Starting /dee2/code/volunteer_pipeline.sh SRR7171499 current disk space = 3087755436032 free memory = 1466490408 SRR7171499 SRAfilesize 5b78fec83ed2598a32fc87edecfaaa7a SRR7171499.sra SRR7171499.sra file validated SRR7171499 is paired end SRR7171499 is conventional basespace SRR7171499 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171499_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.14275 33.0 33.0 34.0 31.0 34.0 2 32.78675 33.0 33.0 34.0 31.0 34.0 3 31.9005 33.0 31.0 33.0 28.0 34.0 4 32.01025 33.0 32.0 33.0 31.0 34.0 5 32.2035 33.0 33.0 33.0 31.0 34.0 6 35.939 37.0 36.0 38.0 33.0 38.0 7 36.773 38.0 37.0 38.0 34.0 38.0 8 36.91875 38.0 38.0 38.0 35.0 38.0 9 37.371 38.0 38.0 38.0 36.0 38.0 10-14 37.47895 38.0 38.0 38.0 37.0 38.0 15-19 37.49974999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.5561 38.0 38.0 38.0 37.4 38.0 25-29 37.50840000000001 38.0 38.0 38.0 37.6 38.0 30-34 37.53085 38.0 38.0 38.0 37.8 38.0 35-39 37.51039999999999 38.0 38.0 38.0 37.2 38.0 40-44 37.50835 38.0 38.0 38.0 37.4 38.0 45-49 37.47695 38.0 38.0 38.0 37.0 38.0 50-54 37.4295 38.0 38.0 38.0 37.0 38.0 55-59 37.3673 38.0 38.0 38.0 37.0 38.0 60-64 37.3382 38.0 38.0 38.0 37.0 38.0 65-69 37.31915 38.0 38.0 38.0 37.0 38.0 70-74 37.2787 38.0 38.0 38.0 36.6 38.0 75-79 37.211 38.0 38.0 38.0 36.0 38.0 80-84 37.122749999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.07625 38.0 38.0 38.0 36.0 38.0 90-94 37.032450000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.883950000000006 38.0 38.0 38.0 35.2 38.0 100-104 36.8392 38.0 38.0 38.0 34.8 38.0 105-109 36.717400000000005 38.0 38.0 38.0 34.8 38.0 110-114 36.68535000000001 38.0 38.0 38.0 34.6 38.0 115-119 36.49495 38.0 38.0 38.0 34.0 38.0 120-124 36.42210000000001 38.0 37.8 38.0 34.0 38.0 125-129 36.298 38.0 37.2 38.0 33.6 38.0 130-134 36.1935 38.0 37.0 38.0 33.2 38.0 135-139 36.05929999999999 38.0 36.0 38.0 33.0 38.0 140-144 35.8123 38.0 36.0 38.0 32.2 38.0 145-149 35.55315 38.0 36.0 38.0 30.6 38.0 150-151 33.591125000000005 36.5 32.0 38.0 21.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 3.0 25 7.0 26 3.0 27 12.0 28 20.0 29 17.0 30 30.0 31 48.0 32 54.0 33 62.0 34 126.0 35 254.0 36 618.0 37 2743.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.32077474131069 11.912974263730433 10.16184664367206 38.60440435128682 2 21.25 13.825000000000001 34.599999999999994 30.325000000000003 3 21.8 18.725 24.6 34.875 4 23.525 27.575 23.525 25.374999999999996 5 23.275000000000002 30.725 24.375 21.625 6 18.975 34.425 25.924999999999997 20.674999999999997 7 14.549999999999999 25.05 41.475 18.925 8 18.95 25.224999999999998 30.5 25.324999999999996 9 17.65 23.474999999999998 35.125 23.75 10-14 19.845 28.93 27.889999999999997 23.335 15-19 19.42 28.425 28.24 23.915 20-24 20.395 28.22 27.605 23.78 25-29 19.62 28.999999999999996 27.389999999999997 23.990000000000002 30-34 19.475 28.775000000000002 27.98 23.77 35-39 20.02 27.88 27.865000000000002 24.235 40-44 20.349999999999998 28.560000000000002 27.47 23.62 45-49 20.21 28.42 27.855 23.515 50-54 20.34 27.894999999999996 27.575 24.19 55-59 19.825 