Starting /dee2/code/volunteer_pipeline.sh SRR7171502 current disk space = 3088177115136 free memory = 1580249344 SRR7171502 SRAfilesize 152637011b51959722039a1cc3c6fd7a SRR7171502.sra SRR7171502.sra file validated SRR7171502 is paired end SRR7171502 is conventional basespace SRR7171502 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171502_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.70875 33.0 33.0 34.0 32.0 34.0 2 32.947 34.0 33.0 34.0 32.0 34.0 3 32.04175 33.0 31.0 33.0 29.0 34.0 4 32.66225 33.0 33.0 34.0 32.0 34.0 5 32.56925 33.0 33.0 33.0 32.0 34.0 6 36.31425 38.0 36.0 38.0 33.0 38.0 7 36.48325 38.0 37.0 38.0 34.0 38.0 8 37.192 38.0 38.0 38.0 36.0 38.0 9 37.4795 38.0 38.0 38.0 37.0 38.0 10-14 37.547250000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.49745 38.0 38.0 38.0 37.2 38.0 20-24 37.51705 38.0 38.0 38.0 37.6 38.0 25-29 37.49435 38.0 38.0 38.0 37.6 38.0 30-34 37.47315 38.0 38.0 38.0 37.6 38.0 35-39 37.459450000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.42305 38.0 38.0 38.0 37.0 38.0 45-49 37.378249999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.39704999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.337450000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.2838 38.0 38.0 38.0 37.0 38.0 65-69 37.25795 38.0 38.0 38.0 37.0 38.0 70-74 37.1754 38.0 38.0 38.0 36.0 38.0 75-79 37.157650000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.074799999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.001250000000006 38.0 38.0 38.0 35.8 38.0 90-94 36.94685 38.0 38.0 38.0 35.8 38.0 95-99 36.7532 38.0 38.0 38.0 34.8 38.0 100-104 36.7085 38.0 38.0 38.0 34.8 38.0 105-109 36.57595 38.0 38.0 38.0 34.0 38.0 110-114 36.5869 38.0 38.0 38.0 34.0 38.0 115-119 36.4636 38.0 38.0 38.0 34.0 38.0 120-124 36.330799999999996 38.0 37.4 38.0 34.0 38.0 125-129 36.20735 38.0 37.0 38.0 33.4 38.0 130-134 36.16225 38.0 37.0 38.0 33.0 38.0 135-139 35.90335 38.0 36.2 38.0 31.8 38.0 140-144 35.72155 38.0 36.0 38.0 31.8 38.0 145-149 35.524950000000004 38.0 36.0 38.0 31.0 38.0 150-151 33.383250000000004 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 1.0 23 4.0 24 5.0 25 6.0 26 11.0 27 8.0 28 19.0 29 31.0 30 30.0 31 43.0 32 58.0 33 80.0 34 137.0 35 235.0 36 574.0 37 2756.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.765319426336376 12.568448500651892 10.873533246414603 36.79269882659713 2 22.325 14.75 32.625 30.3 3 20.549999999999997 18.125 27.525 33.800000000000004 4 23.075000000000003 23.974999999999998 23.1 29.849999999999998 5 23.400000000000002 28.875 25.2 22.525000000000002 6 20.349999999999998 33.475 25.45 20.724999999999998 7 15.049999999999999 27.450000000000003 39.7 17.8 8 18.7 27.474999999999998 31.225 22.6 9 18.325 26.1 32.6 22.975 10-14 19.945 29.635 27.97 22.45 15-19 19.89 28.735 27.905 23.47 20-24 20.32 28.925 28.165000000000003 22.59 25-29 20.44 28.4 27.345000000000002 23.815 30-34 20.13 29.015 27.395000000000003 23.46 35-39 20.135 28.265 27.925 23.674999999999997 40-44 19.814999999999998 28.375 28.065 23.745 45-49 20.075000000000003 28.265 27.185 24.474999999999998 50-54 20.34 28.494999999999997 27.065 24.099999999999998 55-59 20.415 28.04 27.284999999999997 24.26 60-64 19.965 27.750000000000004 28.134999999999998 24.15 65-69 20.26 28.265 27.605 23.87 70-74 20.175 