Starting /dee2/code/volunteer_pipeline.sh SRR7171501 current disk space = 3088173879296 free memory = 1578121224 SRR7171501 SRAfilesize 67747c8cb41af2adefc3b44675628d91 SRR7171501.sra SRR7171501.sra file validated SRR7171501 is paired end SRR7171501 is conventional basespace SRR7171501 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171501_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9885 34.0 33.0 34.0 32.0 34.0 2 33.2185 34.0 33.0 34.0 32.0 34.0 3 33.1995 34.0 33.0 34.0 32.0 34.0 4 33.24075 34.0 33.0 34.0 33.0 34.0 5 33.25 34.0 33.0 34.0 33.0 34.0 6 36.90075 38.0 37.0 38.0 35.0 38.0 7 37.3535 38.0 38.0 38.0 36.0 38.0 8 37.4675 38.0 38.0 38.0 37.0 38.0 9 37.59475 38.0 38.0 38.0 38.0 38.0 10-14 37.51445 38.0 38.0 38.0 37.8 38.0 15-19 37.51985 38.0 38.0 38.0 37.6 38.0 20-24 37.52225 38.0 38.0 38.0 37.6 38.0 25-29 37.45145 38.0 38.0 38.0 37.6 38.0 30-34 37.38175 38.0 38.0 38.0 37.0 38.0 35-39 37.407799999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.39565 38.0 38.0 38.0 37.0 38.0 45-49 37.4467 38.0 38.0 38.0 37.2 38.0 50-54 37.38405 38.0 38.0 38.0 37.0 38.0 55-59 37.3249 38.0 38.0 38.0 37.0 38.0 60-64 37.2697 38.0 38.0 38.0 37.0 38.0 65-69 37.24625 38.0 38.0 38.0 36.6 38.0 70-74 37.06105 38.0 38.0 38.0 36.0 38.0 75-79 37.091899999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.0685 38.0 38.0 38.0 36.0 38.0 85-89 36.9413 38.0 38.0 38.0 35.6 38.0 90-94 36.9528 38.0 38.0 38.0 35.4 38.0 95-99 36.7308 38.0 38.0 38.0 34.8 38.0 100-104 36.5817 38.0 38.0 38.0 34.0 38.0 105-109 36.55409999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.44615 38.0 38.0 38.0 34.0 38.0 115-119 36.56055 38.0 38.0 38.0 34.0 38.0 120-124 36.394 38.0 38.0 38.0 34.0 38.0 125-129 36.333800000000004 38.0 37.4 38.0 33.6 38.0 130-134 36.0432 38.0 36.8 38.0 32.6 38.0 135-139 35.7819 38.0 36.0 38.0 31.4 38.0 140-144 35.72555 38.0 36.0 38.0 31.4 38.0 145-149 35.6301 38.0 36.0 38.0 31.0 38.0 150-151 33.203 36.5 31.5 38.0 21.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 2.0 24 5.0 25 9.0 26 17.0 27 11.0 28 18.0 29 25.0 30 26.0 31 52.0 32 56.0 33 92.0 34 129.0 35 234.0 36 524.0 37 2797.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.01005025125628 12.060301507537687 11.180904522613066 39.74874371859297 2 21.775 15.325 33.300000000000004 29.599999999999998 3 20.075000000000003 19.5 25.224999999999998 35.199999999999996 4 22.525000000000002 27.35 22.975 27.150000000000002 5 23.65 31.0 24.55 20.8 6 20.375 34.449999999999996 25.374999999999996 19.8 7 14.924999999999999 25.8 40.175 19.1 8 17.125 25.724999999999998 31.724999999999998 25.424999999999997 9 16.675 24.45 34.025 24.85 10-14 19.8 29.94 27.11 23.150000000000002 15-19 19.64 28.075 28.125 24.16 20-24 19.869999999999997 28.384999999999998 28.26 23.485 25-29 19.897984697704658 29.06435965394809 27.204080612091815 23.83357503625544 30-34 19.796928925123794 28.880108037813233 27.649677387085482 23.67328564997749 35-39 19.812925170068027 28.721488595438178 27.606042416966787 23.85954381752701 40-44 19.53183614264993 28.429950482668936 28.354924223478218 23.68328915120292 45-49 20.05001250312578 27.866966741685424 27.93198299574894 24.151037759439863 50-54 19.965998299914997 28.311415570778536 27.616380819040952 24.106205310265512 55-59 20.119999999999997 28.485 27.845 23.549999999999997 60-64 19.935 28.384999999999998 27.339999999999996 24.34 65-69 19.91 28.249999999999996 27.62 24.22 70-74 20.055 28.225 27.66 24.060000000000002 75-79 20.080000000000002 28.105000000000004 27.644999999999996 24.169999999999998 80-84 20.155 28.349999999999998 27.700000000000003 