Starting /dee2/code/volunteer_pipeline.sh SRR7171497 current disk space = 3087746064384 free memory = 1449873152 SRR7171497 SRAfilesize 9e84d9c262f78a01a8d3e042cef921dd SRR7171497.sra SRR7171497.sra file validated SRR7171497 is paired end SRR7171497 is conventional basespace SRR7171497 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171497_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.01525 33.0 32.0 34.0 25.0 34.0 2 32.1635 33.0 31.0 34.0 29.0 34.0 3 32.79775 33.0 33.0 34.0 32.0 34.0 4 32.77925 33.0 33.0 34.0 32.0 34.0 5 33.03325 33.0 33.0 34.0 32.0 34.0 6 36.90575 38.0 37.0 38.0 35.0 38.0 7 37.13575 38.0 38.0 38.0 36.0 38.0 8 37.35875 38.0 38.0 38.0 37.0 38.0 9 37.532 38.0 38.0 38.0 38.0 38.0 10-14 37.527649999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.49995 38.0 38.0 38.0 37.6 38.0 20-24 37.5267 38.0 38.0 38.0 38.0 38.0 25-29 37.467200000000005 38.0 38.0 38.0 37.8 38.0 30-34 37.444 38.0 38.0 38.0 37.4 38.0 35-39 37.4168 38.0 38.0 38.0 37.4 38.0 40-44 37.38645 38.0 38.0 38.0 37.0 38.0 45-49 37.41415 38.0 38.0 38.0 37.0 38.0 50-54 37.34255 38.0 38.0 38.0 37.0 38.0 55-59 37.237100000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.1989 38.0 38.0 38.0 37.0 38.0 65-69 37.138999999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.057 38.0 38.0 38.0 36.0 38.0 75-79 37.0532 38.0 38.0 38.0 36.0 38.0 80-84 37.076 38.0 38.0 38.0 36.0 38.0 85-89 37.0212 38.0 38.0 38.0 36.0 38.0 90-94 37.00195 38.0 38.0 38.0 35.8 38.0 95-99 36.84325 38.0 38.0 38.0 35.2 38.0 100-104 36.68600000000001 38.0 38.0 38.0 34.6 38.0 105-109 36.6605 38.0 38.0 38.0 34.4 38.0 110-114 36.6179 38.0 38.0 38.0 34.2 38.0 115-119 36.50605 38.0 38.0 38.0 34.0 38.0 120-124 36.447950000000006 38.0 38.0 38.0 34.0 38.0 125-129 36.383500000000005 38.0 38.0 38.0 34.0 38.0 130-134 36.18470000000001 38.0 37.4 38.0 33.2 38.0 135-139 36.112 38.0 37.2 38.0 33.0 38.0 140-144 35.92985 38.0 36.2 38.0 32.6 38.0 145-149 35.691250000000004 38.0 36.0 38.0 31.0 38.0 150-151 33.846625 37.0 33.5 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 1.0 23 4.0 24 4.0 25 8.0 26 17.0 27 9.0 28 18.0 29 38.0 30 40.0 31 43.0 32 61.0 33 77.0 34 129.0 35 175.0 36 489.0 37 2885.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.217171717171716 11.262626262626263 10.833333333333334 38.686868686868685 2 23.075000000000003 13.8 32.475 30.65 3 20.95 18.175 25.374999999999996 35.5 4 23.175 25.674999999999997 23.799999999999997 27.35 5 22.6 29.875 24.8 22.725 6 19.875 34.725 24.575 20.825 7 14.149999999999999 25.924999999999997 42.3 17.625 8 17.599999999999998 25.45 31.0 25.95 9 16.925 25.474999999999998 34.0 23.599999999999998 10-14 19.705000000000002 29.645 27.605 23.044999999999998 15-19 19.82 27.810000000000002 28.08 24.29 20-24 19.145 28.57 28.42 23.865 25-29 19.53 29.005 27.55 23.915 30-34 19.99 28.29 27.74 23.98 35-39 20.29304395659349 27.94919237885683 27.529129369405407 24.22863429514427 40-44 20.005 28.76 27.384999999999998 23.849999999999998 45-49 19.950000000000003 28.535 27.905 23.61 50-54 19.88 27.884999999999998 28.055000000000003 24.18 55-59 20.485 27.925 27.85 23.74 60-64 19.950000000000003 28.095 27.83 24.125 65-69 20.330000000000002 27.79 27.935 23.945 70-74 19.759999999999998 28.24 27.92 24.08 75-79 20.48 27.639999999999997 28.34 23.54 80-84 20.474999999999998 28.585 27.0 23.94 85-89 20.31 27.950000000000003 28.225 23.515 90-94 20.01 27.83 27.815 24.345 95-99 20.03 