Starting /dee2/code/volunteer_pipeline.sh SRR7171500 current disk space = 3112290504704 free memory = 1569635672 SRR7171500 SRAfilesize fb61a30450dbfc4161e88c3f5e6d90b8 SRR7171500.sra SRR7171500.sra file validated SRR7171500 is paired end SRR7171500 is conventional basespace SRR7171500 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171500_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14175 33.0 32.0 34.0 31.0 34.0 2 32.5905 33.0 33.0 34.0 31.0 34.0 3 33.0705 34.0 33.0 34.0 32.0 34.0 4 32.89225 34.0 33.0 34.0 32.0 34.0 5 33.16825 34.0 33.0 34.0 32.0 34.0 6 37.00525 38.0 37.0 38.0 36.0 38.0 7 37.31975 38.0 38.0 38.0 36.0 38.0 8 37.3165 38.0 38.0 38.0 37.0 38.0 9 37.4995 38.0 38.0 38.0 37.0 38.0 10-14 37.518299999999996 38.0 38.0 38.0 37.6 38.0 15-19 37.511900000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.5053 38.0 38.0 38.0 37.6 38.0 25-29 37.446250000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.45675 38.0 38.0 38.0 37.4 38.0 35-39 37.4467 38.0 38.0 38.0 37.2 38.0 40-44 37.389649999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.46215 38.0 38.0 38.0 37.0 38.0 50-54 37.3679 38.0 38.0 38.0 37.0 38.0 55-59 37.27345 38.0 38.0 38.0 36.8 38.0 60-64 37.20295 38.0 38.0 38.0 36.6 38.0 65-69 37.141000000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.08895 38.0 38.0 38.0 36.0 38.0 75-79 37.06355 38.0 38.0 38.0 36.0 38.0 80-84 37.04155 38.0 38.0 38.0 36.0 38.0 85-89 37.0483 38.0 38.0 38.0 36.0 38.0 90-94 37.03405 38.0 38.0 38.0 36.0 38.0 95-99 36.84865 38.0 38.0 38.0 35.6 38.0 100-104 36.66975 38.0 38.0 38.0 34.2 38.0 105-109 36.68365 38.0 38.0 38.0 34.4 38.0 110-114 36.65785000000001 38.0 38.0 38.0 34.2 38.0 115-119 36.45755 38.0 38.0 38.0 34.0 38.0 120-124 36.417350000000006 38.0 38.0 38.0 33.8 38.0 125-129 36.333450000000006 38.0 37.8 38.0 33.8 38.0 130-134 36.214549999999996 38.0 37.4 38.0 33.4 38.0 135-139 36.0154 38.0 36.4 38.0 33.0 38.0 140-144 35.888549999999995 38.0 36.0 38.0 32.4 38.0 145-149 35.68265 38.0 36.0 38.0 31.2 38.0 150-151 33.85425 37.0 33.5 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 2.0 25 6.0 26 13.0 27 8.0 28 19.0 29 29.0 30 36.0 31 40.0 32 74.0 33 87.0 34 123.0 35 227.0 36 498.0 37 2834.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.74305906108027 12.165572942958102 9.793033821302373 39.29833417465926 2 21.45 14.725 33.7 30.125 3 20.025000000000002 19.225 26.200000000000003 34.55 4 23.150000000000002 28.575 22.775000000000002 25.5 5 22.3 34.449999999999996 22.900000000000002 20.349999999999998 6 19.375 35.325 24.5 20.8 7 14.649999999999999 25.75 41.625 17.974999999999998 8 18.625 25.75 30.2 25.424999999999997 9 16.45 24.0 34.8 24.75 10-14 19.645000000000003 30.245 26.695 23.415 15-19 19.945 29.244999999999997 27.425 23.385 20-24 19.66 28.955 27.860000000000003 23.525 25-29 19.475 28.965000000000003 27.79 23.77 30-34 19.855 29.015 27.439999999999998 23.69 35-39 20.0 28.65 27.62 23.73 40-44 20.135 28.854999999999997 27.295 23.715 45-49 20.580000000000002 28.610000000000003 27.529999999999998 23.28 50-54 20.265 28.48 27.36 23.895 55-59 20.044999999999998 28.57 27.650000000000002 23.735 60-64 19.535 28.854999999999997 28.000000000000004 23.61 65-69 19.945 28.54 27.634999999999998 23.880000000000003 70-74 20.225 28.689999999999998 27.315 23.77 75-79 19.435 28.544999999999998 28.23 23.79 80-84 20.669999999999998 27.87 27.905 23.555 85-89 19.525000000000002 28.144999999999996 28.37 23.96 90-94 20.330000000000002 28.675 27.79 23.205000000000002 95-99 19.915 28.275 27.915 23.895 100-104 20.05 