Starting /dee2/code/volunteer_pipeline.sh SRR7171493 current disk space = 3087560163328 free memory = 1441172440 SRR7171493 SRAfilesize 64a815f23adcfc2348817d974f48586a SRR7171493.sra SRR7171493.sra file validated SRR7171493 is paired end SRR7171493 is conventional basespace SRR7171493 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171493_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4885 33.0 33.0 34.0 31.0 34.0 2 32.95175 34.0 33.0 34.0 32.0 34.0 3 32.56675 33.0 33.0 34.0 30.0 34.0 4 32.96775 33.0 33.0 34.0 32.0 34.0 5 32.97425 33.0 33.0 34.0 32.0 34.0 6 36.69925 38.0 37.0 38.0 34.0 38.0 7 37.24625 38.0 38.0 38.0 36.0 38.0 8 37.38425 38.0 38.0 38.0 37.0 38.0 9 37.46725 38.0 38.0 38.0 37.0 38.0 10-14 37.5292 38.0 38.0 38.0 37.6 38.0 15-19 37.4786 38.0 38.0 38.0 37.6 38.0 20-24 37.48539999999999 38.0 38.0 38.0 37.6 38.0 25-29 37.40955 38.0 38.0 38.0 37.0 38.0 30-34 37.4201 38.0 38.0 38.0 37.2 38.0 35-39 37.40675 38.0 38.0 38.0 37.0 38.0 40-44 37.3845 38.0 38.0 38.0 37.0 38.0 45-49 37.3192 38.0 38.0 38.0 37.0 38.0 50-54 37.300850000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.2392 38.0 38.0 38.0 36.8 38.0 60-64 37.181599999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.15025 38.0 38.0 38.0 36.0 38.0 70-74 37.154700000000005 38.0 38.0 38.0 36.0 38.0 75-79 37.097 38.0 38.0 38.0 36.0 38.0 80-84 37.00725 38.0 38.0 38.0 36.0 38.0 85-89 36.921800000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.86525 38.0 38.0 38.0 35.2 38.0 95-99 36.6832 38.0 38.0 38.0 34.8 38.0 100-104 36.70485 38.0 38.0 38.0 34.8 38.0 105-109 36.5472 38.0 38.0 38.0 34.2 38.0 110-114 36.5707 38.0 38.0 38.0 34.0 38.0 115-119 36.3365 38.0 37.8 38.0 33.6 38.0 120-124 36.274350000000005 38.0 37.2 38.0 34.0 38.0 125-129 36.177800000000005 38.0 37.0 38.0 33.0 38.0 130-134 36.043549999999996 38.0 37.0 38.0 33.0 38.0 135-139 35.855399999999996 38.0 36.0 38.0 31.8 38.0 140-144 35.6206 38.0 35.8 38.0 31.0 38.0 145-149 35.350649999999995 38.0 35.2 38.0 29.4 38.0 150-151 33.415375 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 2.0 22 5.0 23 5.0 24 3.0 25 8.0 26 12.0 27 11.0 28 30.0 29 19.0 30 37.0 31 42.0 32 57.0 33 76.0 34 156.0 35 210.0 36 580.0 37 2744.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.40483701366982 13.53838065194532 10.226077812828601 35.83070452155626 2 22.375 13.625000000000002 32.4 31.6 3 20.025000000000002 17.349999999999998 27.125 35.5 4 23.674999999999997 24.7 23.275000000000002 28.349999999999998 5 22.925 29.775000000000002 25.324999999999996 21.975 6 21.2 33.0 24.349999999999998 21.45 7 15.075 26.1 41.0 17.825 8 18.4 25.7 30.7 25.2 9 17.150000000000002 24.0 34.2 24.65 10-14 20.505000000000003 29.165000000000003 27.455000000000002 22.875 15-19 20.335 28.555000000000003 27.615000000000002 23.494999999999997 20-24 19.96 29.104999999999997 27.425 23.51 25-29 20.61 28.22 28.08 23.09 30-34 20.595 29.115000000000002 27.3 22.99 35-39 20.169999999999998 28.395 27.705000000000002 23.73 40-44 20.169999999999998 28.68 27.939999999999998 23.21 45-49 20.565 28.46 27.49 23.485 50-54 20.27 28.525 27.325 23.880000000000003 55-59 20.45 28.305000000000003 27.66 23.585 60-64 20.595 27.639999999999997 27.66 24.104999999999997 65-69 20.185 28.1 27.500000000000004 24.215 