Starting /dee2/code/volunteer_pipeline.sh SRR7171495 current disk space = 3088218411008 free memory = 1582407708 SRR7171495 SRAfilesize 6b2661f13d4f16a4bdd7ddcd52133af7 SRR7171495.sra SRR7171495.sra file validated SRR7171495 is paired end SRR7171495 is conventional basespace SRR7171495 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171495_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72425 33.0 33.0 34.0 32.0 34.0 2 32.95175 34.0 33.0 34.0 31.0 34.0 3 32.63 33.0 33.0 34.0 31.0 34.0 4 32.7735 33.0 33.0 34.0 32.0 34.0 5 32.936 33.0 33.0 34.0 32.0 34.0 6 36.5225 38.0 36.0 38.0 34.0 38.0 7 37.11425 38.0 38.0 38.0 36.0 38.0 8 37.342 38.0 38.0 38.0 37.0 38.0 9 37.535 38.0 38.0 38.0 37.0 38.0 10-14 37.4755 38.0 38.0 38.0 37.4 38.0 15-19 37.39755 38.0 38.0 38.0 37.0 38.0 20-24 37.50435 38.0 38.0 38.0 38.0 38.0 25-29 37.5372 38.0 38.0 38.0 38.0 38.0 30-34 37.53075 38.0 38.0 38.0 38.0 38.0 35-39 37.488400000000006 38.0 38.0 38.0 37.6 38.0 40-44 37.414 38.0 38.0 38.0 37.0 38.0 45-49 37.304550000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.13605 38.0 38.0 38.0 36.6 38.0 55-59 37.210499999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.2839 38.0 38.0 38.0 36.8 38.0 65-69 37.2587 38.0 38.0 38.0 36.8 38.0 70-74 37.293899999999994 38.0 38.0 38.0 37.0 38.0 75-79 37.165499999999994 38.0 38.0 38.0 36.6 38.0 80-84 37.135949999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.94635 38.0 38.0 38.0 35.6 38.0 90-94 36.924099999999996 38.0 38.0 38.0 35.6 38.0 95-99 36.90105 38.0 38.0 38.0 35.4 38.0 100-104 36.8257 38.0 38.0 38.0 35.0 38.0 105-109 36.608349999999994 38.0 38.0 38.0 34.2 38.0 110-114 36.492 38.0 38.0 38.0 34.0 38.0 115-119 36.37734999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.361 38.0 37.6 38.0 33.8 38.0 125-129 36.2164 38.0 37.2 38.0 33.4 38.0 130-134 36.0041 38.0 37.0 38.0 32.2 38.0 135-139 35.8814 38.0 36.2 38.0 32.4 38.0 140-144 35.46185 38.0 36.0 38.0 29.6 38.0 145-149 35.24265 38.0 35.6 38.0 30.2 38.0 150-151 32.606875 35.5 29.5 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 0.0 22 3.0 23 6.0 24 4.0 25 10.0 26 11.0 27 11.0 28 16.0 29 26.0 30 26.0 31 46.0 32 66.0 33 95.0 34 137.0 35 222.0 36 547.0 37 2770.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.47283702213279 11.770623742454728 8.425553319919517 34.33098591549296 2 23.75 13.950000000000001 33.1 29.2 3 20.1 19.0 26.700000000000003 34.2 4 22.55 27.150000000000002 23.825 26.474999999999998 5 23.225 31.624999999999996 24.375 20.775 6 20.674999999999997 33.425 25.124999999999996 20.775 7 14.75 25.525 41.05 18.675 8 17.625 25.575 31.5 25.3 9 17.549999999999997 23.45 35.825 23.175 10-14 19.66 29.265 27.425 23.65 15-19 20.064999999999998 27.884999999999998 28.275 23.775 20-24 20.49 27.92 27.985 23.605 25-29 19.8 28.88 27.805000000000003 23.515 30-34 19.814999999999998 28.43 27.889999999999997 23.865 35-39 20.039007801560313 27.845569113822766 27.790558111622328 24.324864972994597 40-44 19.925 28.810000000000002 27.855 23.41 45-49 20.155 27.93 28.4 23.515 50-54 19.86 28.349999999999998 28.634999999999998 23.155 55-59 20.785 27.99 27.715 23.51 60-64 20.560000000000002 27.49 28.49 23.46 65-69 20.205000000000002 27.800000000000004 27.96 24.035 70-74 20.595 27.750000000000004 27.950000000000003 23.705000000000002 75-79 20.075000000000003 28.49 28.050000000000004 23.385 80-84 20.47 27.505000000000003 27.794999999999998 24.23 85-89 20.645 28.22 27.235 23.9 90-94 20.085 28.000000000000004 27.83 24.085 95-99 20.385 27.27 28.485 23.86 100-104 20.085 27.944999999999997 28.01 23.96 105-109 20.365 27.560000000000002 28.410000000000004 