27.994999999999997 28.205000000000002 23.75 105-109 20.26 28.244999999999997 27.650000000000002 23.845 110-114 20.565 28.050000000000004 27.755000000000003 23.630000000000003 115-119 20.465 28.1 27.589999999999996 23.845 120-124 20.745 28.32 27.43 23.505000000000003 125-129 20.544999999999998 28.09 27.435 23.93 130-134 20.335 28.115000000000002 27.534999999999997 24.015 135-139 20.95 28.499999999999996 26.915 23.635 140-144 20.875 28.249999999999996 27.215 23.66 145-149 21.105 28.815 26.650000000000002 23.43 150-151 21.912499999999998 28.050000000000004 26.25 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 2.5 26 4.0 27 5.5 28 8.5 29 10.5 30 15.0 31 22.5 32 34.5 33 45.0 34 50.0 35 67.5 36 99.5 37 124.5 38 140.5 39 155.0 40 178.5 41 224.0 42 251.0 43 250.0 44 273.0 45 288.5 46 268.0 47 263.5 48 242.5 49 196.0 50 171.5 51 146.5 52 119.5 53 86.5 54 65.0 55 49.5 56 32.5 57 26.0 58 18.0 59 17.5 60 14.5 61 8.5 62 3.0 63 4.0 64 4.5 65 1.5 66 1.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.4249999999999998 0.0 0.0 0.0 0.0 116-117 1.575 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 1.9874999999999998 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.4625 0.0 0.0 0.0 0.0 126-127 2.7249999999999996 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.4000000000000004 0.0 0.0 0.0 0.0 132-133 3.65 0.0 0.0 0.0 0.0 134-135 4.15 0.0 0.0 0.0 0.0 136-137 4.6125 0.0 0.0 0.0 0.0 138-139 5.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171500 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171500_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9935 33.0 33.0 34.0 32.0 34.0 2 33.008 34.0 33.0 34.0 32.0 34.0 3 33.008 34.0 33.0 34.0 32.0 34.0 4 32.97825 34.0 33.0 34.0 32.0 34.0 5 32.9555 34.0 33.0 34.0 32.0 34.0 6 37.04025 38.0 38.0 38.0 36.0 38.0 7 37.0835 38.0 38.0 38.0 36.0 38.0 8 37.102 38.0 38.0 38.0 37.0 38.0 9 37.08425 38.0 38.0 38.0 37.0 38.0 10-14 37.0392 38.0 38.0 38.0 36.2 38.0 15-19 37.02055 38.0 38.0 38.0 36.2 38.0 20-24 37.04585 38.0 38.0 38.0 36.0 38.0 25-29 37.0446 38.0 38.0 38.0 36.2 38.0 30-34 37.04625 38.0 38.0 38.0 36.0 38.0 35-39 37.07065 38.0 38.0 38.0 36.0 38.0 40-44 36.44805 37.8 37.4 38.0 33.8 38.0 45-49 36.915499999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.916199999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.925200000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.909749999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.8714 38.0 38.0 38.0 35.8 38.0 70-74 36.8835 38.0 38.0 38.0 36.0 38.0 75-79 36.92435 38.0 38.0 38.0 36.0 38.0 80-84 36.8465 38.0 38.0 38.0 35.6 38.0 85-89 36.78305 38.0 38.0 38.0 35.2 38.0 90-94 36.65535 38.0 38.0 38.0 35.0 38.0 95-99 36.513600000000004 38.0 38.0 38.0 34.4 38.0 100-104 36.337950000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.376549999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.2049 38.0 38.0 38.0 33.8 38.0 115-119 36.1803 38.0 38.0 38.0 33.6 38.0 120-124 35.9816 38.0 37.4 38.0 32.4 38.0 125-129 35.984500000000004 38.0 37.0 38.0 33.0 38.0 130-134 35.77265 38.0 36.6 38.0 31.2 38.0 135-139 35.545849999999994 38.0 36.0 38.0 31.0 38.0 140-144 35.178599999999996 38.0 35.8 38.0 28.6 38.0 145-149 35.09655 38.0 35.0 38.0 28.0 38.0 150-151 32.573125000000005 35.5 30.0 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 1.0 8 2.0 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 2.0 19 4.0 20 1.0 21 3.0 22 10.0 23 14.0 24 15.0 25 12.0 26 20.0 27 24.0 28 27.0 29 39.0 30 46.0 31 56.0 32 78.0 33 85.0 34 122.0 35 236.0 36 487.0 37 2709.