Starting /dee2/code/volunteer_pipeline.sh SRR7171494 current disk space = 3087584952320 free memory = 1443046912 SRR7171494 SRAfilesize 0ade6c9f51c1bf19ca70ee9aed29c0d2 SRR7171494.sra SRR7171494.sra file validated SRR7171494 is paired end SRR7171494 is conventional basespace SRR7171494 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171494_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70825 33.0 33.0 34.0 32.0 34.0 2 33.01925 34.0 33.0 34.0 31.0 34.0 3 32.51975 33.0 33.0 34.0 31.0 34.0 4 32.5215 33.0 33.0 34.0 31.0 34.0 5 32.55025 33.0 33.0 33.0 32.0 34.0 6 36.7515 38.0 37.0 38.0 35.0 38.0 7 37.26625 38.0 38.0 38.0 36.0 38.0 8 37.50075 38.0 38.0 38.0 37.0 38.0 9 37.55525 38.0 38.0 38.0 38.0 38.0 10-14 37.4979 38.0 38.0 38.0 37.8 38.0 15-19 37.41675 38.0 38.0 38.0 37.6 38.0 20-24 37.538799999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.5426 38.0 38.0 38.0 38.0 38.0 30-34 37.5349 38.0 38.0 38.0 38.0 38.0 35-39 37.4935 38.0 38.0 38.0 38.0 38.0 40-44 37.42105 38.0 38.0 38.0 37.6 38.0 45-49 37.316950000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.19175 38.0 38.0 38.0 36.8 38.0 55-59 37.2128 38.0 38.0 38.0 37.0 38.0 60-64 37.28835 38.0 38.0 38.0 37.0 38.0 65-69 37.28935 38.0 38.0 38.0 37.0 38.0 70-74 37.2687 38.0 38.0 38.0 37.0 38.0 75-79 37.19045 38.0 38.0 38.0 36.6 38.0 80-84 37.1573 38.0 38.0 38.0 36.0 38.0 85-89 37.01305 38.0 38.0 38.0 36.0 38.0 90-94 36.945350000000005 38.0 38.0 38.0 35.6 38.0 95-99 36.878049999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.90305 38.0 38.0 38.0 35.2 38.0 105-109 36.67855 38.0 38.0 38.0 34.8 38.0 110-114 36.5957 38.0 38.0 38.0 34.0 38.0 115-119 36.455799999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.391600000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.25045 38.0 37.8 38.0 33.6 38.0 130-134 36.0644 38.0 37.2 38.0 32.8 38.0 135-139 35.97755000000001 38.0 37.0 38.0 32.6 38.0 140-144 35.575300000000006 38.0 36.0 38.0 31.0 38.0 145-149 35.37465 38.0 36.0 38.0 30.4 38.0 150-151 32.75725 35.5 30.5 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 3.0 18 1.0 19 0.0 20 1.0 21 1.0 22 3.0 23 7.0 24 3.0 25 11.0 26 11.0 27 14.0 28 18.0 29 21.0 30 31.0 31 35.0 32 51.0 33 77.0 34 131.0 35 211.0 36 537.0 37 2832.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.75806451612903 11.769153225806452 9.753024193548388 33.71975806451613 2 21.725 14.224999999999998 33.7 30.349999999999998 3 20.724999999999998 20.1 24.45 34.725 4 22.400000000000002 27.975 25.025 24.6 5 22.225 31.825 24.099999999999998 21.85 6 18.525 35.9 25.85 19.725 7 14.099999999999998 25.5 41.925000000000004 18.475 8 16.375 24.8 32.525 26.3 9 17.275 24.95 34.150000000000006 23.625 10-14 19.675 28.53 27.755000000000003 24.04 15-19 19.67 28.455000000000002 28.02 23.855 20-24 19.475 28.185 28.285 24.055 25-29 19.869999999999997 28.98 27.525 23.625 30-34 19.965 28.685 27.76 23.59 35-39 19.52597629881494 28.261413070653536 28.15640782039102 24.056202810140505 40-44 19.919999999999998 28.415000000000003 27.97 23.695 45-49 19.97 28.425 27.98 23.625 50-54 20.235 27.685 28.565 23.515 55-59 20.435 28.875 27.595 23.095 60-64 19.96 28.549999999999997 27.384999999999998 24.104999999999997 65-69 20.115 28.744999999999997 27.439999999999998 23.7 70-74 20.47 28.63 27.700000000000003 23.200000000000003 75-79 20.424999999999997 28.065 28.26 23.25 80-84 19.994999999999997 28.62 27.665 23.72 85-89 20.28 28.27 27.96 23.49 90-94 20.125 28.915000000000003 27.465 