23.794999999999998 85-89 20.14 28.04 28.015 23.805 90-94 20.365 28.035 27.860000000000003 23.74 95-99 20.515 27.825 27.88 23.78 100-104 20.02 28.470000000000002 27.63 23.880000000000003 105-109 20.34 27.544999999999998 27.894999999999996 24.22 110-114 20.45 27.96 27.96 23.630000000000003 115-119 20.57 28.139999999999997 27.72 23.57 120-124 20.805 28.425 27.165 23.605 125-129 20.665 27.465 27.634999999999998 24.235 130-134 20.474999999999998 27.834999999999997 27.650000000000002 24.04 135-139 20.74 27.900000000000002 27.694999999999997 23.665 140-144 20.655 27.625 27.32 24.4 145-149 20.79 27.915 27.279999999999998 24.015 150-151 21.099999999999998 28.212500000000002 26.575 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 2.0 26 4.0 27 9.0 28 10.0 29 9.0 30 15.0 31 21.0 32 26.5 33 38.5 34 46.0 35 56.5 36 79.5 37 108.5 38 134.0 39 176.5 40 216.0 41 218.0 42 239.5 43 261.0 44 260.0 45 273.0 46 279.0 47 255.5 48 229.0 49 209.5 50 175.5 51 144.0 52 120.5 53 88.5 54 67.5 55 53.0 56 39.0 57 30.5 58 25.5 59 18.5 60 12.0 61 13.5 62 8.5 63 3.0 64 3.5 65 4.0 66 2.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.034999999999999996 35-39 0.04 40-44 0.034999999999999996 45-49 0.025 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2125 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.9749999999999999 0.0 0.0 0.0 0.0 122-123 2.225 0.0 0.0 0.0 0.0 124-125 2.5250000000000004 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.9375 0.0 0.0 0.0 0.0 134-135 4.5 0.0 0.0 0.0 0.0 136-137 4.9125 0.0 0.0 0.0 0.0 138-139 5.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171501 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171501_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64325 33.0 33.0 34.0 32.0 34.0 2 32.658 33.0 33.0 34.0 32.0 34.0 3 32.73275 34.0 33.0 34.0 32.0 34.0 4 32.52925 34.0 33.0 34.0 31.0 34.0 5 32.56 34.0 33.0 34.0 32.0 34.0 6 36.55975 38.0 38.0 38.0 35.0 38.0 7 36.625 38.0 38.0 38.0 35.0 38.0 8 36.557 38.0 38.0 38.0 35.0 38.0 9 36.6185 38.0 38.0 38.0 35.0 38.0 10-14 36.7078 38.0 38.0 38.0 35.2 38.0 15-19 36.907450000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.9774 38.0 38.0 38.0 36.0 38.0 25-29 37.06875 38.0 38.0 38.0 36.6 38.0 30-34 37.10170000000001 38.0 38.0 38.0 36.8 38.0 35-39 36.9514 38.0 38.0 38.0 36.0 38.0 40-44 36.93815 38.0 38.0 38.0 36.0 38.0 45-49 36.93300000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.83855 38.0 38.0 38.0 36.0 38.0 55-59 36.8433 38.0 38.0 38.0 35.8 38.0 60-64 36.8087 38.0 38.0 38.0 35.8 38.0 65-69 36.8976 38.0 38.0 38.0 36.0 38.0 70-74 36.874249999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.90585 38.0 38.0 38.0 36.0 38.0 80-84 36.8499 38.0 38.0 38.0 35.6 38.0 85-89 36.73530000000001 38.0 38.0 38.0 35.0 38.0 90-94 36.6001 38.0 38.0 38.0 34.8 38.0 95-99 36.493449999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.4269 38.0 38.0 38.0 34.0 38.0 105-109 36.328799999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.265 38.0 38.0 38.0 34.0 38.0 115-119 36.0071 38.0 37.2 38.0 32.8 38.0 120-124 35.860749999999996 38.0 37.0 38.0 32.0 38.0 125-129 35.853 38.0 37.0 38.0 31.0 38.0 130-134 35.59415 38.0 36.0 38.0 31.0 38.0 135-139 35.340500000000006 38.0 36.0 38.0 28.8 38.0 140-144 35.13095 38.0 35.6 38.0 28.0 38.0 145-149 34.723499999999994 38.0 35.0 38.0 25.2 38.0 150-151 32.312375 35.5 28.0 38.0 19.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 3.0 18 3.0 19 3.0 20 6.0 21 9.0 22 10.0 23 7.0 24 17.0 25 17.0 26 16.0 27 20.0 28 31.0 29 39.0 30 52.0 31 64.0 32 69.0 33 100.0 34 124.0 35 223.0 36 528.0 37 2649.