Starting /dee2/code/volunteer_pipeline.sh SRR7171498 current disk space = 3087972917248 free memory = 1574211060 SRR7171498 SRAfilesize 4d31ab2743df33f1128431b41831a992 SRR7171498.sra SRR7171498.sra file validated SRR7171498 is paired end SRR7171498 is conventional basespace SRR7171498 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171498_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13475 34.0 33.0 34.0 33.0 34.0 2 33.33625 34.0 33.0 34.0 33.0 34.0 3 33.20475 34.0 33.0 34.0 31.0 34.0 4 33.40725 34.0 33.0 34.0 33.0 34.0 5 33.42025 34.0 33.0 34.0 33.0 34.0 6 37.10225 38.0 37.0 38.0 36.0 38.0 7 37.47125 38.0 38.0 38.0 37.0 38.0 8 37.552 38.0 38.0 38.0 38.0 38.0 9 37.62325 38.0 38.0 38.0 38.0 38.0 10-14 37.58875 38.0 38.0 38.0 38.0 38.0 15-19 37.5178 38.0 38.0 38.0 38.0 38.0 20-24 37.443200000000004 38.0 38.0 38.0 37.4 38.0 25-29 37.45819999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.512249999999995 38.0 38.0 38.0 38.0 38.0 35-39 36.3585 38.0 37.6 38.0 32.0 38.0 40-44 37.091 38.0 38.0 38.0 34.6 38.0 45-49 37.4418 38.0 38.0 38.0 37.0 38.0 50-54 37.31915 38.0 38.0 38.0 36.8 38.0 55-59 37.22725 38.0 38.0 38.0 37.0 38.0 60-64 37.2503 38.0 38.0 38.0 37.0 38.0 65-69 37.24765 38.0 38.0 38.0 37.0 38.0 70-74 34.57225 33.6 33.6 37.8 32.2 38.0 75-79 35.242599999999996 36.2 35.0 38.0 32.0 38.0 80-84 37.12165 38.0 38.0 38.0 36.0 38.0 85-89 37.149100000000004 38.0 38.0 38.0 36.0 38.0 90-94 37.1091 38.0 38.0 38.0 36.0 38.0 95-99 37.044799999999995 38.0 38.0 38.0 36.0 38.0 100-104 36.9616 38.0 38.0 38.0 35.6 38.0 105-109 36.8249 38.0 38.0 38.0 34.8 38.0 110-114 36.6893 38.0 38.0 38.0 34.8 38.0 115-119 36.556200000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.39555 38.0 38.0 38.0 34.0 38.0 125-129 36.2725 38.0 37.8 38.0 33.6 38.0 130-134 36.0818 38.0 37.2 38.0 33.0 38.0 135-139 36.176300000000005 38.0 37.4 38.0 33.0 38.0 140-144 36.0732 38.0 36.8 38.0 33.0 38.0 145-149 35.899249999999995 38.0 36.0 38.0 32.8 38.0 150-151 33.520250000000004 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 1.0 23 3.0 24 3.0 25 13.0 26 5.0 27 11.0 28 23.0 29 31.0 30 36.0 31 53.0 32 60.0 33 83.0 34 136.0 35 201.0 36 624.0 37 2714.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.582809751193764 11.435033928122644 9.72606182457904 39.25609449610455 2 20.8 15.299999999999999 35.85 28.050000000000004 3 20.175 17.849999999999998 26.05 35.925000000000004 4 23.625 27.800000000000004 22.325 26.25 5 22.6 31.4 24.775 21.224999999999998 6 19.15 34.4 25.275 21.175 7 14.674999999999999 25.3 42.375 17.65 8 18.325 24.825 32.6 24.25 9 17.65 24.3 33.975 24.075 10-14 19.74 29.505 27.935 22.82 15-19 19.66 28.449999999999996 28.115000000000002 23.775 20-24 19.52 28.785 28.17 23.525 25-29 19.500975048752437 28.7864393219661 27.946397319865994 23.76618830941547 30-34 19.48194819481948 28.79287928792879 28.052805280528055 23.672367236723673 35-39 19.639909977494373 29.50237559389847 27.216804201050266 23.640910227556887 40-44 19.68098404920246 28.451422571128553 28.001400070003502 23.866193309665483 45-49 19.44291643746562 28.064209631444715 28.159223883582534 24.333650047507128 50-54 19.505975298764938 28.911445572278616 28.356417820891046 23.226161308065404 55-59 20.105 28.73 27.345000000000002 23.82 60-64 19.915 28.275 28.27 23.54 65-69 19.725 27.965 28.139999999999997 24.169999999999998 70-74 20.765 29.125 26.365 23.745 75-79 19.93 28.71 27.894999999999996 23.465 80-84 20.195 28.17 27.944999999999997 23.69 85-89 20.02 28.299999999999997 28.225 23.455000000000002 90-94 19.955000000000002 28.895 27.42 23.73 95-99 20.415 28.455000000000002 27.800000000000004 23.330000000000002 100-104 20.04 28.68 