70-74 20.415 27.855 27.744999999999997 23.985 75-79 20.515 27.77 27.93 23.785 80-84 20.419999999999998 27.860000000000003 27.87 23.849999999999998 85-89 20.48 27.6 27.700000000000003 24.22 90-94 20.015 27.450000000000003 28.7 23.835 95-99 20.755000000000003 27.500000000000004 28.01 23.735 100-104 20.14 27.905 27.79 24.165 105-109 20.655 28.21 27.99 23.145 110-114 20.705000000000002 28.04 27.735 23.52 115-119 21.099999999999998 28.16 27.065 23.674999999999997 120-124 20.895 27.775 27.345000000000002 23.985 125-129 21.065 27.61 27.02 24.305 130-134 21.69 27.725 26.6 23.985 135-139 21.16 28.110000000000003 26.305 24.425 140-144 21.52 27.87 26.665 23.945 145-149 21.63 28.325 26.275 23.77 150-151 20.875 28.262500000000003 26.55 24.3125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.5 24 1.0 25 1.5 26 2.5 27 5.5 28 7.5 29 11.0 30 18.5 31 25.5 32 30.5 33 34.5 34 44.0 35 66.0 36 87.5 37 97.0 38 120.5 39 147.5 40 194.5 41 237.0 42 250.0 43 260.0 44 253.0 45 269.0 46 270.0 47 241.0 48 223.0 49 198.0 50 168.0 51 145.5 52 131.5 53 101.0 54 70.5 55 54.0 56 45.0 57 39.5 58 32.0 59 28.5 60 22.5 61 16.5 62 10.0 63 5.0 64 4.5 65 3.5 66 3.0 67 2.5 68 1.0 69 1.0 70 1.5 71 2.0 72 2.0 73 2.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0125 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0125 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.075 0.025 0.0 0.0 0.0 80-81 0.0875 0.025 0.0 0.0 0.0 82-83 0.1 0.025 0.0 0.0 0.0 84-85 0.1 0.025 0.0 0.0 0.0 86-87 0.15000000000000002 0.025 0.0 0.0 0.0 88-89 0.225 0.025 0.0 0.0 0.0 90-91 0.25 0.025 0.0 0.0 0.0 92-93 0.3375 0.025 0.0 0.0 0.0 94-95 0.4125 0.025 0.0 0.0 0.0 96-97 0.575 0.025 0.0 0.0 0.0 98-99 0.6875 0.025 0.0 0.0 0.0 100-101 0.8125 0.025 0.0 0.0 0.0 102-103 1.075 0.025 0.0 0.0 0.0 104-105 1.4625 0.025 0.0 0.0 0.0 106-107 1.675 0.025 0.0 0.0 0.0 108-109 1.9625 0.025 0.0 0.0 0.0 110-111 2.3625 0.025 0.0 0.0 0.0 112-113 2.8625 0.025 0.0 0.0 0.0 114-115 3.2 0.025 0.0 0.0 0.0 116-117 3.5375 0.025 0.0 0.0 0.0 118-119 3.85 0.025 0.0 0.0 0.0 120-121 4.4 0.025 0.0 0.0 0.0 122-123 4.9875 0.025 0.0 0.0 0.0 124-125 5.45 0.025 0.0 0.0 0.0 126-127 5.9625 0.025 0.0 0.0 0.0 128-129 6.525 0.025 0.0 0.0 0.0 130-131 7.2125 0.025 0.0 0.0 0.0 132-133 7.7375 0.025 0.0 0.0 0.0 134-135 8.3 0.025 0.0 0.0 0.0 136-137 8.9375 0.025 0.0 0.0 0.0 138-139 10.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171493 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171493_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9615 33.0 33.0 34.0 32.0 34.0 2 33.02825 33.0 33.0 34.0 32.0 34.0 3 33.031 34.0 33.0 34.0 32.0 34.0 4 32.96 34.0 33.0 34.0 32.0 34.0 5 32.90425 34.0 33.0 34.0 32.0 34.0 6 37.11075 38.0 38.0 38.0 36.0 38.0 7 37.13 38.0 38.0 38.0 37.0 38.0 8 37.1355 38.0 38.0 38.0 37.0 38.0 9 37.147 38.0 38.0 38.0 37.0 38.0 10-14 37.06245 38.0 38.0 38.0 36.4 38.0 15-19 37.10335 38.0 38.0 38.0 36.2 38.0 20-24 37.07955 38.0 38.0 38.0 36.4 38.0 25-29 37.07549999999999 38.0 38.0 38.0 36.4 38.0 30-34 37.03345 38.0 38.0 38.0 36.2 38.0 35-39 37.0073 38.0 38.0 38.0 36.0 38.0 40-44 37.024350000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.962149999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.8349 38.0 38.0 38.0 35.6 38.0 55-59 