27.575 28.255000000000003 24.14 100-104 20.349999999999998 27.485 28.205000000000002 23.96 105-109 20.135 27.72 28.525 23.62 110-114 20.135 28.03 28.165000000000003 23.669999999999998 115-119 20.7 28.494999999999997 27.155 23.65 120-124 20.13 27.900000000000002 27.689999999999998 24.279999999999998 125-129 20.995 27.705000000000002 27.355 23.945 130-134 20.685000000000002 28.255000000000003 27.279999999999998 23.78 135-139 20.155 28.205000000000002 27.57 24.07 140-144 20.82 28.065 27.185 23.93 145-149 20.875 27.865000000000002 27.229999999999997 24.03 150-151 21.1625 28.65 26.2125 23.974999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 2.0 24 1.0 25 2.5 26 6.5 27 6.0 28 9.5 29 14.0 30 17.0 31 22.5 32 28.5 33 38.0 34 49.5 35 63.0 36 81.0 37 103.0 38 128.0 39 158.0 40 174.5 41 216.5 42 268.5 43 267.5 44 245.0 45 247.0 46 269.0 47 276.5 48 247.5 49 204.0 50 165.0 51 140.0 52 124.5 53 99.5 54 73.0 55 47.5 56 41.0 57 38.0 58 30.0 59 20.5 60 14.0 61 14.0 62 10.0 63 9.5 64 7.0 65 2.5 66 2.0 67 2.0 68 1.5 69 2.0 70 1.5 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1625 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.65 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.8 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.2625 0.0 0.0 0.0 0.0 132-133 5.675 0.0 0.0 0.0 0.0 134-135 6.25 0.0 0.0 0.0 0.0 136-137 6.8125 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTTGA 10 0.006832588 144.9875 9 >>END_MODULE SRR7171497 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171497_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.943 33.0 33.0 34.0 32.0 34.0 2 33.034 34.0 33.0 34.0 32.0 34.0 3 33.066 34.0 33.0 34.0 32.0 34.0 4 33.018 34.0 33.0 34.0 32.0 34.0 5 33.05275 34.0 33.0 34.0 32.0 34.0 6 37.07 38.0 38.0 38.0 37.0 38.0 7 37.13775 38.0 38.0 38.0 37.0 38.0 8 37.08025 38.0 38.0 38.0 37.0 38.0 9 37.0595 38.0 38.0 38.0 37.0 38.0 10-14 37.0946 38.0 38.0 38.0 36.8 38.0 15-19 37.06230000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.076 38.0 38.0 38.0 37.0 38.0 25-29 37.04805 38.0 38.0 38.0 36.8 38.0 30-34 37.04735 38.0 38.0 38.0 36.6 38.0 35-39 37.0263 38.0 38.0 38.0 36.6 38.0 40-44 36.441700000000004 37.8 37.4 38.0 33.8 38.0 45-49 36.926750000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.9764 38.0 38.0 38.0 36.0 38.0 55-59 37.00195000000001 38.0 38.0 38.0 36.2 38.0 60-64 36.91029999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.85085 38.0 38.0 38.0 35.8 38.0 70-74 36.855450000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.8313 38.0 38.0 38.0 35.8 38.0 80-84 36.844300000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.733200000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.6496 38.0 38.0 38.0 35.0 38.0 95-99 36.549800000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.40315 38.0 38.0 38.0 34.0 38.0 105-109 36.36675 38.0 38.0 38.0 34.0 38.0 110-114 36.29215 38.0 38.0 38.0 34.0 38.0 115-119 36.239549999999994 38.0 38.0 38.0 33.8 38.0 120-124 36.1168 38.0 37.8 38.0 33.2 38.0 125-129 36.0415 38.0 37.8 38.0 33.0 38.0 130-134 35.820049999999995 38.0 37.0 38.0 31.6 38.0 135-139 35.72135 38.0 36.2 38.0 31.4 38.0 140-144 35.44805 38.0 36.0 38.0 30.4 38.0 145-149 35.18745 38.0 35.8 38.0 28.0 38.0 150-151 32.698875 35.5 30.5 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 4.0 19 3.0 20 8.0 21 8.0 22 12.0 23 13.0 24 15.0 25 17.0 26 25.0 27 23.0 28 25.0 29 34.0 30 41.0 31 54.0 32 64.0 33 86.0 34 133.0 35 190.0 36 430.0 37 2810.