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.14257128564282 20.935467733866933 15.532766383191596 28.38919459729865 2 25.93241551939925 25.982478097622025 30.83854818523154 17.246558197747184 3 20.41531148361271 28.796597448086064 29.847385539154363 20.94070552914686 4 23.29246935201401 35.37653239929948 22.34175631723793 18.989241931448586 5 24.91860756323566 35.96293513648885 21.98847983971951 17.129977460555974 6 20.611835506519558 37.387161484453365 23.269809428284855 18.73119358074223 7 19.894763217238786 22.300175394637936 37.434227010774244 20.370834377349034 8 22.80130293159609 25.407166123778502 26.10874467551992 25.68278626910549 9 22.135873652544497 25.09400852343946 29.85710704437202 22.913010779644022 10-14 23.612573319296136 28.836416503734895 26.515265453451647 21.035744723517322 15-19 23.123589872148408 28.5585359739283 27.365254449736774 20.95261970418651 20-24 23.026777655200082 28.698224852071007 26.958178718283023 21.316818774445892 25-29 23.742232912407296 27.866305872920428 27.370214471838043 21.021246742834236 30-34 23.250575633196515 28.000800880969066 27.7305035539093 21.018119931925117 35-39 23.5029266096353 28.645755165340937 27.18995447496123 20.661363750062534 40-44 23.198277157309562 28.37682175589723 27.455301247057644 20.969599839735565 45-49 23.340181389988476 27.88996342135592 28.05030816254948 20.719547026106127 50-54 23.434444722988218 28.1774880922537 27.38530960140386 21.002757583354224 55-59 23.268642495361316 27.977533724487238 27.62649816960032 21.127325610551125 60-64 23.745299573828028 28.35798445725746 27.746302331411382 20.150413637503135 65-69 23.606935257566647 28.1870114251353 27.269993986770896 20.93605933052716 70-74 23.537953134388143 28.970558782295214 27.062888043260564 20.42860004005608 75-79 24.328514980243085 27.844745660981346 27.744710648727057 20.082028710048515 80-84 23.777133139941984 27.403220966289886 27.983395018505554 20.83625087526258 85-89 23.791412271043942 27.850065058552698 27.544790311280153 20.81373235912321 90-94 24.075743913435527 27.747720669271615 27.762749223524697 20.41378619376816 95-99 23.80689793463004 28.052937637858435 27.917585722879483 20.222578704632042 100-104 23.77990670612429 28.304158098008724 27.526709133771384 20.3892260620956 105-109 24.02949142341258 28.122178754137828 27.801183669375064 20.04714615307453 110-114 23.868993881031198 28.22248971812619 27.660748319791352 20.24776808105126 115-119 24.621326110943926 27.445079747216372 27.420002006219278 20.513592135620424 120-124 24.367009275507645 27.69616445224367 27.570819754324393 20.366006517924294 125-129 23.884409275304254 27.936094556017427 27.73075574698252 20.4487404216958 130-134 24.755896049271445 28.411196234540082 27.124330278904413 19.70857743728406 135-139 24.238324313489677 28.517739025856887 27.22489476849068 20.019041892162758 140-144 24.660213651637495 28.296303726365412 27.463764481669088 19.579718140328 145-149 24.987461129501455 28.102116561340157 26.943524927274552 19.96689738188384 150-151 25.55165496489468 27.896188565697088 26.993480441323968 19.55867602808425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.0 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 3.5 26 3.0 27 3.5 28 3.5 29 6.5 30 14.5 31 18.0 32 17.0 33 25.5 34 45.0 35 54.0 36 65.0 37 97.0 38 128.5 39 153.0 40 193.0 41 230.0 42 270.0 43 294.5 44 292.5 45 301.5 46 297.5 47 266.5 48 234.0 49 208.5 50 171.0 51 141.0 52 116.0 53 89.5 54 64.0 55 43.5 56 30.0 57 24.5 58 20.5 59 13.5 60 12.0 61 8.0 62 8.0 63 10.0 64 6.0 65 0.5 66 0.