27.815 23.465 105-109 20.07 28.83 27.555000000000003 23.544999999999998 110-114 20.455000000000002 28.720000000000002 27.67 23.155 115-119 20.419999999999998 28.24 28.035 23.305 120-124 20.52 28.415000000000003 27.565 23.5 125-129 20.54 28.325 27.46 23.674999999999997 130-134 20.695 28.59 26.93 23.785 135-139 20.825 28.634999999999998 26.834999999999997 23.705000000000002 140-144 21.44 27.950000000000003 26.77 23.84 145-149 21.215 28.470000000000002 26.740000000000002 23.575 150-151 20.8125 28.349999999999998 26.4625 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 1.0 26 1.5 27 3.0 28 7.5 29 9.0 30 12.0 31 19.0 32 28.0 33 41.5 34 61.5 35 84.5 36 104.5 37 121.0 38 136.5 39 161.0 40 196.0 41 241.5 42 252.5 43 251.5 44 275.0 45 289.0 46 283.5 47 254.5 48 227.5 49 204.0 50 165.5 51 129.0 52 108.0 53 86.0 54 59.5 55 45.0 56 36.0 57 26.5 58 19.5 59 14.0 60 11.0 61 9.0 62 5.5 63 3.5 64 3.5 65 1.5 66 1.5 67 2.5 68 2.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.01 35-39 0.025 40-44 0.005 45-49 0.015 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8496993987976 99.65 2 0.1002004008016032 0.2 3 0.0501002004008016 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.7875 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.862500000000001 0.0 0.0 0.0 0.0 130-131 6.425000000000001 0.0 0.0 0.0 0.0 132-133 6.9875 0.0 0.0 0.0 0.0 134-135 7.675000000000001 0.0 0.0 0.0 0.0 136-137 8.375 0.0 0.0 0.0 0.0 138-139 9.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171498 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171498_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99775 33.0 33.0 34.0 32.0 34.0 2 33.0275 34.0 33.0 34.0 32.0 34.0 3 33.10475 34.0 33.0 34.0 32.0 34.0 4 33.126 34.0 33.0 34.0 33.0 34.0 5 33.11275 34.0 33.0 34.0 33.0 34.0 6 37.27375 38.0 38.0 38.0 37.0 38.0 7 37.1435 38.0 38.0 38.0 37.0 38.0 8 37.2605 38.0 38.0 38.0 37.0 38.0 9 37.25225 38.0 38.0 38.0 37.0 38.0 10-14 37.2233 38.0 38.0 38.0 37.0 38.0 15-19 37.219750000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.1693 38.0 38.0 38.0 37.0 38.0 25-29 37.18495 38.0 38.0 38.0 37.0 38.0 30-34 37.1968 38.0 38.0 38.0 37.0 38.0 35-39 37.15725 38.0 38.0 38.0 37.0 38.0 40-44 36.965 38.0 38.0 38.0 36.4 38.0 45-49 37.061749999999996 38.0 38.0 38.0 36.8 38.0 50-54 37.094350000000006 38.0 38.0 38.0 36.8 38.0 55-59 37.02845000000001 38.0 38.0 38.0 36.4 38.0 60-64 37.05955 38.0 38.0 38.0 36.6 38.0 65-69 37.00384999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.9954 38.0 38.0 38.0 36.0 38.0 75-79 36.92915 38.0 38.0 38.0 36.0 38.0 80-84 36.885149999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.892250000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.70395 38.0 38.0 38.0 35.0 38.0 95-99 36.66930000000001 38.0 38.0 38.0 34.8 38.0 100-104 36.57445 38.0 38.0 38.0 34.4 38.0 105-109 36.568949999999994 38.0 38.0 38.0 34.8 38.0 110-114 36.480050000000006 38.0 38.0 38.0 34.2 38.0 115-119 36.3605 38.0 38.0 38.0 34.0 38.0 120-124 36.1438 38.0 38.0 38.0 33.2 38.0 125-129 36.1449 38.0 38.0 38.0 33.2 38.0 130-134 35.9894 38.0 37.6 38.0 33.0 38.0 135-139 35.78425 38.0 36.4 38.0 31.6 38.0 140-144 35.63395 38.0 36.0 38.0 31.0 38.0 145-149 35.3295 38.0 36.0 38.0 30.0 38.0 150-151 32.629625 35.5 30.0 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.0 17 0.0 18 8.0 19 5.0 20 4.0 21 8.0 22 3.0 23 7.0 24 8.0 25 13.0 26 17.0 27 28.0 28 25.0 29 30.0 30 47.0 31 45.0 32 53.0 33 78.0 34 108.0 35 194.0 36 383.0 37 2927.