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.8 21.8 15.049999999999999 26.35 2 25.46273136568284 28.23911955977989 28.989494747373683 17.30865432716358 3 21.866399799849887 28.67150362772079 29.647235426569928 19.814861145859393 4 23.867900925694272 33.074806104578435 23.867900925694272 19.189392044033024 5 24.337168584292147 36.7183591795898 21.510755377688845 17.433716858429214 6 20.0 38.773466833541924 23.178973717146434 18.04755944931164 7 21.031547320981474 20.95643465197797 38.35753630445669 19.654481722583874 8 20.845845845845844 25.75075075075075 29.02902902902903 24.374374374374376 9 23.510265398097147 25.087631447170754 29.519278918377566 21.88282423635453 10-14 23.59539308963445 29.359038557836755 26.074111166750125 20.971457185778668 15-19 22.804206309464195 28.79819729594392 27.74161241862794 20.655983975963945 20-24 23.466680018024334 28.363290442096833 27.13162769739148 21.03840184248736 25-29 23.802852139104328 28.841631223417565 27.005253940455344 20.350262697022767 30-34 23.758066936815247 28.015408474661065 28.290559807894343 19.935964780629345 35-39 24.199679871948778 28.541416566626648 26.625650260104038 20.63325330132053 40-44 23.6291775065039 29.107464478687213 26.961176706023615 20.302181308785272 45-49 23.62744607377008 28.597167308943494 27.34597867974576 20.429407937540663 50-54 23.630994093502853 28.721593753128445 27.044749224146564 20.60266292922214 55-59 23.68868868868869 28.68868868868869 27.5025025025025 20.12012012012012 60-64 23.57857857857858 27.982982982982985 27.612612612612615 20.825825825825824 65-69 23.77902321857486 27.762209767814248 27.90232185748599 20.5564451561249 70-74 24.283499224728654 28.09983494222978 27.489621367478616 20.127044465562946 75-79 23.50617530876544 28.376418820941048 27.586379318965946 20.531026551327567 80-84 23.925 27.67 27.644999999999996 20.76 85-89 24.192257677303193 28.063419025707713 27.383214964489344 20.36110833249975 90-94 23.8116681677174 27.719403582507756 27.9495646952867 20.519363554488145 95-99 24.00260299344246 28.01721980277319 28.172398257996694 19.807778945787653 100-104 24.299954916595702 28.27731302910384 27.305515203125786 20.117216851174675 105-109 23.869157942193056 27.82146971898011 28.096979411912038 20.212392926914795 110-114 24.55551660239395 27.875995392397456 27.620573947012574 19.947914058196023 115-119 24.21875 28.084935897435898 27.28866185897436 20.407652243589745 120-124 24.350568096501327 28.434856599429402 27.19855848641073 20.016016817658542 125-129 24.708589724348393 28.19550752914103 27.490119565761166 19.605783180749413 130-134 25.157578789394698 28.18409204602301 27.188594297148573 19.469734867433715 135-139 25.07631486763749 27.513386378421657 27.593454436270832 19.816844317670018 140-144 25.282981067815285 28.0777321446459 26.8306120404688 19.808674747070018 145-149 25.806451612903224 27.218994189541174 27.038669605289524 19.935884592266078 150-151 26.37114951164538 28.236914600550968 25.90783871775607 19.484097170047583 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 2.5 27 4.0 28 7.0 29 10.5 30 11.5 31 12.5 32 18.0 33 24.5 34 40.0 35 56.5 36 76.0 37 113.5 38 149.0 39 175.0 40 212.0 41 250.5 42 264.5 43 274.0 44 286.0 45 288.0 46 268.0 47 252.0 48 235.5 49 192.0 50 157.5 51 131.0 52 109.5 53 86.0 54 64.0 55 61.0 56 44.5 57 30.5 58 21.0 59 8.0 60 9.5 61 9.5 62 10.5 63 9.0 64 5.0 65 4.5 66 2.0 67 0.5 68 2.0 69 1.