28.105000000000004 28.299999999999997 23.77 60-64 20.385 27.855 27.98 23.78 65-69 20.28 27.97 27.565 24.185000000000002 70-74 20.29 28.865000000000002 27.634999999999998 23.21 75-79 20.135 28.62 27.68 23.565 80-84 20.71 28.17 27.13 23.990000000000002 85-89 20.405 28.255000000000003 27.950000000000003 23.39 90-94 20.544999999999998 28.4 27.33 23.724999999999998 95-99 20.86 29.035 26.995 23.11 100-104 20.735 28.125 27.37 23.77 105-109 21.279999999999998 28.38 26.965 23.375 110-114 21.235 27.96 27.815 22.99 115-119 20.405 28.485 27.175 23.935000000000002 120-124 21.07 28.33 27.025 23.575 125-129 21.095 27.860000000000003 27.37 23.674999999999997 130-134 20.93 28.08 27.500000000000004 23.49 135-139 20.96 27.744999999999997 26.865 24.43 140-144 20.86 27.74 27.134999999999998 24.265 145-149 20.8 28.17 26.419999999999998 24.610000000000003 150-151 20.952619077384675 27.990998874859358 26.103262907863485 24.953119139892486 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.0 25 1.5 26 2.5 27 5.0 28 6.5 29 12.0 30 17.5 31 24.0 32 27.5 33 29.5 34 43.5 35 59.0 36 73.0 37 103.5 38 126.0 39 156.5 40 194.0 41 227.5 42 251.0 43 268.0 44 296.0 45 299.5 46 283.0 47 253.5 48 218.0 49 194.0 50 177.5 51 146.0 52 113.0 53 91.0 54 71.5 55 51.0 56 40.0 57 37.0 58 29.5 59 18.5 60 12.5 61 8.5 62 6.0 63 6.5 64 4.0 65 1.5 66 1.0 67 0.5 68 0.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.4 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.6 0.0 0.0 0.0 0.0 120-121 4.075 0.0 0.0 0.0 0.0 122-123 4.637499999999999 0.0 0.0 0.0 0.0 124-125 5.125 0.0 0.0 0.0 0.0 126-127 5.75 0.0 0.0 0.0 0.0 128-129 6.300000000000001 0.0 0.0 0.0 0.0 130-131 6.725 0.0 0.0 0.0 0.0 132-133 7.3625 0.0 0.0 0.0 0.0 134-135 7.85 0.0 0.0 0.0 0.0 136-137 8.337499999999999 0.0 0.0 0.0 0.0 138-139 9.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTTAA 10 0.0060887975 150.61038 1 AAAAAAA 95 0.0072921216 10.681448 25-29 >>END_MODULE SRR7171499 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171499_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.069 33.0 33.0 34.0 32.0 34.0 2 33.1465 34.0 33.0 34.0 33.0 34.0 3 33.1745 34.0 33.0 34.0 33.0 34.0 4 33.16775 34.0 33.0 34.0 33.0 34.0 5 33.17825 34.0 33.0 34.0 33.0 34.0 6 37.38625 38.0 38.0 38.0 37.0 38.0 7 37.40325 38.0 38.0 38.0 37.0 38.0 8 37.417 38.0 38.0 38.0 38.0 38.0 9 37.316 38.0 38.0 38.0 37.0 38.0 10-14 37.2466 38.0 38.0 38.0 36.8 38.0 15-19 37.33 38.0 38.0 38.0 37.0 38.0 20-24 37.2917 38.0 38.0 38.0 37.0 38.0 25-29 37.2562 38.0 38.0 38.0 37.0 38.0 30-34 37.263799999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.2298 38.0 38.0 38.0 36.8 38.0 40-44 37.236000000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2056 38.0 38.0 38.0 37.0 38.0 50-54 37.13955 38.0 38.0 38.0 36.4 38.0 55-59 37.1182 38.0 38.0 38.0 36.2 38.0 60-64 37.02125 38.0 38.0 38.0 36.0 38.0 65-69 37.024 38.0 38.0 38.0 36.0 38.0 70-74 36.96705 38.0 38.0 38.0 36.0 38.0 75-79 36.9009 38.0 38.0 38.0 35.6 38.0 80-84 36.8721 38.0 38.0 38.0 35.6 38.0 85-89 36.72935 38.0 38.0 38.0 34.8 38.0 90-94 36.6281 38.0 38.0 38.0 34.2 38.0 95-99 36.58825 