23.665 110-114 20.865000000000002 28.125 27.150000000000002 23.86 115-119 20.855 28.305000000000003 27.375 23.465 120-124 20.07 28.525 27.58 23.825 125-129 20.385 28.349999999999998 27.18 24.085 130-134 21.26 28.084999999999997 26.575 24.08 135-139 20.76 27.805000000000003 27.450000000000003 23.985 140-144 21.404999999999998 27.71 26.71 24.175 145-149 21.445 27.515 27.150000000000002 23.89 150-151 20.65 27.987499999999997 27.025 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 1.5 25 2.0 26 5.0 27 5.5 28 7.0 29 11.5 30 14.5 31 16.5 32 24.0 33 33.0 34 43.0 35 63.0 36 77.5 37 96.5 38 128.0 39 162.0 40 188.5 41 207.5 42 254.0 43 279.0 44 274.5 45 277.5 46 270.0 47 262.0 48 239.5 49 206.5 50 186.0 51 155.5 52 124.0 53 97.0 54 78.5 55 60.0 56 36.5 57 33.5 58 26.0 59 14.5 60 10.0 61 6.0 62 5.0 63 3.5 64 1.5 65 1.5 66 0.5 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.225 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 4.1875 0.0 0.0 0.0 0.0 124-125 4.6875 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.0625 0.0 0.0 0.0 0.0 132-133 6.737500000000001 0.0 0.0 0.0 0.0 134-135 7.375 0.0 0.0 0.0 0.0 136-137 7.9375 0.0 0.0 0.0 0.0 138-139 8.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACGTC 30 4.189703E-5 29.000002 140-144 CACGTCT 30 4.189703E-5 29.000002 140-144 CGGAAGA 35 1.1966578E-4 24.857143 130-134 AGAGCAC 35 1.1966578E-4 24.857143 135-139 CACACGT 30 0.0014437955 24.166668 140-144 ACGTCTG 30 0.0014437955 24.166668 140-144 TCGGAAG 40 2.9585467E-4 21.75 130-134 GAGCACA 40 2.9585467E-4 21.75 135-139 ATCGGAA 40 2.9585467E-4 21.75 130-134 GGAAGAG 35 0.0035366106 20.714287 130-134 AGATCGG 35 0.0035366106 20.714287 125-129 >>END_MODULE SRR7171495 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171495_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.918 33.0 33.0 34.0 32.0 34.0 2 32.962 34.0 33.0 34.0 32.0 34.0 3 32.99475 34.0 33.0 34.0 32.0 34.0 4 32.99725 34.0 33.0 34.0 32.0 34.0 5 32.92825 34.0 33.0 34.0 32.0 34.0 6 36.96375 38.0 38.0 38.0 37.0 38.0 7 37.05525 38.0 38.0 38.0 37.0 38.0 8 37.05325 38.0 38.0 38.0 37.0 38.0 9 37.009 38.0 38.0 38.0 37.0 38.0 10-14 36.98205 38.0 38.0 38.0 36.6 38.0 15-19 36.938050000000004 38.0 38.0 38.0 36.2 38.0 20-24 36.9852 38.0 38.0 38.0 37.0 38.0 25-29 37.0157 38.0 38.0 38.0 37.0 38.0 30-34 36.99515 38.0 38.0 38.0 36.8 38.0 35-39 36.968300000000006 38.0 38.0 38.0 36.4 38.0 40-44 36.9135 38.0 38.0 38.0 36.0 38.0 45-49 36.839749999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.734449999999995 38.0 38.0 38.0 35.6 38.0 55-59 36.73570000000001 38.0 38.0 38.0 35.8 38.0 60-64 36.759249999999994 38.0 38.0 38.0 35.8 38.0 65-69 36.718849999999996 38.0 38.0 38.0 35.4 38.0 70-74 36.71295 38.0 38.0 38.0 35.2 38.0 75-79 36.7332 38.0 38.0 38.0 35.4 38.0 80-84 36.7228 38.0 38.0 38.0 35.2 38.0 85-89 36.58775 38.0 38.0 38.0 34.8 38.0 90-94 36.43685 38.0 38.0 38.0 34.0 38.0 95-99 36.348400000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.290099999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.10880000000001 38.0 38.0 38.0 33.4 38.0 110-114 36.02975 38.0 38.0 38.0 33.0 38.0 115-119 35.9099 38.0 37.6 38.0 32.2 38.0 120-124 35.7575 38.0 37.2 38.0 31.2 38.0 125-129 35.6313 38.0 36.8 38.0 31.0 38.0 130-134 35.51965 38.0 36.2 38.0 30.4 38.0 135-139 35.1129 38.0 35.8 38.0 27.6 38.0 140-144 34.742000000000004 38.0 34.8 38.0 25.2 38.0 145-149 34.3423 38.0 33.2 38.0 23.2 38.0 150-151 31.831875 35.5 28.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 8.0 17 13.0 18 19.0 19 11.0 20 8.0 21 9.0 22 15.0 23 7.0 24 5.0 25 16.0 26 17.0 27 18.0 28 28.0 29 35.0 30 44.0 31 59.0 32 77.0 33 81.0 34 117.0 35 217.0 36 462.0 37 2727.