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.075 4 0.075 5 0.05 6 0.125 7 0.15 8 0.1 9 0.15 10-14 0.15 15-19 0.15 20-24 0.135 25-29 0.075 30-34 0.055 35-39 0.04 40-44 0.06 45-49 0.095 50-54 0.11 55-59 0.1 60-64 0.1 65-69 0.08 70-74 0.034999999999999996 75-79 0.005 80-84 0.0 85-89 0.03 90-94 0.06999999999999999 95-99 0.11499999999999999 100-104 0.185 105-109 0.185 110-114 0.165 115-119 0.16 120-124 0.105 125-129 0.055 130-134 0.05 135-139 0.08499999999999999 140-144 0.16999999999999998 145-149 0.18 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 1.05 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.9 0.0 0.0 0.0 0.0 126-127 4.387499999999999 0.0 0.0 0.0 0.0 128-129 4.8625 0.0 0.0 0.0 0.0 130-131 5.3875 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.35 0.0 0.0 0.0 0.0 136-137 6.9125 0.0 0.0 0.0 0.0 138-139 7.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAAAG 10 0.006692141 145.97469 9 CGGCAGC 10 0.006692141 145.97469 8 >>END_MODULE Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790531 spots for SRR7171497.sra Written 790531 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra Read 790513 spots for SRR7171497.sra Written 790513 spots for SRR7171497.sra SRR ids: ['SRR7171497.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0g5q7wa0 SRR7171497.sra spots: 15810278 blocks: [[1, 790513], [790514, 1581026], [1581027, 2371539], [2371540, 3162052], [3162053, 3952565], [3952566, 4743078], [4743079, 5533591], [5533592, 6324104], [6324105, 7114617], [7114618, 7905130], [7905131, 8695643], [8695644, 9486156], [9486157, 10276669], [10276670, 11067182], [11067183, 11857695], [11857696, 12648208], [12648209, 13438721], [13438722, 14229234], [14229235, 15019747], [15019748, 15810278]] SRR7171497 file size 5335884 SRR7171497 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171497 SRR7171497_1.fastq SRR7171497_2.fastq Input file: SRR7171497_1.fastq Paired file: SRR7171497_2.fastq trimmed: SRR7171497-trimmed-pair1.fastq, SRR7171497-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:37:09 2025 >> started Thu Feb 13 20:37:26 2025 >> done (16.999s) 15810278 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 514 ( 0.00%) empty read pairs filtered out after trimming by size control 15809746 (100.00%) read pairs available; of these: 1861012 (11.77%) trimmed read pairs available after processing 13948734 (88.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 3 0.00% 29 2 0.00% 30 2 0.00% 31 0 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 0 0.00% 36 1 0.00% 37 1 0.00% 38 2 0.00% 39 2 0.00% 40 2 0.00% 41 2 0.00% 42 4 0.00% 43 1 0.00% 44 5 0.00% 45 2 0.00% 46 3 0.00% 47 8 0.00% 48 6 0.00% 49 11 0.00% 50 10 0.00% 51 11 0.00% 52 20 0.00% 53 26 0.00% 54 20 0.00% 55 15 0.00% 56 29 0.00% 57 22 0.00% 58 23 0.00% 59 35 0.00% 60 42 0.00% 61 63 0.00% 62 66 0.00% 63 85 0.00% 64 112 0.00% 65 112 0.00% 66 117 0.00% 67 139 0.00% 68 156 0.00% 69 197 0.00% 70 276 0.00% 71 292 0.00% 72 325 0.00% 73 388 0.00% 74 472 0.00% 75 504 0.00% 76 620 0.00% 77 720 0.00% 78 830 0.01% 79 923 0.01% 80 1069 0.01% 81 1253 0.01% 82 1449 0.01% 83 1644 0.01% 84 1936 0.01% 85 2086 0.01% 86 2353 0.01% 87 2661 0.02% 88 2922 0.02% 89 3222 0.02% 90 3726 0.02% 91 4025 0.03% 92 4662 0.03% 93 5259 0.03% 94 5745 0.04% 95 6195 0.04% 96 7005 0.04% 97 7216 0.05% 98 7985 0.05% 99 8432 0.05% 100 9017 0.06% 