38.0 38.0 38.0 34.2 38.0 100-104 36.418850000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.3617 38.0 38.0 38.0 34.0 38.0 110-114 36.12425 38.0 37.0 38.0 33.0 38.0 115-119 35.88505 38.0 37.0 38.0 31.4 38.0 120-124 35.82950000000001 38.0 36.8 38.0 31.0 38.0 125-129 35.68285 38.0 36.0 38.0 31.0 38.0 130-134 35.3742 38.0 36.0 38.0 29.0 38.0 135-139 34.9854 38.0 35.2 38.0 27.2 38.0 140-144 34.74575 38.0 35.0 38.0 25.2 38.0 145-149 34.36065 38.0 33.8 38.0 23.4 38.0 150-151 31.48175 35.5 27.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 5.0 18 3.0 19 5.0 20 4.0 21 4.0 22 4.0 23 3.0 24 10.0 25 11.0 26 15.0 27 15.0 28 24.0 29 25.0 30 48.0 31 51.0 32 79.0 33 98.0 34 161.0 35 261.0 36 649.0 37 2520.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 20.325 15.6 25.45 2 25.95 26.275 30.075000000000003 17.7 3 20.125 29.65 29.625 20.599999999999998 4 24.8 32.975 23.225 19.0 5 24.25 34.65 23.075000000000003 18.025 6 21.575 36.8 23.825 17.8 7 19.425 21.125 38.7 20.75 8 23.075000000000003 23.7 27.975 25.25 9 20.925 26.6 28.825 23.65 10-14 23.544999999999998 28.435 25.765 22.255 15-19 23.535 28.025 27.205000000000002 21.235 20-24 23.630000000000003 28.68 26.884999999999998 20.805 25-29 23.515 28.09 27.93 20.465 30-34 23.18 28.48 27.445000000000004 20.895 35-39 23.169999999999998 28.76 27.235 20.835 40-44 23.895 27.834999999999997 27.215 21.055 45-49 23.51 28.084999999999997 27.43 20.974999999999998 50-54 23.585 27.74 28.025 20.65 55-59 23.025000000000002 28.060000000000002 28.000000000000004 20.915 60-64 22.91 27.650000000000002 28.415000000000003 21.025 65-69 23.435 28.634999999999998 27.875 20.055 70-74 23.985 27.839999999999996 27.725 20.45 75-79 23.385 28.075 27.865000000000002 20.674999999999997 80-84 23.125 27.765 27.925 21.185000000000002 85-89 24.3 27.985 27.05 20.665 90-94 23.669999999999998 27.705000000000002 27.655 20.97 95-99 23.62 28.12 27.6 20.66 100-104 24.13 27.765 27.565 20.54 105-109 23.96 27.500000000000004 27.800000000000004 20.74 110-114 24.035 28.044999999999998 27.62 20.3 115-119 24.45 28.084999999999997 27.01 20.455000000000002 120-124 24.490000000000002 28.299999999999997 26.68 20.53 125-129 24.435000000000002 28.025 27.339999999999996 20.200000000000003 130-134 24.959999999999997 27.675 27.175 20.19 135-139 24.855 28.235 27.315 19.595000000000002 140-144 24.88 27.605 27.495000000000005 20.02 145-149 25.935000000000002 27.21 27.195000000000004 19.66 150-151 25.825 26.674999999999997 27.8375 19.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 1.0 25 1.5 26 3.0 27 5.0 28 5.0 29 4.0 30 6.0 31 8.0 32 13.5 33 19.5 34 29.0 35 48.0 36 69.0 37 102.5 38 127.5 39 164.0 40 194.0 41 224.5 42 277.5 43 311.5 44 314.0 45 294.0 46 297.5 47 275.5 48 222.0 49 199.5 50 172.5 51 135.0 52 113.5 53 85.0 54 62.0 55 55.0 56 45.5 57 28.0 58 16.0 59 15.5 60 12.0 61 8.0 62 6.5 63 4.5 64 5.5 65 5.0 66 2.5 67 2.0 68 1.