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.974999999999994 20.9 13.375 27.750000000000004 2 26.82193839218633 26.34610568494866 29.802153769095916 17.029802153769097 3 21.067134268537075 28.932865731462925 29.759519038076153 20.240480961923847 4 23.922845691382765 36.54809619238477 21.8687374749499 17.660320641282564 5 24.98748122183275 36.22934401602404 21.382073109664496 17.40110165247872 6 21.022300175394637 36.88298672012027 23.177148584314708 18.917564520170384 7 21.308598646277265 21.283529706693407 38.631235898721485 18.776635748307847 8 22.149837133550488 25.156602355299423 28.238536707592083 24.455023803558003 9 22.832080200501252 25.53884711779449 29.924812030075188 21.704260651629074 10-14 23.83793812365241 29.062829062829067 25.743368600511456 21.35586421300707 15-19 23.376948914623753 27.638241339549808 27.818719606958442 21.166090138868 20-24 22.913010779644022 28.804211581850087 27.64602657307596 20.63675106542993 25-29 23.201402805611224 28.06613226452906 27.790581162324653 20.941883767535067 30-34 23.264427649031482 27.76915761549627 28.26968316732569 20.696731568146554 35-39 23.221966589976994 28.64359307792338 27.48324497349205 20.651195358607584 40-44 23.43014521782674 28.337506259389084 27.41612418627942 20.816224336504757 45-49 22.99057927440369 28.437562637803165 27.445379835638406 21.12647825215474 50-54 23.844843139220206 27.678660920116265 28.259997995389398 20.21649794527413 55-59 24.08920070157855 27.767476822851417 27.70233024304686 20.44099223252318 60-64 22.75506113449589 27.670875927039486 28.37743034676288 21.196632591701743 65-69 23.62871311927065 27.971747733306618 27.70625657466313 20.693282572759607 70-74 23.893584037605642 27.959193879081862 27.809171375706356 20.338050707606143 75-79 23.395 27.925 27.900000000000002 20.78 80-84 23.555 28.515 27.500000000000004 20.43 85-89 24.333516730855802 28.059820937328066 27.51463012054219 20.092032211273946 90-94 24.16211612644657 28.415410049596712 27.55873954210711 19.863734281849606 95-99 23.81573011178505 27.660534362624695 28.131735926612862 20.391999598977392 100-104 24.540893125940794 27.551430005017565 28.1685900652283 19.739086803813347 105-109 23.272964430843327 28.00882957908995 27.978728741283298 20.739477248783427 110-114 23.961677367576247 28.20024077046549 27.372592295345104 20.46548956661316 115-119 23.92056566872273 27.802015947043778 27.927385788074822 20.35003259615867 120-124 24.164369832122276 28.474066649962417 27.251315459784514 20.110248058130793 125-129 24.07388866639968 28.01862234681618 27.583099719663593 20.324389267120544 130-134 24.425531914893618 28.435544430538172 27.264080100125156 19.874843554443054 135-139 24.66680028058924 27.638039883755887 27.82342920132278 19.871730634332096 140-144 24.11717495987159 28.315609951845904 27.588282504012838 19.978932584269664 145-149 24.89840967240255 27.883409421562234 27.45698088596799 19.761200020067225 150-151 24.25990968389363 27.270446562970395 27.985449071751127 20.484194681384846 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.5 26 1.5 27 2.5 28 3.5 29 6.5 30 12.0 31 11.5 32 17.0 33 29.0 34 43.5 35 65.5 36 85.5 37 105.0 38 138.0 39 166.5 40 189.5 41 235.0 42 262.0 43 284.5 44 287.5 45 288.0 46 285.5 47 243.5 48 232.5 49 215.0 50 191.5 51 153.5 52 102.5 53 88.0 54 70.5 55 44.5 56 30.5 57 20.5 58 16.5 59 14.5 60 8.5 61 7.5 62 7.5 63 7.5 64 5.0 65 1.5 66 1.5 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.2 4 0.2 5 0.15 6 0.22499999999999998 7 0.27499999999999997 8 0.22499999999999998 