23.494999999999997 95-99 20.905 27.865000000000002 27.615000000000002 23.615 100-104 20.474999999999998 28.565 27.37 23.59 105-109 20.28 28.285 27.589999999999996 23.845 110-114 20.549999999999997 28.43 27.415 23.605 115-119 20.705000000000002 28.194999999999997 27.51 23.59 120-124 20.76 27.935 27.48 23.825 125-129 21.08 27.985 27.125 23.810000000000002 130-134 20.615 27.825 27.689999999999998 23.87 135-139 20.615 27.855 27.355 24.175 140-144 20.965 27.955000000000002 26.810000000000002 24.27 145-149 21.67 28.415000000000003 26.525 23.39 150-151 20.6375 27.987499999999997 26.5125 24.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 2.5 23 2.5 24 3.0 25 4.0 26 4.5 27 4.5 28 7.0 29 11.5 30 15.0 31 21.0 32 27.0 33 39.0 34 53.0 35 62.0 36 82.5 37 113.5 38 127.5 39 150.0 40 181.5 41 216.5 42 252.0 43 277.5 44 288.5 45 297.0 46 284.0 47 254.5 48 239.5 49 204.0 50 158.0 51 131.0 52 113.5 53 93.5 54 73.5 55 54.0 56 38.0 57 22.5 58 16.0 59 15.5 60 16.5 61 12.0 62 5.5 63 2.5 64 2.0 65 2.5 66 3.0 67 2.0 68 2.0 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9500000000000002 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.5250000000000004 0.0 0.0 0.0 0.0 114-115 2.825 0.0 0.0 0.0 0.0 116-117 3.1375 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 5.2125 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.112500000000001 0.0 0.0 0.0 0.0 132-133 6.737500000000001 0.0 0.0 0.0 0.0 134-135 7.275 0.0 0.0 0.0 0.0 136-137 7.65 0.0 0.0 0.0 0.0 138-139 8.212499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCACT 10 0.006577216 146.82278 1 TCAAAAC 10 0.006832588 144.9875 3 TCCACTC 10 0.006832588 144.9875 2 >>END_MODULE SRR7171494 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171494_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01525 33.0 33.0 34.0 32.0 34.0 2 33.1155 34.0 33.0 34.0 32.0 34.0 3 33.116 34.0 33.0 34.0 32.0 34.0 4 33.04475 34.0 33.0 34.0 32.0 34.0 5 33.073 34.0 33.0 34.0 33.0 34.0 6 37.15125 38.0 38.0 38.0 37.0 38.0 7 37.2215 38.0 38.0 38.0 37.0 38.0 8 37.18 38.0 38.0 38.0 37.0 38.0 9 37.21625 38.0 38.0 38.0 37.0 38.0 10-14 37.1025 38.0 38.0 38.0 36.8 38.0 15-19 37.137899999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.15725 38.0 38.0 38.0 37.0 38.0 25-29 37.21695 38.0 38.0 38.0 37.0 38.0 30-34 37.1684 38.0 38.0 38.0 37.0 38.0 35-39 37.1784 38.0 38.0 38.0 37.0 38.0 40-44 37.124199999999995 38.0 38.0 38.0 37.0 38.0 45-49 36.986 38.0 38.0 38.0 36.4 38.0 50-54 36.96385 38.0 38.0 38.0 36.0 38.0 55-59 36.9206 38.0 38.0 38.0 36.0 38.0 60-64 36.98135 38.0 38.0 38.0 36.0 38.0 65-69 36.930049999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.882549999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.85795 38.0 38.0 38.0 35.8 38.0 80-84 36.88725 38.0 38.0 38.0 36.0 38.0 85-89 36.82595 38.0 38.0 38.0 35.6 38.0 90-94 36.6892 38.0 38.0 38.0 35.0 38.0 95-99 36.64845 38.0 38.0 38.0 35.0 38.0 100-104 36.5056 38.0 38.0 38.0 34.2 38.0 105-109 36.429849999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.29995 38.0 38.0 38.0 33.8 38.0 115-119 36.1687 38.0 38.0 38.0 33.4 38.0 120-124 36.0699 38.0 37.8 38.0 33.2 38.0 125-129 35.8635 38.0 37.0 38.0 32.0 38.0 130-134 35.801500000000004 38.0 36.6 38.0 31.4 38.0 135-139 35.313849999999995 38.0 36.0 38.0 28.8 38.0 140-144 34.99435 38.0 35.6 38.0 27.4 38.0 145-149 34.65415 38.0 33.8 38.0 25.4 38.0 150-151 31.949375 35.5 28.5 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 1.0 16 3.0 17 12.0 18 12.0 19 4.0 20 5.0 21 4.0 22 7.0 23 6.0 24 13.0 25 11.0 26 19.0 27 18.0 28 28.0 29 31.0 30 34.0 31 55.0 32 60.0 33 76.0 34 131.0 35 196.0 36 521.0 37 2750.