36.805099999999996 38.0 38.0 38.0 35.4 38.0 60-64 36.775749999999995 38.0 38.0 38.0 35.0 38.0 65-69 36.70405 38.0 38.0 38.0 34.8 38.0 70-74 36.680049999999994 38.0 38.0 38.0 34.8 38.0 75-79 36.56585 38.0 38.0 38.0 34.2 38.0 80-84 36.55465 38.0 38.0 38.0 34.0 38.0 85-89 36.46775 38.0 38.0 38.0 34.0 38.0 90-94 36.35465 38.0 37.8 38.0 34.0 38.0 95-99 36.1786 38.0 37.6 38.0 33.4 38.0 100-104 36.11635 38.0 37.0 38.0 33.0 38.0 105-109 35.946000000000005 38.0 37.0 38.0 31.4 38.0 110-114 35.7213 38.0 36.8 38.0 30.6 38.0 115-119 35.53285 38.0 36.4 38.0 29.8 38.0 120-124 35.34075 38.0 36.0 38.0 28.4 38.0 125-129 35.13510000000001 38.0 35.8 38.0 28.0 38.0 130-134 34.9222 38.0 35.0 38.0 27.0 38.0 135-139 34.45725 38.0 34.6 38.0 23.6 38.0 140-144 34.2438 38.0 34.2 38.0 23.0 38.0 145-149 33.819399999999995 38.0 33.4 38.0 21.8 38.0 150-151 30.9795 34.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 7.0 18 4.0 19 3.0 20 10.0 21 5.0 22 12.0 23 8.0 24 13.0 25 18.0 26 22.0 27 28.0 28 33.0 29 49.0 30 48.0 31 62.0 32 84.0 33 125.0 34 167.0 35 300.0 36 744.0 37 2257.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.4 21.625 16.05 23.925 2 27.450000000000003 26.275 27.525 18.75 3 20.525 29.675 30.7 19.1 4 24.875 33.025 22.825 19.275000000000002 5 25.0 35.525 22.325 17.150000000000002 6 21.125 37.925 23.125 17.825 7 21.125 22.95 36.449999999999996 19.475 8 22.5 25.25 27.500000000000004 24.75 9 22.625 24.85 29.275000000000002 23.25 10-14 23.625 28.810000000000002 26.08 21.485000000000003 15-19 23.34 28.08 27.245 21.335 20-24 23.705000000000002 29.275000000000002 26.334999999999997 20.685000000000002 25-29 23.085 28.965000000000003 27.084999999999997 20.865000000000002 30-34 23.935000000000002 28.17 27.189999999999998 20.705000000000002 35-39 24.115000000000002 28.485 27.16 20.24 40-44 23.605 28.299999999999997 27.38 20.715 45-49 23.585 28.305000000000003 27.48 20.630000000000003 50-54 24.13 28.435 27.634999999999998 19.8 55-59 24.015 27.365000000000002 27.955000000000002 20.665 60-64 23.895 28.095 27.169999999999998 20.84 65-69 24.095 28.444999999999997 26.939999999999998 20.52 70-74 24.095 27.605 27.48 20.82 75-79 23.825 27.825 27.275 21.075 80-84 23.825 28.34 27.33 20.505000000000003 85-89 24.08 27.750000000000004 27.425 20.745 90-94 24.169999999999998 27.565 27.79 20.474999999999998 95-99 23.565 28.565 27.38 20.49 100-104 24.25 27.810000000000002 27.305 20.635 105-109 23.845 27.6 27.834999999999997 20.72 110-114 24.43 28.694999999999997 26.75 20.125 115-119 25.025 27.584999999999997 26.66 20.73 120-124 24.875 28.055000000000003 26.705000000000002 20.365 125-129 24.64 28.044999999999998 26.939999999999998 20.375 130-134 25.629999999999995 27.99 26.290000000000003 20.09 135-139 25.285000000000004 28.449999999999996 26.965 19.3 140-144 25.575 27.025 27.79 19.61 145-149 25.515 28.050000000000004 26.700000000000003 19.735 150-151 26.525 27.3625 26.4625 19.