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.63465866466617 20.10502625656414 13.50337584396099 27.7569392348087 2 25.03128911138924 27.108886107634543 30.613266583229038 17.246558197747184 3 20.67067067067067 28.703703703703702 30.805805805805807 19.81981981981982 4 23.178973717146434 34.593241551939926 23.57947434292866 18.64831038798498 5 23.810716074111166 35.90385578367552 23.13470205307962 17.1507260891337 6 20.485850237916353 37.56574004507889 24.04207362885049 17.90633608815427 7 19.459053343350863 20.510894064613073 39.969947407963936 20.06010518407213 8 21.206810215322985 25.062593890836254 28.267401101652478 25.463194792188283 9 22.400400902029567 26.23402655975946 29.19067902781258 22.174893510398398 10-14 23.344528547796884 28.988921750463682 26.3572108877638 21.309338813975636 15-19 23.127819548872182 28.616541353383457 27.724310776942357 20.531328320802007 20-24 23.1520922074668 28.589325983462793 27.56201453269857 20.696567276371837 25-29 23.169387959531203 28.748873084243215 27.306420915556444 20.775318040669138 30-34 23.459632614244956 27.78917863756945 27.899294258971917 20.851894489213674 35-39 23.141570785392695 28.609304652326163 27.613806903451728 20.635317658829415 40-44 23.45845845845846 28.1981981981982 27.767767767767772 20.575575575575574 45-49 22.95788050282967 27.680673110632544 28.60219361947213 20.759252767065657 50-54 23.12625250501002 27.55511022044088 28.612224448897795 20.706412825651302 55-59 22.778084114491953 28.562835229836082 27.745751666750213 20.91332898892175 60-64 23.489596390072702 27.450488844321885 28.002005515166704 21.057909250438705 65-69 23.480787535694606 28.330243975752715 27.904413606532742 20.28455488201994 70-74 23.380197128133286 28.023215089808375 28.123280132085853 20.473307649972483 75-79 23.338500775116266 28.049207381107166 27.904185627844175 20.70810621593239 80-84 23.3023302330233 28.152815281528156 28.127812781278127 20.417041704170416 85-89 23.44937975190076 28.266306522609042 28.061224489795915 20.223089235694278 90-94 23.79593471512967 27.255432061680185 28.421948533093023 20.526684690097127 95-99 23.492858932598345 27.79253319969932 28.358807316462038 20.355800551240293 100-104 23.831494483450353 28.00401203610832 27.933801404212637 20.23069207622869 105-109 23.98596139383304 27.81649536224618 28.418149912258713 19.77939333166207 110-114 23.633263115658544 27.986758952753537 28.107132109539574 20.27284582204835 115-119 23.86181307661452 27.993381468110712 27.822904131568393 20.321901323706378 120-124 24.22481590943245 28.492711516305164 27.34558934027952 19.93688323398287 125-129 24.67838013715773 28.12734644841568 27.49662111428142 19.697652300145165 130-134 25.10636167976375 28.15456229040493 27.583963161319385 19.155112868511935 135-139 25.181585933977857 28.307368631969144 27.250413264539397 19.2606321695136 140-144 25.349852033906807 28.334252896624367 26.9799869589206 19.335908110548228 145-149 25.564249172434543 28.122178754137828 27.22941117464139 19.084160898786237 150-151 26.053159478435305 28.197091273821464 26.37913741223671 19.37061183550652 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.5 27 3.0 28 6.0 29 10.0 30 9.5 31 15.0 32 21.5 33 28.5 34 50.5 35 72.5 36 82.0 37 94.0 38 124.0 39 174.5 40 224.5 41 250.5 42 276.5 43 300.5 44 293.0 45 277.5 46 273.0 47 259.5 48 237.0 49 208.0 50 167.5 51 130.5 52 103.0 53 74.5 54 53.5 55 42.0 56 32.0 57 25.5 58 21.0 59 16.5 60 9.5 61 6.0 62 5.5 63 3.5 64 2.0 65 2.0 66 1.