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.175 20.8 14.325 25.7 2 26.18154538634659 25.731432858214554 29.40735183795949 18.67966991747937 3 20.330082520630157 30.9827456864216 28.857214303575894 19.829957489372344 4 24.681170292573142 34.93373343335834 23.50587646911728 16.879219804951237 5 24.656164041010253 36.58414603650913 21.580395098774694 17.179294823705927 6 20.76038019009505 37.46873436718359 23.66183091545773 18.10905452726363 7 20.040030022516888 21.61621215911934 36.727545659244434 21.61621215911934 8 22.491868901676256 26.444833625218916 26.619964973730298 24.44333249937453 9 22.441831373530146 26.244683512634477 28.796597448086064 22.516887665749312 10-14 23.532355737951054 28.9274811070517 26.07477103248086 21.46539212251639 15-19 23.203203203203206 28.223223223223222 27.24724724724725 21.326326326326324 20-24 23.312146539212254 28.211801211150593 27.35598818877934 21.120064060857814 25-29 23.13309658380433 28.52498374431051 27.519631871154903 20.822287800730255 30-34 23.188478271740763 28.16922538380757 27.499124868730306 21.14317147572136 35-39 23.409681936387276 27.60552110422084 28.020604120824167 20.964192838567712 40-44 22.905307388324747 27.93757190735831 28.26271822320044 20.894402481116504 45-49 22.706571242680546 28.502076973124467 27.77638756818978 21.014964216005204 50-54 22.94409129586065 28.30471995595375 28.044446669002454 20.706742079183144 55-59 23.505856442086294 27.470217238962856 28.276103714085494 20.747822604865352 60-64 23.374543270433957 28.23464637869763 27.894289003453625 20.496521347414788 65-69 23.49379503602882 27.607085668534825 27.70716573258607 21.19195356285028 70-74 23.035758939734936 28.28207051762941 27.956989247311824 20.72518129532383 75-79 23.632363236323634 27.817781778177817 28.007800780078007 20.54205420542054 80-84 23.385 28.055000000000003 28.139999999999997 20.419999999999998 85-89 23.374674934987 27.945589117823566 27.875575115023004 20.80416083216643 90-94 23.50880704563651 27.87730184147318 28.3226581265012 20.29123298638911 95-99 24.665899194153862 27.864257470343862 27.578957905801094 19.890885429701186 100-104 24.035043804755947 28.335419274092615 27.40926157697122 20.220275344180223 105-109 24.435544430538172 27.524405506883603 28.030037546933666 20.010012515644558 110-114 24.22148793431461 28.08150595774507 27.32051667167317 20.376489436267146 115-119 24.175219023779725 28.565707133917396 27.17897371714643 20.080100125156445 120-124 24.345562840983032 28.07948345763051 27.38375294058762 20.19120076079884 125-129 24.35583129033872 28.023215089808375 27.517886626307096 20.103066993545802 130-134 25.11381259692831 28.250537795787682 26.899794887187955 19.735854720096054 135-139 24.727199919911904 27.965762338572432 27.505255781359494 19.801781960156173 140-144 25.21151439299124 27.85481852315394 27.123904881101378 19.809762202753443 145-149 25.085119166833568 28.740236330863205 26.722411375926296 19.452233126376928 150-151 25.854513584574935 28.22085889570552 26.155001878051838 19.76962564166771 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 1.0 22 2.5 23 1.5 24 0.5 25 0.5 26 2.0 27 4.5 28 5.5 29 6.0 30 7.5 31 16.5 32 23.5 33 25.5 34 40.0 35 62.0 36 78.5 37 103.5 38 149.5 39 168.0 40 186.0 41 241.5 42 267.0 43 277.0 44 293.5 45 292.5 46 278.0 