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.35 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.15 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 4.075 0.0 0.0 0.0 0.0 122-123 4.637499999999999 0.0 0.0 0.0 0.0 124-125 5.125 0.0 0.0 0.0 0.0 126-127 5.75 0.0 0.0 0.0 0.0 128-129 6.25 0.0 0.0 0.0 0.0 130-131 6.637499999999999 0.0 0.0 0.0 0.0 132-133 7.25 0.0 0.0 0.0 0.0 134-135 7.725 0.0 0.0 0.0 0.0 136-137 8.212499999999999 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCAA 10 0.006830828 145.0 2 AACCAAA 10 0.006830828 145.0 3 TCATCTG 10 0.006830828 145.0 8 >>END_MODULE Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894576 spots for SRR7171499.sra Written 894576 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra Read 894557 spots for SRR7171499.sra Written 894557 spots for SRR7171499.sra SRR ids: ['SRR7171499.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k_ctq_qj SRR7171499.sra spots: 17891159 blocks: [[1, 894557], [894558, 1789114], [1789115, 2683671], [2683672, 3578228], [3578229, 4472785], [4472786, 5367342], [5367343, 6261899], [6261900, 7156456], [7156457, 8051013], [8051014, 8945570], [8945571, 9840127], [9840128, 10734684], [10734685, 11629241], [11629242, 12523798], [12523799, 13418355], [13418356, 14312912], [14312913, 15207469], [15207470, 16102026], [16102027, 16996583], [16996584, 17891159]] SRR7171499 file size 6041026 SRR7171499 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171499 SRR7171499_1.fastq SRR7171499_2.fastq Input file: SRR7171499_1.fastq Paired file: SRR7171499_2.fastq trimmed: SRR7171499-trimmed-pair1.fastq, SRR7171499-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:38:13 2025 >> started Thu Feb 13 20:38:34 2025 >> done (20.688s) 17891159 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 1684 ( 0.01%) empty read pairs filtered out after trimming by size control 17889447 (99.99%) read pairs available; of these: 2772968 (15.50%) trimmed read pairs available after processing 15116479 (84.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 0 0.00% 30 2 0.00% 31 1 0.00% 32 5 0.00% 33 8 0.00% 34 4 0.00% 35 6 0.00% 36 3 0.00% 37 1 0.00% 38 5 0.00% 39 8 0.00% 40 5 0.00% 41 8 0.00% 42 8 0.00% 43 7 0.00% 44 9 0.00% 45 9 0.00% 46 5 0.00% 47 15 0.00% 48 16 0.00% 49 19 0.00% 50 28 0.00% 51 34 0.00% 52 46 0.00% 53 56 0.00% 54 57 0.00% 55 77 0.00% 56 83 0.00% 57 93 0.00% 58 107 0.00% 59 122 0.00% 60 131 0.00% 61 179 0.00% 62 211 0.00% 63 246 0.00% 64 289 0.00% 65 322 0.00% 66 376 0.00% 67 433 0.00% 68 496 0.00% 69 607 0.00% 70 746 0.00% 71 807 0.00% 72 1036 0.01% 73 1188 0.01% 74 1383 0.01% 75 1606 0.01% 76 1794 0.01% 77 1934 0.01% 78 2255 0.01% 79 2509 0.01% 80 2727 0.02% 81 3333 0.02% 82 3761 0.02% 83 4225 0.02% 84 4829 0.03% 85 5455 0.03% 86 5832 0.03% 87 6432 0.04% 88 7177 0.04% 89 7766 0.04% 90 8430 0.05% 91 9183 0.05% 92 10460 0.06% 93 11499 0.06% 94 12715 0.07% 95 13830 0.08% 96 14401 0.08% 97 14797 0.08% 98 15954 0.09% 99 16835 0.09% 100 18162 0.10% 101 19429 0.11% 102 20862 0.12% 103 22269 0.12% 104 23596 0.13% 105 24945 0.14% 106 26050 0.15% 107 26716 0.15% 108 28214 0.16% 109 29042 0.16% 110 29984 0.17% 111 31237 0.17% 112 32758 0.18% 113 34608 0.19% 114 36666 0.20% 115 38920 0.22% 116 39152 0.22% 117 40650 0.23% 118 41460 0.23% 119 42407 