28.9 27.334999999999997 23.59 75-79 20.285 27.905 27.865000000000002 23.945 80-84 20.169999999999998 28.01 27.6 24.22 85-89 20.645 28.675 27.16 23.52 90-94 20.525 28.18 27.49 23.805 95-99 20.495 28.28 27.644999999999996 23.580000000000002 100-104 20.77 28.804999999999996 27.345000000000002 23.080000000000002 105-109 20.595 28.749999999999996 26.979999999999997 23.674999999999997 110-114 21.46 27.589999999999996 28.07 22.88 115-119 21.425 28.355000000000004 27.395000000000003 22.825 120-124 20.875 28.035 26.775 24.315 125-129 20.87 28.425 26.57 24.135 130-134 21.095 27.694999999999997 27.275 23.935000000000002 135-139 21.36 28.499999999999996 26.32 23.82 140-144 21.3 28.02 26.595000000000002 24.085 145-149 21.395 28.044999999999998 26.125 24.435000000000002 150-151 21.425 27.3625 26.2875 24.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 3.0 26 5.0 27 5.0 28 8.0 29 14.5 30 17.5 31 21.0 32 31.0 33 42.5 34 56.0 35 64.5 36 73.5 37 100.5 38 126.0 39 145.5 40 166.0 41 203.0 42 246.0 43 281.0 44 282.5 45 262.0 46 258.5 47 245.5 48 239.5 49 217.5 50 178.5 51 157.5 52 127.0 53 96.0 54 75.0 55 55.0 56 40.5 57 32.5 58 26.5 59 24.5 60 17.5 61 9.0 62 7.0 63 6.5 64 5.0 65 2.5 66 3.0 67 2.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.824517422913 99.55000000000001 2 0.1002757583354224 0.2 3 0.0501378791677112 0.15 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.125 0.0 0.0 0.0 0.0 112-113 3.5875000000000004 0.0 0.0 0.0 0.0 114-115 4.1125 0.0 0.0 0.0 0.0 116-117 4.8125 0.0 0.0 0.0 0.0 118-119 5.512499999999999 0.0 0.0 0.0 0.0 120-121 6.2 0.0 0.0 0.0 0.0 122-123 6.775 0.0 0.0 0.0 0.0 124-125 7.4625 0.0 0.0 0.0 0.0 126-127 8.1875 0.0 0.0 0.0 0.0 128-129 9.0 0.0 0.0 0.0 0.0 130-131 9.675 0.0 0.0 0.0 0.0 132-133 10.5875 0.0 0.0 0.0 0.0 134-135 11.3875 0.0 0.0 0.0 0.0 136-137 12.25 0.0 0.0 0.0 0.0 138-139 13.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 130 0.007040662 8.921538 65-69 >>END_MODULE SRR7171502 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171502_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0165 33.0 33.0 34.0 32.0 34.0 2 33.10675 34.0 33.0 34.0 32.0 34.0 3 33.0925 34.0 33.0 34.0 32.0 34.0 4 33.062 34.0 33.0 34.0 32.0 34.0 5 33.02525 34.0 33.0 34.0 32.0 34.0 6 37.19975 38.0 38.0 38.0 37.0 38.0 7 37.28475 38.0 38.0 38.0 37.0 38.0 8 37.22225 38.0 38.0 38.0 37.0 38.0 9 37.142 38.0 38.0 38.0 37.0 38.0 10-14 37.104299999999995 38.0 38.0 38.0 36.8 38.0 15-19 37.184749999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.18665 38.0 38.0 38.0 37.0 38.0 25-29 37.164750000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.14110000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.11615 38.0 38.0 38.0 36.8 38.0 40-44 37.05745 38.0 38.0 38.0 36.2 38.0 45-49 36.99545 38.0 38.0 38.0 36.0 38.0 50-54 36.957499999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.9204 38.0 38.0 38.0 36.0 38.0 60-64 36.88945 38.0 38.0 38.0 36.0 38.0 65-69 36.876450000000006 38.0 38.0 38.0 35.8 38.0 70-74 36.85224999999999 38.0 38.0 38.0 35.8 38.0 75-79 36.7099 38.0 38.0 38.0 34.6 38.0 80-84 36.693 38.0 38.0 38.0 34.8 38.0 85-89 36.620050000000006 38.0 38.0 38.0 34.6 38.0 90-94 36.53585 38.0 38.0 38.0 34.0 38.0 95-99 36.453450000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.29105 38.0 38.0 38.0 33.8 38.0 105-109 36.15145 38.0 37.6 38.0 33.4 38.0 110-114 35.9597 38.0 37.0 38.0 32.6 38.0 115-119 35.77335 38.0 37.0 38.0 31.0 38.0 120-124 35.6111 38.0 36.2 38.0 30.2 38.0 125-129 35.49249999999999 38.0 36.0 38.0 29.6 38.0 130-134 35.25314999999999 38.0 35.6 38.0 27.8 38.0 135-139 34.76665 38.0 35.0 38.0 25.4 38.0 140-144 34.5477 38.0 35.0 38.0 23.6 38.0 145-149 34.15985 38.0 33.6 38.0 23.0 38.0 150-151 31.275 35.5 27.