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 21.375 13.525 25.45 2 25.925925925925924 27.027027027027028 29.704704704704703 17.34234234234234 3 20.995995995995994 28.153153153153156 30.705705705705704 20.145145145145147 4 23.742807105328996 33.950462847135356 23.567675756817614 18.739054290718038 5 25.125125125125123 36.53653653653654 21.646646646646648 16.691691691691695 6 21.946946946946948 36.16116116116116 23.173173173173172 18.71871871871872 7 22.65331664580726 21.101376720901126 36.24530663329161 20.0 8 23.123123123123122 26.376376376376378 25.825825825825827 24.674674674674673 9 21.00125156445557 25.60700876095119 30.087609511889863 23.30413016270338 10-14 24.034850533273246 28.626508437233987 25.496970607380703 21.84167042211206 15-19 23.212139423076923 27.999799679487182 27.649238782051285 21.138822115384613 20-24 23.370381495944727 28.547111244618 27.63592670471613 20.446580554721137 25-29 23.46228917471598 28.406986637305444 27.726340023021873 20.40438416495671 30-34 23.41670835417709 27.958979489744873 27.70885442721361 20.915457728864432 35-39 23.70185092546273 28.69434717358679 27.103551775887947 20.50025012506253 40-44 23.25825825825826 28.803803803803802 27.602602602602605 20.335335335335337 45-49 23.272581614259963 28.184458241538152 27.87903064290006 20.663929501301823 50-54 23.392955558895736 27.962322761661408 27.496367553484642 21.148354125958214 55-59 23.03337007716204 28.680228479807596 27.457661088285402 20.828740354744966 60-64 23.418323899213544 28.572859790612632 27.11015378450133 20.898662525672492 65-69 23.809762202753443 27.584480600750936 27.824780976220275 20.780976220275342 70-74 23.282461846384788 28.33625218914186 27.63572679509632 20.745559169377035 75-79 23.684736947389478 28.110622124424882 27.915583116623328 20.289057811562312 80-84 23.505000000000003 28.38 27.939999999999998 20.175 85-89 24.06063941562015 27.863111022164404 27.402811827687994 20.673437734527443 90-94 23.71583057975368 28.592169820766998 27.625913687794135 20.066085911685192 95-99 23.624611684537527 27.638039883755887 28.444733941276677 20.2926144904299 100-104 23.804511278195488 28.411027568922304 27.29323308270677 20.49122807017544 105-109 23.147869674185465 28.30075187969925 27.473684210526315 21.07769423558897 110-114 23.804511278195488 28.140350877192983 27.248120300751882 20.807017543859647 115-119 23.937449879711306 28.638732959101844 26.99478748997594 20.429029671210905 120-124 24.349917330527582 28.017435743273712 27.536449721929955 20.09619720426875 125-129 24.575719649561954 28.565707133917396 27.304130162703377 19.554443053817273 130-134 24.97246971668836 28.22604865351887 27.295024526979677 19.506457102813094 135-139 24.97369871248935 28.42041981864636 26.887430489454434 19.718450979409848 140-144 25.286953034935593 28.264247406145053 26.96105458373014 19.487744975189216 145-149 25.789473684210527 28.050125313283207 26.776942355889727 19.383458646616543 150-151 24.987468671679196 27.656641604010023 27.142857142857142 20.213032581453636 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.5 21 0.5 22 0.5 23 2.5 24 2.5 25 2.0 26 2.0 27 3.5 28 4.5 29 6.0 30 11.5 31 14.0 32 17.5 33 20.0 34 36.0 35 54.5 36 67.5 37 99.5 38 130.0 39 167.0 40 221.5 41 244.0 42 260.5 43 282.5 44 278.5 45 279.0 46 293.5 47 266.5 48 239.0 49 212.5 50 163.0 51 139.5 52 116.5 53 89.5 54 71.0 55 58.0 56 38.0 57 23.0 58 19.0 59 14.5 60 9.0 61 7.0 62 5.5 63 4.0 64 2.5 65 1.0 66 1.5 67 2.0 68 1.0 69 1.0 70 1.