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.125 3 0.075 4 0.075 5 0.17500000000000002 6 0.3 7 0.22499999999999998 8 0.22499999999999998 9 0.27499999999999997 10-14 0.265 15-19 0.27499999999999997 20-24 0.29 25-29 0.22 30-34 0.11 35-39 0.055 40-44 0.165 45-49 0.215 50-54 0.27499999999999997 55-59 0.295 60-64 0.27499999999999997 65-69 0.22 70-74 0.13999999999999999 75-79 0.034999999999999996 80-84 0.03 85-89 0.09 90-94 0.19 95-99 0.26 100-104 0.315 105-109 0.31 110-114 0.31 115-119 0.31 120-124 0.27499999999999997 125-129 0.165 130-134 0.145 135-139 0.22 140-144 0.305 145-149 0.31 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77426636568849 99.45 2 0.17557060446450964 0.35000000000000003 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.025081514923501375 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.575 0.0 0.0 0.0 0.0 118-119 1.7374999999999998 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.575 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.5250000000000004 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.550000000000001 0.0 0.0 0.0 0.0 136-137 4.9625 0.0 0.0 0.0 0.0 138-139 5.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGTTC 10 0.006730461 145.6962 5 TTAAATG 10 0.006730461 145.6962 2 >>END_MODULE Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054042 spots for SRR7171501.sra Written 1054042 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra Read 1054035 spots for SRR7171501.sra Written 1054035 spots for SRR7171501.sra SRR ids: ['SRR7171501.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1q_0nkel SRR7171501.sra spots: 21080707 blocks: [[1, 1054035], [1054036, 2108070], [2108071, 3162105], [3162106, 4216140], [4216141, 5270175], [5270176, 6324210], [6324211, 7378245], [7378246, 8432280], [8432281, 9486315], [9486316, 10540350], [10540351, 11594385], [11594386, 12648420], [12648421, 13702455], [13702456, 14756490], [14756491, 15810525], [15810526, 16864560], [16864561, 17918595], [17918596, 18972630], [18972631, 20026665], [20026666, 21080707]] SRR7171501 file size 7121859 SRR7171501 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171501 SRR7171501_1.fastq SRR7171501_2.fastq Input file: SRR7171501_1.fastq Paired file: SRR7171501_2.fastq trimmed: SRR7171501-trimmed-pair1.fastq, SRR7171501-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:34:10 2025 >> started Thu Feb 13 21:34:33 2025 >> done (23.034s) 21080707 read pairs processed; of these: 1081 ( 0.01%) short read pairs filtered out after trimming by size control 2173 ( 0.01%) empty read pairs filtered out after trimming by size control 21077453 (99.98%) read pairs available; of these: 1926000 ( 9.14%) trimmed read pairs available after processing 19151453 (90.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 4 0.00% 26 0 0.00% 27 0 0.00% 28 3 0.00% 29 2 0.00% 30 2 0.00% 31 1 0.00% 32 1 0.00% 33 0 0.00% 34 2 0.00% 35 4 0.00% 36 4 0.00% 37 8 0.00% 38 3 0.00% 39 8 0.00% 40 3 0.00% 41 7 0.00% 42 5 0.00% 43 6 0.00% 44 5 0.00% 45 8 0.00% 46 7 0.00% 47 13 0.00% 48 13 0.00% 49 12 0.00% 50 15 0.00% 51 18 0.00% 52 18 0.00% 53 33 0.00% 54 24 0.00% 55 33 0.00% 56 36 0.00% 57 45 0.00% 58 52 0.00% 59 65 0.00% 60 59 0.00% 61 68 0.00% 62 91 0.00% 63 104 0.00% 64 145 0.00% 65 131 0.00% 66 174 0.00% 67 189 0.00% 68 193 0.00% 69 266 0.00% 70 301 0.00% 71 328 0.00% 72 384 0.00% 73 451 0.00% 74 543 0.00% 75 604 0.00% 76 681 0.00% 77 804 0.00% 78 889 0.00% 79 980 0.00% 80 1135 0.01% 81 1349 0.01% 82 1524 0.01% 83 1752 0.01% 84 2035 0.01% 85 2288 0.01% 86 2552 0.01% 87 2760 0.01% 88 3080 0.01% 89 3325 0.02% 90 3704 0.02% 91 4295 0.02% 92 4717 0.02% 93 5141 0.02% 94 