47 262.5 48 224.5 49 195.0 50 182.5 51 144.5 52 102.0 53 73.0 54 58.0 55 50.5 56 45.5 57 39.5 58 27.5 59 14.0 60 9.5 61 6.5 62 4.5 63 6.0 64 5.0 65 2.0 66 1.0 67 2.0 68 2.5 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.05 7 0.075 8 0.075 9 0.075 10-14 0.095 15-19 0.1 20-24 0.095 25-29 0.034999999999999996 30-34 0.015 35-39 0.02 40-44 0.045 45-49 0.095 50-54 0.105 55-59 0.11 60-64 0.105 65-69 0.08 70-74 0.025 75-79 0.01 80-84 0.0 85-89 0.02 90-94 0.08 95-99 0.105 100-104 0.125 105-109 0.125 110-114 0.13 115-119 0.125 120-124 0.105 125-129 0.065 130-134 0.055 135-139 0.11 140-144 0.125 145-149 0.13999999999999999 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79939819458376 99.5 2 0.15045135406218654 0.3 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.025075225677031094 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.5875 0.0 0.0 0.0 0.0 126-127 5.125 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.0375 0.0 0.0 0.0 0.0 132-133 6.6625 0.0 0.0 0.0 0.0 134-135 7.175000000000001 0.0 0.0 0.0 0.0 136-137 7.55 0.0 0.0 0.0 0.0 138-139 8.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873658 spots for SRR7171494.sra Written 873658 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra Read 873646 spots for SRR7171494.sra Written 873646 spots for SRR7171494.sra SRR ids: ['SRR7171494.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zx0wba0r SRR7171494.sra spots: 17472932 blocks: [[1, 873646], [873647, 1747292], [1747293, 2620938], [2620939, 3494584], [3494585, 4368230], [4368231, 5241876], [5241877, 6115522], [6115523, 6989168], [6989169, 7862814], [7862815, 8736460], [8736461, 9610106], [9610107, 10483752], [10483753, 11357398], [11357399, 12231044], [12231045, 13104690], [13104691, 13978336], [13978337, 14851982], [14851983, 15725628], [15725629, 16599274], [16599275, 17472932]] SRR7171494 file size 5899302 SRR7171494 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171494 SRR7171494_1.fastq SRR7171494_2.fastq Input file: SRR7171494_1.fastq Paired file: SRR7171494_2.fastq trimmed: SRR7171494-trimmed-pair1.fastq, SRR7171494-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:26:19 2025 >> started Thu Feb 13 20:26:50 2025 >> done (30.569s) 17472932 read pairs processed; of these: 123 ( 0.00%) short read pairs filtered out after trimming by size control 1185 ( 0.01%) empty read pairs filtered out after trimming by size control 17471624 (99.99%) read pairs available; of these: 2204883 (12.62%) trimmed read pairs available after processing 15266741 (87.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 0 0.00% 28 3 0.00% 29 0 0.00% 30 1 0.00% 31 2 0.00% 32 1 0.00% 33 2 0.00% 34 2 0.00% 35 2 0.00% 36 4 0.00% 37 2 0.00% 38 6 0.00% 39 6 0.00% 40 9 0.00% 41 8 0.00% 42 9 0.00% 43 8 0.00% 44 10 0.00% 45 17 0.00% 46 15 0.00% 47 12 0.00% 48 24 0.00% 49 12 0.00% 50 27 0.00% 51 21 0.00% 52 48 0.00% 53 44 0.00% 54 43 0.00% 55 55 0.00% 56 58 0.00% 57 61 0.00% 58 68 0.00% 59 93 0.00% 60 112 0.00% 61 140 0.00% 62 147 0.00% 63 173 0.00% 64 202 0.00% 65 194 0.00% 66 250 0.00% 67 274 0.00% 68 335 0.00% 69 392 0.00% 70 439 0.00% 71 536 0.00% 72 646 0.00% 73 792 0.00% 74 860 0.00% 75 1030 0.01% 76 1104 0.01% 77 1239 0.01% 78 1418 0.01% 79 1617 0.01% 80 1874 0.01% 81 2286 0.01% 82 2455 0.01% 83 2731 0.02% 84 3294 0.02% 85 3522 0.02% 86 3892 0.02% 87 4215 0.02% 88 4512 0.03% 89 5033 0.03% 90 5647 0.03% 91 6402 0.04% 92 7189 0.04% 93 8095 0.05% 94 8736 0.05% 95 