9 0.25 10-14 0.28500000000000003 15-19 0.265 20-24 0.27499999999999997 25-29 0.2 30-34 0.105 35-39 0.03 40-44 0.15 45-49 0.22 50-54 0.22999999999999998 55-59 0.22499999999999998 60-64 0.22 65-69 0.185 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.034999999999999996 90-94 0.19499999999999998 95-99 0.255 100-104 0.35000000000000003 105-109 0.335 110-114 0.32 115-119 0.295 120-124 0.22499999999999998 125-129 0.12 130-134 0.125 135-139 0.21 140-144 0.32 145-149 0.335 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 1.9874999999999998 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.45 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 3.0250000000000004 0.0 0.0 0.0 0.0 130-131 3.3875 0.0 0.0 0.0 0.0 132-133 3.625 0.0 0.0 0.0 0.0 134-135 4.125 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138-139 4.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801688 spots for SRR7171500.sra Written 801688 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra Read 801673 spots for SRR7171500.sra Written 801673 spots for SRR7171500.sra SRR ids: ['SRR7171500.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cze1v4le SRR7171500.sra spots: 16033475 blocks: [[1, 801673], [801674, 1603346], [1603347, 2405019], [2405020, 3206692], [3206693, 4008365], [4008366, 4810038], [4810039, 5611711], [5611712, 6413384], [6413385, 7215057], [7215058, 8016730], [8016731, 8818403], [8818404, 9620076], [9620077, 10421749], [10421750, 11223422], [11223423, 12025095], [12025096, 12826768], [12826769, 13628441], [13628442, 14430114], [14430115, 15231787], [15231788, 16033475]] SRR7171500 file size 5411518 SRR7171500 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171500 SRR7171500_1.fastq SRR7171500_2.fastq Input file: SRR7171500_1.fastq Paired file: SRR7171500_2.fastq trimmed: SRR7171500-trimmed-pair1.fastq, SRR7171500-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:16:36 2025 >> started Fri Feb 14 12:16:54 2025 >> done (17.842s) 16033475 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 638 ( 0.00%) empty read pairs filtered out after trimming by size control 16032826 (100.00%) read pairs available; of these: 1445324 ( 9.01%) trimmed read pairs available after processing 14587502 (90.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 0 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 2 0.00% 33 1 0.00% 34 1 0.00% 35 1 0.00% 36 2 0.00% 37 4 0.00% 38 1 0.00% 39 2 0.00% 40 5 0.00% 41 3 0.00% 42 4 0.00% 43 6 0.00% 44 3 0.00% 45 3 0.00% 46 7 0.00% 47 9 0.00% 48 10 0.00% 49 11 0.00% 50 9 0.00% 51 14 0.00% 52 16 0.00% 53 10 0.00% 54 30 0.00% 55 20 0.00% 56 49 0.00% 57 29 0.00% 58 40 0.00% 59 57 0.00% 60 58 0.00% 61 55 0.00% 62 94 0.00% 63 91 0.00% 64 107 0.00% 65 120 0.00% 66 132 0.00% 67 133 0.00% 68 164 0.00% 69 192 0.00% 70 249 0.00% 71 262 0.00% 72 344 0.00% 73 410 0.00% 74 461 0.00% 75 518 0.00% 76 563 0.00% 77 638 0.00% 78 679 0.00% 79 917 0.01% 80 1003 0.01% 81 1143 0.01% 82 1217 0.01% 83 1452 0.01% 84 1664 0.01% 85 1888 0.01% 86 2073 0.01% 87 2251 0.01% 88 2523 0.02% 89 2768 0.02% 90 2951 0.02% 91 3474 0.02% 92 3851 0.02% 93 4273 0.03% 94 4654 0.03% 95 4914 0.03% 96 5333 0.03% 97 5743 0.04% 98 6118 0.04% 99 6702 0.04% 100 7012 0.04% 101 7624 0.05% 102 8307 0.05% 103 8999 0.06% 104 9698 0.06% 105 10422 0.07% 106 10885 0.07% 107 11323 0.07% 108 11778 0.07% 109 12219 0.08% 110 13041 0.08% 111 13610 0.08% 112 14213 0.09% 113 15375 0.10% 114 16510 0.10% 115 17477 0.11% 116 18472 0.12% 117 20100 0.13% 118 21265 0.13% 119 20923 0.13% 120 