0.24% 120 42589 0.24% 121 44488 0.25% 122 46782 0.26% 123 48221 0.27% 124 50100 0.28% 125 51826 0.29% 126 53452 0.30% 127 54228 0.30% 128 54895 0.31% 129 55894 0.31% 130 56243 0.31% 131 57679 0.32% 132 59874 0.33% 133 60851 0.34% 134 62719 0.35% 135 65095 0.36% 136 66756 0.37% 137 67109 0.38% 138 67750 0.38% 139 69010 0.39% 140 68608 0.38% 141 70437 0.39% 142 71833 0.40% 143 72950 0.41% 144 75130 0.42% 145 76978 0.43% 146 77448 0.43% 147 78579 0.44% 148 79685 0.45% 149 78773 0.44% 150 80806 0.45% 151 15116479 84.50% 17889447 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=19 prefix-density=0.49 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=10.53 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=3.5 sequence=TCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=22 prefix-density=0.42 prefix-fanout=2.8 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=35.20 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=10.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171499 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:39:28 Started mapping on | Feb 13 20:39:29 Finished on | Feb 13 20:42:09 Mapping speed, Million of reads per hour | 402.51 Number of input reads | 17889447 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16433548 Uniquely mapped reads % | 91.86% Average mapped length | 293.59 Number of splices: Total | 16408256 Number of splices: Annotated (sjdb) | 16098873 Number of splices: GT/AG | 16146403 Number of splices: GC/AG | 208519 Number of splices: AT/AC | 11928 Number of splices: Non-canonical | 41406 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409062 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 75347 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.32% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1046837 1046837 1046837 N_multimapping 409062 409062 409062 N_noFeature 393286 16285211 447255 N_ambiguous 171883 919 76924 UnstrandedReadsAssigned:15868379 PositiveStrandReadsAssigned:147418 NegativeStrandReadsAssigned:15909369 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171499 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171499-trimmed-pair1.fastq SRR7171499-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,889,447 reads, 15,929,311 reads pseudoaligned [quant] estimated average fragment length: 216.493 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR7171499.ke.tsv 34699 SRR7171499.se.tsv 87100 total ==> SRR7171499.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.51 1449 49.6118 Potri.005G024800.1.v4.1 1035 819.507 262 19.7307 Potri.004G059700.1.v4.1 961 745.517 29 2.40068 Potri.007G009000.2.v4.1 1416 1200.51 0 0 Potri.003G141000.2.v4.1 2943 2727.51 689.196 15.5945 Potri.016G087400.1.v4.1 270 88.4586 1774 1237.68 Potri.015G069301.1.v4.1 564 350.397 0 0 Potri.010G195200.1.v4.1 1773 1557.51 564 22.3482 Potri.012G127500.1.v4.1 977 761.512 6291 509.843 ==> SRR7171499.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 480 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 183 SRR7171499 completed mapping pipeline successfully