5858 0.03% 95 6174 0.03% 96 6606 0.03% 97 7261 0.03% 98 7541 0.04% 99 8433 0.04% 100 9040 0.04% 101 9523 0.05% 102 10444 0.05% 103 11534 0.05% 104 12301 0.06% 105 13195 0.06% 106 14003 0.07% 107 14649 0.07% 108 14897 0.07% 109 15885 0.08% 110 16408 0.08% 111 17539 0.08% 112 18848 0.09% 113 19681 0.09% 114 21820 0.10% 115 23135 0.11% 116 25387 0.12% 117 29239 0.14% 118 29155 0.14% 119 27278 0.13% 120 26642 0.13% 121 27757 0.13% 122 29480 0.14% 123 30397 0.14% 124 32650 0.15% 125 33998 0.16% 126 35390 0.17% 127 36197 0.17% 128 37409 0.18% 129 37927 0.18% 130 38806 0.18% 131 39950 0.19% 132 41337 0.20% 133 43493 0.21% 134 45374 0.22% 135 46951 0.22% 136 48681 0.23% 137 50276 0.24% 138 50818 0.24% 139 51373 0.24% 140 52845 0.25% 141 59069 0.28% 142 62608 0.30% 143 59116 0.28% 144 62326 0.30% 145 68441 0.32% 146 62745 0.30% 147 67982 0.32% 148 65222 0.31% 149 67113 0.32% 150 70282 0.33% 151 19151453 90.86% 21077453 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=6.34 fanout-score-rank=7 prefix-density=0.84 prefix-fanout=3.3 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCAACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=101.20 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.4 sequence=AACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=24 prefix-density=0.56 prefix-fanout=2.8 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=28.03 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.2 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAA SRR7171501 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:35:19 Started mapping on | Feb 13 21:35:20 Finished on | Feb 13 21:37:47 Mapping speed, Million of reads per hour | 516.18 Number of input reads | 21077453 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19649060 Uniquely mapped reads % | 93.22% Average mapped length | 296.96 Number of splices: Total | 19176622 Number of splices: Annotated (sjdb) | 18801801 Number of splices: GT/AG | 18865543 Number of splices: GC/AG | 245937 Number of splices: AT/AC | 16563 Number of splices: Non-canonical | 48579 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484170 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 148638 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 944225 944225 944225 N_multimapping 484170 484170 484170 N_noFeature 501348 19462592 569063 N_ambiguous 224786 1202 105535 UnstrandedReadsAssigned:18922926 PositiveStrandReadsAssigned:185266 NegativeStrandReadsAssigned:18974462 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171501 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171501-trimmed-pair1.fastq SRR7171501-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,077,453 reads, 19,058,244 reads pseudoaligned [quant] estimated average fragment length: 241.485 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR7171501.ke.tsv 34699 SRR7171501.se.tsv 87100 total ==> SRR7171501.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.52 1326 35.5913 Potri.005G024800.1.v4.1 1035 794.515 247 14.8323 Potri.004G059700.1.v4.1 961 720.528 38 2.51621 Potri.007G009000.2.v4.1 1416 1175.52 0 0 Potri.003G141000.2.v4.1 2943 2702.52 711 12.5521 Potri.016G087400.1.v4.1 270 78.0004 1476.23 902.964 Potri.015G069301.1.v4.1 564 327.043 0 0 Potri.010G195200.1.v4.1 1773 1532.52 385 11.9859 Potri.012G127500.1.v4.1 977 736.522 12609 816.788 ==> SRR7171501.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 164 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 664 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 438 SRR7171501 completed mapping pipeline successfully