101 9549 0.06% 102 10751 0.07% 103 11718 0.07% 104 12464 0.08% 105 13327 0.08% 106 14233 0.09% 107 15017 0.09% 108 15782 0.10% 109 16538 0.10% 110 17111 0.11% 111 18198 0.12% 112 19092 0.12% 113 20407 0.13% 114 21443 0.14% 115 23162 0.15% 116 24475 0.15% 117 26121 0.17% 118 27625 0.17% 119 27224 0.17% 120 27017 0.17% 121 28148 0.18% 122 29371 0.19% 123 30700 0.19% 124 32696 0.21% 125 33831 0.21% 126 34764 0.22% 127 36349 0.23% 128 37283 0.24% 129 37971 0.24% 130 39147 0.25% 131 39831 0.25% 132 41210 0.26% 133 42783 0.27% 134 44033 0.28% 135 45360 0.29% 136 46995 0.30% 137 47927 0.30% 138 49109 0.31% 139 49974 0.32% 140 51224 0.32% 141 53220 0.34% 142 55578 0.35% 143 54929 0.35% 144 60822 0.38% 145 59903 0.38% 146 58900 0.37% 147 60991 0.39% 148 61964 0.39% 149 61578 0.39% 150 66589 0.42% 151 13948734 88.23% 15809746 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=25 prefix-density=0.58 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=23.01 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.4 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=27 prefix-density=0.51 prefix-fanout=2.5 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=33.93 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=12.3 sequence=GAGAAGGCAATGAGAGATGC SRR7171497 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:38:17 Started mapping on | Feb 13 20:38:17 Finished on | Feb 13 20:41:03 Mapping speed, Million of reads per hour | 342.86 Number of input reads | 15809746 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14437487 Uniquely mapped reads % | 91.32% Average mapped length | 295.80 Number of splices: Total | 13924267 Number of splices: Annotated (sjdb) | 13610719 Number of splices: GT/AG | 13697881 Number of splices: GC/AG | 176287 Number of splices: AT/AC | 10777 Number of splices: Non-canonical | 39322 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364955 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 77369 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.73% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1007304 1007304 1007304 N_multimapping 364955 364955 364955 N_noFeature 409184 14309600 458296 N_ambiguous 153650 570 74776 UnstrandedReadsAssigned:13874653 PositiveStrandReadsAssigned:127317 NegativeStrandReadsAssigned:13904415 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171497 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171497-trimmed-pair1.fastq SRR7171497-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,809,746 reads, 13,956,338 reads pseudoaligned [quant] estimated average fragment length: 228.568 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR7171497.ke.tsv 34699 SRR7171497.se.tsv 87100 total ==> SRR7171497.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.43 1284.55 48.8403 Potri.005G024800.1.v4.1 1035 807.432 861 72.5908 Potri.004G059700.1.v4.1 961 733.436 19 1.7635 Potri.007G009000.2.v4.1 1416 1188.43 0 0 Potri.003G141000.2.v4.1 2943 2715.43 868 21.7603 Potri.016G087400.1.v4.1 270 81.976 1399 1161.76 Potri.015G069301.1.v4.1 564 338.984 0 0 Potri.010G195200.1.v4.1 1773 1545.43 586 25.8126 Potri.012G127500.1.v4.1 977 749.432 7298 662.912 ==> SRR7171497.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 57 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 363 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 114 SRR7171497 completed mapping pipeline successfully