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 8.0 17 4.0 18 7.0 19 6.0 20 8.0 21 3.0 22 8.0 23 9.0 24 8.0 25 17.0 26 20.0 27 23.0 28 25.0 29 30.0 30 43.0 31 67.0 32 66.0 33 114.0 34 146.0 35 273.0 36 629.0 37 2485.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.35 20.825 16.85 24.975 2 26.950000000000003 26.974999999999998 28.4 17.675 3 21.375 28.825 30.325000000000003 19.475 4 25.324999999999996 33.45 22.375 18.85 5 24.875 33.825 23.35 17.95 6 21.05 35.925000000000004 24.55 18.475 7 21.175 21.5 37.6 19.725 8 22.475 26.05 27.250000000000004 24.224999999999998 9 22.25 25.4 29.425 22.925 10-14 24.29 28.904999999999998 25.814999999999998 20.990000000000002 15-19 23.615 28.575 27.275 20.535 20-24 23.39 28.215 27.63 20.765 25-29 23.474999999999998 28.585 27.12 20.82 30-34 23.810000000000002 27.91 27.485 20.794999999999998 35-39 23.56 28.105000000000004 27.29 21.044999999999998 40-44 23.315 27.875 27.55 21.26 45-49 23.49 27.21 27.965 21.335 50-54 23.395 27.355 28.310000000000002 20.94 55-59 24.099999999999998 28.134999999999998 27.175 20.59 60-64 24.005000000000003 27.644999999999996 27.54 20.810000000000002 65-69 23.605 27.935 27.615000000000002 20.845 70-74 23.935000000000002 27.61 27.505000000000003 20.95 75-79 23.94 27.68 27.310000000000002 21.07 80-84 23.89 28.205000000000002 27.145000000000003 20.76 85-89 24.025 28.22 26.995 20.76 90-94 23.645 28.425 27.61 20.32 95-99 23.544999999999998 27.900000000000002 27.944999999999997 20.61 100-104 24.195 27.544999999999998 27.650000000000002 20.61 105-109 23.835 27.865000000000002 27.834999999999997 20.465 110-114 24.365000000000002 27.865000000000002 27.16 20.61 115-119 24.89 28.335 26.705000000000002 20.07 120-124 25.155 28.050000000000004 27.060000000000002 19.735 125-129 24.98 27.51 27.505000000000003 20.005 130-134 25.85 27.639999999999997 27.11 19.400000000000002 135-139 25.915 27.815 27.134999999999998 19.134999999999998 140-144 26.105 28.37 26.505000000000003 19.02 145-149 26.505000000000003 27.915 26.369999999999997 19.21 150-151 27.287499999999998 28.425 25.35 18.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 3.0 27 4.5 28 6.5 29 6.5 30 5.0 31 11.0 32 18.5 33 24.0 34 37.0 35 53.5 36 66.5 37 93.5 38 123.5 39 153.0 40 186.5 41 214.5 42 247.5 43 289.0 44 310.0 45 305.5 46 282.5 47 260.5 48 236.5 49 205.5 50 179.0 51 140.0 52 113.0 53 98.0 54 76.0 55 58.0 56 43.5 57 34.5 58 34.0 59 22.0 60 13.0 61 10.0 62 8.5 63 8.5 64 3.5 65 2.5 66 2.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.3375 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.275 0.0 0.0 0.0 0.0 112-113 3.7375 0.0 0.0 0.0 0.0 114-115 4.3125 0.0 0.0 0.0 0.0 116-117 5.025 0.0 0.0 0.0 0.0 118-119 5.725 0.0 0.0 0.0 0.0 120-121 6.4375 0.0 0.0 0.0 0.0 122-123 7.025 0.0 0.0 0.0 0.0 124-125 7.675 0.0 0.0 0.0 0.0 126-127 8.375 0.0 0.0 0.0 0.0 128-129 9.2 0.0 0.0 0.0 0.0 130-131 9.8875 0.0 0.0 0.0 0.0 132-133 10.7875 0.0 0.0 0.0 0.0 134-135 11.575 0.0 0.0 0.0 0.0 136-137 12.475 0.0 0.0 0.0 0.0 138-139 13.