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.075 5 0.1 6 0.1 7 0.125 8 0.1 9 0.125 10-14 0.145 15-19 0.16 20-24 0.13 25-29 0.095 30-34 0.05 35-39 0.05 40-44 0.1 45-49 0.13999999999999999 50-54 0.20500000000000002 55-59 0.21 60-64 0.185 65-69 0.125 70-74 0.075 75-79 0.02 80-84 0.0 85-89 0.065 90-94 0.13 95-99 0.21 100-104 0.25 105-109 0.25 110-114 0.25 115-119 0.24 120-124 0.20500000000000002 125-129 0.125 130-134 0.11 135-139 0.19499999999999998 140-144 0.245 145-149 0.25 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 3.2125000000000004 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 5.1125 0.0 0.0 0.0 0.0 128-129 5.6125 0.0 0.0 0.0 0.0 130-131 6.0 0.0 0.0 0.0 0.0 132-133 6.6875 0.0 0.0 0.0 0.0 134-135 7.324999999999999 0.0 0.0 0.0 0.0 136-137 7.8875 0.0 0.0 0.0 0.0 138-139 8.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGTGT 30 4.189703E-5 29.000002 140-144 TCGTGTA 30 4.189703E-5 29.000002 140-144 GAGCGTC 35 1.1966578E-4 24.857143 135-139 AGAGCGT 35 1.1966578E-4 24.857143 135-139 CGTGTAG 30 0.0014437955 24.166668 140-144 AAGAGCG 35 0.0035366106 20.714287 135-139 CGTCGTG 35 0.0035366106 20.714287 140-144 AGCGTCG 35 0.0035366106 20.714287 135-139 AGATCGG 35 0.0035366106 20.714287 125-129 ATCGGAA 40 0.0076550315 18.125 130-134 TCGGAAG 50 0.0013298223 17.4 130-134 CGGAAGA 50 0.0013298223 17.4 130-134 >>END_MODULE Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857241 spots for SRR7171495.sra Written 857241 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra Read 857233 spots for SRR7171495.sra Written 857233 spots for SRR7171495.sra SRR ids: ['SRR7171495.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g7q8qhbc SRR7171495.sra spots: 17144668 blocks: [[1, 857233], [857234, 1714466], [1714467, 2571699], [2571700, 3428932], [3428933, 4286165], [4286166, 5143398], [5143399, 6000631], [6000632, 6857864], [6857865, 7715097], [7715098, 8572330], [8572331, 9429563], [9429564, 10286796], [10286797, 11144029], [11144030, 12001262], [12001263, 12858495], [12858496, 13715728], [13715729, 14572961], [14572962, 15430194], [15430195, 16287427], [16287428, 17144668]] SRR7171495 file size 5788065 SRR7171495 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171495 SRR7171495_1.fastq SRR7171495_2.fastq Input file: SRR7171495_1.fastq Paired file: SRR7171495_2.fastq trimmed: SRR7171495-trimmed-pair1.fastq, SRR7171495-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:07:28 2025 >> started Thu Feb 13 21:07:46 2025 >> done (18.374s) 17144668 read pairs processed; of these: 132 ( 0.00%) short read pairs filtered out after trimming by size control 1568 ( 0.01%) empty read pairs filtered out after trimming by size control 17142968 (99.99%) read pairs available; of these: 2441964 (14.24%) trimmed read pairs available after processing 14701004 (85.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 1 0.00% 31 0 0.00% 32 1 0.00% 33 5 0.00% 34 3 0.00% 35 4 0.00% 36 5 0.00% 37 3 0.00% 38 8 0.00% 39 6 0.00% 40 4 0.00% 41 15 0.00% 42 5 0.00% 43 5 0.00% 44 10 0.00% 45 8 0.00% 46 9 0.00% 47 15 0.00% 48 20 0.00% 49 26 0.00% 50 31 0.00% 51 35 0.00% 52 41 0.00% 53 38 0.00% 54 52 0.00% 55 40 0.00% 56 64 0.00% 57 64 0.00% 58 92 0.00% 59 103 0.00% 60 122 0.00% 61 137 0.00% 62 141 0.00% 63 181 0.00% 64 211 0.00% 65 265 0.00% 66 296 0.00% 67 316 0.00% 68 406 0.00% 69 451 0.00% 70 551 0.00% 71 684 0.00% 72 805 0.00% 73 925 0.01% 74 1041 0.01% 75 1139 0.01% 76 1344 0.01% 77 1480 0.01% 78 1662 0.01% 79 1847 0.01% 80 2206 0.01% 81 2558 0.01% 82 3045 0.02% 83 3366 0.02% 84 3798 0.02% 85 4268 0.02% 86 4681 0.03% 87 5114 0.03% 88 5528 0.03% 89 5976 0.03% 90 6703 0.04% 91 7475 0.04% 