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 0.5 26 1.0 27 3.0 28 7.0 29 8.5 30 7.5 31 12.5 32 16.0 33 25.0 34 45.0 35 60.5 36 79.0 37 100.0 38 124.0 39 162.5 40 210.0 41 236.0 42 244.0 43 275.0 44 284.0 45 276.0 46 273.0 47 250.5 48 237.0 49 212.5 50 175.0 51 145.0 52 114.5 53 90.0 54 72.5 55 58.5 56 44.0 57 33.5 58 25.0 59 19.0 60 13.0 61 9.5 62 9.0 63 6.5 64 5.5 65 2.5 66 3.0 67 3.0 68 3.0 69 3.5 70 2.5 71 2.0 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49685534591195 98.875 2 0.42767295597484273 0.8500000000000001 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 3.0374999999999996 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.7 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.550000000000001 0.0 0.0 0.0 0.0 122-123 5.175 0.0 0.0 0.0 0.0 124-125 5.65 0.0 0.0 0.0 0.0 126-127 6.15 0.0 0.0 0.0 0.0 128-129 6.7625 0.0 0.0 0.0 0.0 130-131 7.3875 0.0 0.0 0.0 0.0 132-133 7.9125 0.0 0.0 0.0 0.0 134-135 8.5 0.0 0.0 0.0 0.0 136-137 9.1625 0.0 0.0 0.0 0.0 138-139 10.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721323 spots for SRR7171493.sra Written 721323 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra Read 721316 spots for SRR7171493.sra Written 721316 spots for SRR7171493.sra SRR ids: ['SRR7171493.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8q6p1npt SRR7171493.sra spots: 14426327 blocks: [[1, 721316], [721317, 1442632], [1442633, 2163948], [2163949, 2885264], [2885265, 3606580], [3606581, 4327896], [4327897, 5049212], [5049213, 5770528], [5770529, 6491844], [6491845, 7213160], [7213161, 7934476], [7934477, 8655792], [8655793, 9377108], [9377109, 10098424], [10098425, 10819740], [10819741, 11541056], [11541057, 12262372], [12262373, 12983688], [12983689, 13705004], [13705005, 14426327]] SRR7171493 file size 4866908 SRR7171493 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171493 SRR7171493_1.fastq SRR7171493_2.fastq Input file: SRR7171493_1.fastq Paired file: SRR7171493_2.fastq trimmed: SRR7171493-trimmed-pair1.fastq, SRR7171493-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:21:41 2025 >> started Thu Feb 13 20:21:57 2025 >> done (15.763s) 14426327 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 6987 ( 0.05%) empty read pairs filtered out after trimming by size control 14419313 (99.95%) read pairs available; of these: 2315227 (16.06%) trimmed read pairs available after processing 12104086 (83.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 1 0.00% 24 3 0.00% 25 2 0.00% 26 1 0.00% 27 1 0.00% 28 2 0.00% 29 0 0.00% 30 2 0.00% 31 2 0.00% 32 0 0.00% 33 3 0.00% 34 5 0.00% 35 2 0.00% 36 1 0.00% 37 3 0.00% 38 1 0.00% 39 4 0.00% 40 2 0.00% 41 4 0.00% 42 4 0.00% 43 6 0.00% 44 9 0.00% 45 10 0.00% 46 6 0.00% 47 8 0.00% 48 7 0.00% 49 12 0.00% 50 23 0.00% 51 20 0.00% 52 29 0.00% 53 24 0.00% 54 30 0.00% 55 40 0.00% 56 54 0.00% 57 53 0.00% 58 56 0.00% 59 77 0.00% 60 108 0.00% 61 127 0.00% 62 133 0.00% 63 150 0.00% 64 189 0.00% 65 241 0.00% 66 228 0.00% 67 317 0.00% 68 320 0.00% 69 412 0.00% 70 460 0.00% 71 534 0.00% 72 704 0.00% 73 816 0.01% 74 918 0.01% 75 1042 0.01% 76 1183 0.01% 77 1283 0.01% 78 1580 0.01% 79 1736 0.01% 80 2070 0.01% 81 2428 0.02% 82 2803 0.02% 83 3104 0.02% 84 3583 0.02% 85 3917 0.03% 86 4318 0.03% 87 4864 0.03% 88 5180 0.04% 89 5901 0.04% 90 6512 0.05% 91 7304 0.05% 92 8052 0.06% 93 8912 0.06% 94 9751 0.07% 95 10443 0.07% 96 11589 0.08% 97 12088 0.08% 98 12808 0.09% 99 13809 0.10% 100 14674 0.10% 101 15960 0.11% 102 16903 0.12% 103 18326 0.13% 104 19578 0.14% 105 20759 0.14% 106 21691 0.15% 107 22595 0.16% 108 23557 0.16% 109 