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.125 3 0.1 4 0.125 5 0.15 6 0.17500000000000002 7 0.17500000000000002 8 0.15 9 0.22499999999999998 10-14 0.255 15-19 0.25 20-24 0.22499999999999998 25-29 0.16999999999999998 30-34 0.105 35-39 0.05 40-44 0.1 45-49 0.165 50-54 0.2 55-59 0.255 60-64 0.27499999999999997 65-69 0.19499999999999998 70-74 0.065 75-79 0.015 80-84 0.01 85-89 0.04 90-94 0.13 95-99 0.22499999999999998 100-104 0.3 105-109 0.27499999999999997 110-114 0.31 115-119 0.27999999999999997 120-124 0.185 125-129 0.11499999999999999 130-134 0.105 135-139 0.185 140-144 0.315 145-149 0.31 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.037500000000000006 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.1125 0.0 0.0 0.025 0.0 90-91 0.275 0.0 0.0 0.025 0.0 92-93 0.3625 0.0 0.0 0.025 0.0 94-95 0.425 0.0 0.0 0.025 0.0 96-97 0.475 0.0 0.0 0.025 0.0 98-99 0.5375000000000001 0.0 0.0 0.025 0.0 100-101 0.7250000000000001 0.0 0.0 0.025 0.0 102-103 0.9125 0.0 0.0 0.025 0.0 104-105 1.2625 0.0 0.0 0.025 0.0 106-107 1.3625 0.0 0.0 0.025 0.0 108-109 1.5875 0.0 0.0 0.025 0.0 110-111 1.85 0.0 0.0 0.025 0.0 112-113 2.0875 0.0 0.0 0.025 0.0 114-115 2.5 0.0 0.0 0.025 0.0 116-117 3.0625 0.0 0.0 0.025 0.0 118-119 3.3875 0.0 0.0 0.025 0.0 120-121 3.8375000000000004 0.0 0.0 0.025 0.0 122-123 4.2375 0.0 0.0 0.025 0.0 124-125 4.7125 0.0 0.0 0.025 0.0 126-127 5.25 0.0 0.0 0.025 0.0 128-129 5.85 0.0 0.0 0.025 0.0 130-131 6.425000000000001 0.0 0.0 0.025 0.0 132-133 6.9625 0.0 0.0 0.025 0.0 134-135 7.575 0.0 0.0 0.025 0.0 136-137 8.25 0.0 0.0 0.025 0.0 138-139 8.9875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAGGC 10 0.006830828 145.0 8 >>END_MODULE Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811453 spots for SRR7171498.sra Written 811453 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra Read 811447 spots for SRR7171498.sra Written 811447 spots for SRR7171498.sra SRR ids: ['SRR7171498.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4kzempew SRR7171498.sra spots: 16228946 blocks: [[1, 811447], [811448, 1622894], [1622895, 2434341], [2434342, 3245788], [3245789, 4057235], [4057236, 4868682], [4868683, 5680129], [5680130, 6491576], [6491577, 7303023], [7303024, 8114470], [8114471, 8925917], [8925918, 9737364], [9737365, 10548811], [10548812, 11360258], [11360259, 12171705], [12171706, 12983152], [12983153, 13794599], [13794600, 14606046], [14606047, 15417493], [15417494, 16228946]] SRR7171498 file size 5477756 SRR7171498 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171498 SRR7171498_1.fastq SRR7171498_2.fastq Input file: SRR7171498_1.fastq Paired file: SRR7171498_2.fastq trimmed: SRR7171498-trimmed-pair1.fastq, SRR7171498-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:52:18 2025 >> started Thu Feb 13 20:52:36 2025 >> done (17.104s) 16228946 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 933 ( 0.01%) empty read pairs filtered out after trimming by size control 16227985 (99.99%) read pairs available; of these: 2469185 (15.22%) trimmed read pairs available after processing 13758800 (84.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 4 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 2 0.00% 31 2 0.00% 32 3 0.00% 33 2 0.00% 34 0 0.00% 35 2 0.00% 36 5 0.00% 37 2 0.00% 38 1 0.00% 39 4 0.00% 40 15 0.00% 41 7 0.00% 42 6 0.00% 43 4 0.00% 44 8 0.00% 45 7 0.00% 46 9 0.00% 47 14 0.00% 48 18 0.00% 49 25 0.00% 50 26 0.00% 51 27 0.00% 52 29 0.00% 53 26 0.00% 54 39 0.00% 55 54 0.00% 56 50 0.00% 57 57 0.00% 58 76 0.00% 59 70 0.00% 60 97 0.00% 61 127 0.00% 62 151 0.00% 63 149 0.00% 64 173 0.00% 65 236 0.00% 66 226 0.00% 67 267 0.00% 68 321 0.00% 69 394 0.00% 70 476 0.00% 71 557 0.00% 72 675 0.00% 73 786 0.00% 74 853 0.01% 75 969 0.01% 76 1150 0.01% 77 1250 0.01% 78 1487 0.01% 79 1661 0.01% 80 1909 0.01% 81 2161 0.01% 82 2623 0.02% 83 3027 0.02% 84 3345 0.02% 85 3807 0.02% 86 4173 0.03% 87 4590 0.03% 88 5055 0.03% 89 5562 0.03% 90 6177 0.04% 91 6754 0.04% 92 7837 0.05% 93 8484 0.05% 94 9525 0.06% 95 10262 0.06% 