92 8364 0.05% 93 9470 0.06% 94 10305 0.06% 95 10932 0.06% 96 11928 0.07% 97 12271 0.07% 98 13283 0.08% 99 13976 0.08% 100 15163 0.09% 101 16095 0.09% 102 17368 0.10% 103 19146 0.11% 104 20086 0.12% 105 21629 0.13% 106 22321 0.13% 107 23015 0.13% 108 23795 0.14% 109 24657 0.14% 110 26004 0.15% 111 26816 0.16% 112 28543 0.17% 113 29878 0.17% 114 31583 0.18% 115 33234 0.19% 116 34781 0.20% 117 37154 0.22% 118 37922 0.22% 119 38794 0.23% 120 37912 0.22% 121 38536 0.22% 122 40240 0.23% 123 42139 0.25% 124 44452 0.26% 125 45538 0.27% 126 47092 0.27% 127 47566 0.28% 128 48324 0.28% 129 48908 0.29% 130 49395 0.29% 131 50610 0.30% 132 52129 0.30% 133 54256 0.32% 134 55759 0.33% 135 57490 0.34% 136 58697 0.34% 137 58928 0.34% 138 59907 0.35% 139 60255 0.35% 140 61846 0.36% 141 63345 0.37% 142 65129 0.38% 143 68663 0.40% 144 69412 0.40% 145 70780 0.41% 146 69094 0.40% 147 71590 0.42% 148 71347 0.42% 149 70750 0.41% 150 73913 0.43% 151 14701004 85.76% 17142968 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=7.34 fanout-score-rank=8 prefix-density=0.62 prefix-fanout=2.4 sequence=TTCTCAGCACCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=14.49 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=4.1 sequence=TTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.37 fanout-score-rank=24 prefix-density=0.37 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=67.30 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=12.6 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGC SRR7171495 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:08:39 Started mapping on | Feb 13 21:08:39 Finished on | Feb 13 21:11:02 Mapping speed, Million of reads per hour | 431.57 Number of input reads | 17142968 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15795300 Uniquely mapped reads % | 92.14% Average mapped length | 294.17 Number of splices: Total | 15340324 Number of splices: Annotated (sjdb) | 15062449 Number of splices: GT/AG | 15095056 Number of splices: GC/AG | 192915 Number of splices: AT/AC | 10675 Number of splices: Non-canonical | 41678 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 432371 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 81695 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.73% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 915297 915297 915297 N_multimapping 432371 432371 432371 N_noFeature 365757 15651034 426269 N_ambiguous 163592 1164 78972 UnstrandedReadsAssigned:15265951 PositiveStrandReadsAssigned:143102 NegativeStrandReadsAssigned:15290059 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171495 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171495-trimmed-pair1.fastq SRR7171495-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,142,968 reads, 15,344,782 reads pseudoaligned [quant] estimated average fragment length: 223.189 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7171495.ke.tsv 34699 SRR7171495.se.tsv 87100 total ==> SRR7171495.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.81 1392 50.9695 Potri.005G024800.1.v4.1 1035 812.811 198 16.018 Potri.004G059700.1.v4.1 961 738.817 10 0.890011 Potri.007G009000.2.v4.1 1416 1193.81 0 0 Potri.003G141000.2.v4.1 2943 2720.81 711.826 17.2031 Potri.016G087400.1.v4.1 270 86.5717 1172 890.191 Potri.015G069301.1.v4.1 564 344.047 0 0 Potri.010G195200.1.v4.1 1773 1550.81 462.91 19.6277 Potri.012G127500.1.v4.1 977 754.811 3826 333.302 ==> SRR7171495.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 490 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 487 SRR7171495 completed mapping pipeline successfully