9319 0.05% 96 10188 0.06% 97 10460 0.06% 98 11099 0.06% 99 12128 0.07% 100 12543 0.07% 101 13910 0.08% 102 15211 0.09% 103 16567 0.09% 104 17485 0.10% 105 18656 0.11% 106 19571 0.11% 107 20146 0.12% 108 20751 0.12% 109 21452 0.12% 110 22315 0.13% 111 23672 0.14% 112 25074 0.14% 113 26376 0.15% 114 27923 0.16% 115 29650 0.17% 116 31134 0.18% 117 33353 0.19% 118 34368 0.20% 119 35080 0.20% 120 33997 0.19% 121 34677 0.20% 122 36189 0.21% 123 37992 0.22% 124 39887 0.23% 125 40859 0.23% 126 42357 0.24% 127 43011 0.25% 128 43124 0.25% 129 43593 0.25% 130 44462 0.25% 131 45754 0.26% 132 47131 0.27% 133 49221 0.28% 134 50684 0.29% 135 52224 0.30% 136 53710 0.31% 137 53708 0.31% 138 54775 0.31% 139 55124 0.32% 140 56426 0.32% 141 58617 0.34% 142 59853 0.34% 143 63736 0.36% 144 65236 0.37% 145 65965 0.38% 146 64392 0.37% 147 65962 0.38% 148 66846 0.38% 149 65709 0.38% 150 68760 0.39% 151 15266741 87.38% 17471624 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=27 prefix-density=0.23 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=116.42 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=19.9 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=48.21 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.4 sequence=GAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCCGTATTCGCGAAA SRR7171494 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:27:36 Started mapping on | Feb 13 20:27:36 Finished on | Feb 13 20:29:59 Mapping speed, Million of reads per hour | 439.85 Number of input reads | 17471624 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16095229 Uniquely mapped reads % | 92.12% Average mapped length | 295.01 Number of splices: Total | 15993041 Number of splices: Annotated (sjdb) | 15711403 Number of splices: GT/AG | 15736927 Number of splices: GC/AG | 201537 Number of splices: AT/AC | 11665 Number of splices: Non-canonical | 42912 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 434848 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 120177 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.52% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 941547 941547 941547 N_multimapping 434848 434848 434848 N_noFeature 393389 15953116 453206 N_ambiguous 163901 759 81245 UnstrandedReadsAssigned:15537939 PositiveStrandReadsAssigned:141354 NegativeStrandReadsAssigned:15560778 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171494 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171494-trimmed-pair1.fastq SRR7171494-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,471,624 reads, 15,610,145 reads pseudoaligned [quant] estimated average fragment length: 231.77 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR7171494.ke.tsv 34699 SRR7171494.se.tsv 87100 total ==> SRR7171494.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.23 1309 48.6988 Potri.005G024800.1.v4.1 1035 804.23 159 13.1455 Potri.004G059700.1.v4.1 961 730.236 21 1.91212 Potri.007G009000.2.v4.1 1416 1185.23 0 0 Potri.003G141000.2.v4.1 2943 2712.23 591 14.4884 Potri.016G087400.1.v4.1 270 84.4904 1118 879.818 Potri.015G069301.1.v4.1 564 336.617 0 0 Potri.010G195200.1.v4.1 1773 1542.23 317 13.6669 Potri.012G127500.1.v4.1 977 746.23 2521 224.625 ==> SRR7171494.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 92 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 346 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 252 SRR7171494 completed mapping pipeline successfully