20237 0.13% 121 21512 0.13% 122 21916 0.14% 123 23357 0.15% 124 24674 0.15% 125 25639 0.16% 126 26733 0.17% 127 27232 0.17% 128 28006 0.17% 129 28606 0.18% 130 29296 0.18% 131 30223 0.19% 132 31248 0.19% 133 32548 0.20% 134 33736 0.21% 135 35102 0.22% 136 36303 0.23% 137 37280 0.23% 138 38087 0.24% 139 38703 0.24% 140 39767 0.25% 141 42165 0.26% 142 44145 0.28% 143 42739 0.27% 144 49210 0.31% 145 47270 0.29% 146 46640 0.29% 147 49216 0.31% 148 49264 0.31% 149 48850 0.30% 150 53823 0.34% 151 14587502 90.99% 16032826 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=12 prefix-density=0.33 prefix-fanout=3.6 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=10.77 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.4 sequence=ATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=26 prefix-density=0.41 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=36.14 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.1 sequence=AAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCGAGGGTTGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCCCGCAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCGTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCTCGGTGCGAGTTCTATCGGGTAAAGCCAATGATTAGAGGCATCGGGGGCGCAACGCCCTCGACCTATTCTCAAACTTTAAATAGGTAGGACGGCGCGGCTGCTTCGTTGAGCCGCGCCACGGAATCGAGAGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGT SRR7171500 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:17:39 Started mapping on | Feb 14 12:17:40 Finished on | Feb 14 12:19:53 Mapping speed, Million of reads per hour | 433.97 Number of input reads | 16032826 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14794515 Uniquely mapped reads % | 92.28% Average mapped length | 296.97 Number of splices: Total | 14588087 Number of splices: Annotated (sjdb) | 14337092 Number of splices: GT/AG | 14358331 Number of splices: GC/AG | 182740 Number of splices: AT/AC | 11051 Number of splices: Non-canonical | 35965 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405160 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 145012 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.07% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 833151 833151 833151 N_multimapping 405160 405160 405160 N_noFeature 374404 14661269 428246 N_ambiguous 159355 914 79371 UnstrandedReadsAssigned:14260756 PositiveStrandReadsAssigned:132332 NegativeStrandReadsAssigned:14286898 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171500 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171500-trimmed-pair1.fastq SRR7171500-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,032,826 reads, 14,377,536 reads pseudoaligned [quant] estimated average fragment length: 241.196 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,000 rounds 52401 SRR7171500.ke.tsv 34699 SRR7171500.se.tsv 87100 total ==> SRR7171500.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.8 890 32.701 Potri.005G024800.1.v4.1 1035 794.804 225 18.4917 Potri.004G059700.1.v4.1 961 720.83 38 3.44354 Potri.007G009000.2.v4.1 1416 1175.8 0 0 Potri.003G141000.2.v4.1 2943 2702.8 541.167 13.0789 Potri.016G087400.1.v4.1 270 77.4814 1263 1064.78 Potri.015G069301.1.v4.1 564 327.512 0 0 Potri.010G195200.1.v4.1 1773 1532.8 275 11.7193 Potri.012G127500.1.v4.1 977 736.815 3250 288.124 ==> SRR7171500.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 54 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 422 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 138 SRR7171500 completed mapping pipeline successfully