732 0.14% 119 22354 0.14% 120 21700 0.14% 121 22979 0.14% 122 24121 0.15% 123 25118 0.16% 124 26319 0.16% 125 27242 0.17% 126 28359 0.18% 127 29428 0.18% 128 29892 0.19% 129 30240 0.19% 130 31015 0.19% 131 31763 0.20% 132 33482 0.21% 133 35074 0.22% 134 36099 0.23% 135 37829 0.24% 136 38559 0.24% 137 39339 0.25% 138 39986 0.25% 139 40556 0.25% 140 41986 0.26% 141 44187 0.28% 142 46220 0.29% 143 45330 0.28% 144 51473 0.32% 145 49513 0.31% 146 48568 0.30% 147 50441 0.32% 148 50986 0.32% 149 51268 0.32% 150 55762 0.35% 151 14453747 90.31% 16005032 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=24 prefix-density=0.73 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=29.78 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.4 sequence=ATCAAAGTACTTCACACCATGAAAAATCACACACTAAGCAAACCATGCATGATGGAATAAAAATGCTTTTAGGCGCACTGGAAATCTTTGGGGACCTTCTTTCCACAGACATTGAGAAGCAAGCTTAGAGATACAGGGATATTAAGGTTGATGCCCAAGATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGA criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=29 prefix-density=0.58 prefix-fanout=2.5 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=36.56 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.5 sequence=GAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCCTTATTCGCGAAACCACATTGTCATCAGTCTCCAATGAGAAAGCCGATTGCCACACAACCGAGTCCAATGAAAAGAATAATTTTGTCAAGGATTTTGGCCCACAGCCTACTGCTACATCTTATGACAATGGTATAAAACCAGCAAAAGATAAGTCCTTTTCGAAACATTTCCACCCAAACTCTCAGTTGTTCCTTTACAATGATGGTGACGTTAAAGGAGAGAGATCCTTCGCTGAAGATGTTGAGCCGAGGCCTAATGTGTCCGTTTACCACGACGACGCTACTCTTAAAGGAGAAAAATCTTTTCAGGAGGACTTCGAACCAGGACCTAACATATCAGTTTATG SRR7171492 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:03:45 Started mapping on | Feb 13 20:03:45 Finished on | Feb 13 20:05:51 Mapping speed, Million of reads per hour | 457.29 Number of input reads | 16005032 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14784877 Uniquely mapped reads % | 92.38% Average mapped length | 296.59 Number of splices: Total | 14788040 Number of splices: Annotated (sjdb) | 14526307 Number of splices: GT/AG | 14560672 Number of splices: GC/AG | 183085 Number of splices: AT/AC | 10206 Number of splices: Non-canonical | 34077 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394546 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 157040 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 825609 825609 825609 N_multimapping 394546 394546 394546 N_noFeature 343889 14648541 400016 N_ambiguous 148663 1019 67871 UnstrandedReadsAssigned:14292325 PositiveStrandReadsAssigned:135317 NegativeStrandReadsAssigned:14316990 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171492 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171492-trimmed-pair1.fastq SRR7171492-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,005,032 reads, 14,399,289 reads pseudoaligned [quant] estimated average fragment length: 237.444 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7171492.ke.tsv 34699 SRR7171492.se.tsv 87100 total ==> SRR7171492.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.56 1035 35.2702 Potri.005G024800.1.v4.1 1035 798.556 285 21.6674 Potri.004G059700.1.v4.1 961 724.577 32 2.68122 Potri.007G009000.2.v4.1 1416 1179.56 0 0 Potri.003G141000.2.v4.1 2943 2706.56 525 11.7763 Potri.016G087400.1.v4.1 270 78.917 1374 1057.02 Potri.015G069301.1.v4.1 564 330.567 0 0 Potri.010G195200.1.v4.1 1773 1536.56 312 12.3275 Potri.012G127500.1.v4.1 977 740.561 3835 314.392 ==> SRR7171492.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 540 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 268 SRR7171492 completed mapping pipeline successfully