24464 0.17% 110 25311 0.18% 111 26472 0.18% 112 28303 0.20% 113 29361 0.20% 114 31174 0.22% 115 32424 0.22% 116 33610 0.23% 117 34797 0.24% 118 34974 0.24% 119 36051 0.25% 120 36767 0.25% 121 38415 0.27% 122 39740 0.28% 123 41600 0.29% 124 42800 0.30% 125 43853 0.30% 126 45310 0.31% 127 46066 0.32% 128 46794 0.32% 129 48015 0.33% 130 48339 0.34% 131 48824 0.34% 132 50646 0.35% 133 51911 0.36% 134 53235 0.37% 135 54574 0.38% 136 55287 0.38% 137 56725 0.39% 138 56936 0.39% 139 57417 0.40% 140 57312 0.40% 141 58384 0.40% 142 60086 0.42% 143 60754 0.42% 144 62367 0.43% 145 63657 0.44% 146 64178 0.45% 147 64993 0.45% 148 65284 0.45% 149 64803 0.45% 150 66738 0.46% 151 12104086 83.94% 14419313 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=13 prefix-density=0.51 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=42.51 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.0 sequence=TCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCCAAAGT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=23 prefix-density=0.59 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=33.20 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171493 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:22:46 Started mapping on | Feb 13 20:22:46 Finished on | Feb 13 20:25:37 Mapping speed, Million of reads per hour | 303.56 Number of input reads | 14419313 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12526418 Uniquely mapped reads % | 86.87% Average mapped length | 293.26 Number of splices: Total | 11887332 Number of splices: Annotated (sjdb) | 11641939 Number of splices: GT/AG | 11689986 Number of splices: GC/AG | 154593 Number of splices: AT/AC | 9643 Number of splices: Non-canonical | 33110 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376565 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 200694 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.72% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1516330 1516330 1516330 N_multimapping 376565 376565 376565 N_noFeature 324405 12399590 374644 N_ambiguous 140858 1116 63533 UnstrandedReadsAssigned:12061155 PositiveStrandReadsAssigned:125712 NegativeStrandReadsAssigned:12088241 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171493 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171493-trimmed-pair1.fastq SRR7171493-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,419,313 reads, 12,304,249 reads pseudoaligned [quant] estimated average fragment length: 217.441 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7171493.ke.tsv 34699 SRR7171493.se.tsv 87100 total ==> SRR7171493.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.56 996 39.6713 Potri.005G024800.1.v4.1 1035 818.559 396 34.7145 Potri.004G059700.1.v4.1 961 744.569 15 1.44561 Potri.007G009000.2.v4.1 1416 1199.56 0 0 Potri.003G141000.2.v4.1 2943 2726.56 479 12.6063 Potri.016G087400.1.v4.1 270 89.0738 1217.75 981.011 Potri.015G069301.1.v4.1 564 349.367 0 0 Potri.010G195200.1.v4.1 1773 1556.56 364 16.7804 Potri.012G127500.1.v4.1 977 760.559 3747 353.522 ==> SRR7171493.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 329 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 366 SRR7171493 completed mapping pipeline successfully