96 11022 0.07% 97 11917 0.07% 98 12643 0.08% 99 13416 0.08% 100 14648 0.09% 101 15530 0.10% 102 16982 0.10% 103 18337 0.11% 104 19632 0.12% 105 20725 0.13% 106 22080 0.14% 107 22698 0.14% 108 23785 0.15% 109 24622 0.15% 110 25508 0.16% 111 27041 0.17% 112 28292 0.17% 113 30042 0.19% 114 31892 0.20% 115 33905 0.21% 116 35528 0.22% 117 38633 0.24% 118 40465 0.25% 119 38816 0.24% 120 38091 0.23% 121 39470 0.24% 122 41133 0.25% 123 42742 0.26% 124 44400 0.27% 125 45725 0.28% 126 47781 0.29% 127 48777 0.30% 128 49117 0.30% 129 49546 0.31% 130 50398 0.31% 131 52066 0.32% 132 53522 0.33% 133 55028 0.34% 134 56395 0.35% 135 58318 0.36% 136 59641 0.37% 137 60870 0.38% 138 61516 0.38% 139 62093 0.38% 140 63004 0.39% 141 68126 0.42% 142 67773 0.42% 143 70430 0.43% 144 70540 0.43% 145 72814 0.45% 146 69877 0.43% 147 71308 0.44% 148 74245 0.46% 149 71704 0.44% 150 76678 0.47% 151 13758800 84.78% 16227985 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.12 fanout-score-rank=20 prefix-density=0.34 prefix-fanout=3.5 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=69.02 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.8 sequence=CAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACTTG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.39 fanout-score-rank=19 prefix-density=0.48 prefix-fanout=3.6 sequence=TGCAAGTGCGGCAGTGGCTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=121.22 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=12.3 sequence=AGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATC SRR7171498 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:53:18 Started mapping on | Feb 13 20:53:18 Finished on | Feb 13 20:55:01 Mapping speed, Million of reads per hour | 567.19 Number of input reads | 16227985 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15251874 Uniquely mapped reads % | 93.99% Average mapped length | 293.91 Number of splices: Total | 14411116 Number of splices: Annotated (sjdb) | 14099043 Number of splices: GT/AG | 14169875 Number of splices: GC/AG | 185977 Number of splices: AT/AC | 11638 Number of splices: Non-canonical | 43626 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 378839 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 65295 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 597272 597272 597272 N_multimapping 378839 378839 378839 N_noFeature 461327 15105665 515458 N_ambiguous 168036 945 75523 UnstrandedReadsAssigned:14622511 PositiveStrandReadsAssigned:145264 NegativeStrandReadsAssigned:14660893 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171498 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171498-trimmed-pair1.fastq SRR7171498-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,227,985 reads, 14,722,683 reads pseudoaligned [quant] estimated average fragment length: 219.551 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,241 rounds 52401 SRR7171498.ke.tsv 34699 SRR7171498.se.tsv 87100 total ==> SRR7171498.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.45 1079 40.7157 Potri.005G024800.1.v4.1 1035 816.449 160 13.3067 Potri.004G059700.1.v4.1 961 742.454 39 3.56677 Potri.007G009000.2.v4.1 1416 1197.45 0 0 Potri.003G141000.2.v4.1 2943 2724.45 638.616 15.9163 Potri.016G087400.1.v4.1 270 87.7009 1348 1043.68 Potri.015G069301.1.v4.1 564 347.637 0 0 Potri.010G195200.1.v4.1 1773 1554.45 394 17.2107 Potri.012G127500.1.v4.1 977 758.454 6140 549.691 ==> SRR7171498.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 182 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 537 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 226 SRR7171498 completed mapping pipeline successfully