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCCCT 10 0.006830828 145.0 6 >>END_MODULE Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658953 spots for SRR7171502.sra Written 658953 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra Read 658944 spots for SRR7171502.sra Written 658944 spots for SRR7171502.sra SRR ids: ['SRR7171502.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q_mxi1a8 SRR7171502.sra spots: 13178889 blocks: [[1, 658944], [658945, 1317888], [1317889, 1976832], [1976833, 2635776], [2635777, 3294720], [3294721, 3953664], [3953665, 4612608], [4612609, 5271552], [5271553, 5930496], [5930497, 6589440], [6589441, 7248384], [7248385, 7907328], [7907329, 8566272], [8566273, 9225216], [9225217, 9884160], [9884161, 10543104], [10543105, 11202048], [11202049, 11860992], [11860993, 12519936], [12519937, 13178889]] SRR7171502 file size 4444192 SRR7171502 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171502 SRR7171502_1.fastq SRR7171502_2.fastq Input file: SRR7171502_1.fastq Paired file: SRR7171502_2.fastq trimmed: SRR7171502-trimmed-pair1.fastq, SRR7171502-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:06:43 2025 >> started Thu Feb 13 21:06:56 2025 >> done (13.250s) 13178889 read pairs processed; of these: 65 ( 0.00%) short read pairs filtered out after trimming by size control 14999 ( 0.11%) empty read pairs filtered out after trimming by size control 13163825 (99.89%) read pairs available; of these: 2740154 (20.82%) trimmed read pairs available after processing 10423671 (79.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 1 0.00% 21 3 0.00% 22 4 0.00% 23 2 0.00% 24 2 0.00% 25 1 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 2 0.00% 30 5 0.00% 31 1 0.00% 32 2 0.00% 33 5 0.00% 34 3 0.00% 35 5 0.00% 36 2 0.00% 37 5 0.00% 38 5 0.00% 39 9 0.00% 40 7 0.00% 41 11 0.00% 42 10 0.00% 43 3 0.00% 44 11 0.00% 45 13 0.00% 46 18 0.00% 47 16 0.00% 48 30 0.00% 49 18 0.00% 50 34 0.00% 51 53 0.00% 52 35 0.00% 53 54 0.00% 54 49 0.00% 55 54 0.00% 56 74 0.00% 57 80 0.00% 58 95 0.00% 59 118 0.00% 60 134 0.00% 61 161 0.00% 62 212 0.00% 63 215 0.00% 64 239 0.00% 65 305 0.00% 66 368 0.00% 67 360 0.00% 68 421 0.00% 69 503 0.00% 70 628 0.00% 71 732 0.01% 72 825 0.01% 73 991 0.01% 74 1133 0.01% 75 1272 0.01% 76 1525 0.01% 77 1630 0.01% 78 1823 0.01% 79 2171 0.02% 80 2471 0.02% 81 2957 0.02% 82 3439 0.03% 83 3802 0.03% 84 4376 0.03% 85 4896 0.04% 86 5390 0.04% 87 5946 0.05% 88 6503 0.05% 89 7197 0.05% 90 7870 0.06% 91 8916 0.07% 92 10086 0.08% 93 11319 0.09% 94 12244 0.09% 95 13310 0.10% 96 14359 0.11% 97 15168 0.12% 98 15952 0.12% 99 17378 0.13% 100 18237 0.14% 101 19528 0.15% 102 21548 0.16% 103 23088 0.18% 104 24763 0.19% 105 26126 0.20% 106 27622 0.21% 107 28551 0.22% 108 29320 0.22% 109 30701 0.23% 110 31433 0.24% 111 32882 0.25% 112 34910 0.27% 113 36620 0.28% 114 38819 0.29% 115 40555 0.31% 116 41937 0.32% 117 42251 0.32% 118 42974 0.33% 119 43965 0.33% 120 44978 0.34% 121 46194 0.35% 122 47997 0.36% 123 50599 0.38% 124 52357 0.40% 125 53147 0.40% 126 54996 0.42% 127 55426 0.42% 128 55681 0.42% 129 56552 0.43% 130 57177 0.43% 131 57878 0.44% 132 59138 0.45% 133 60782 0.46% 134 62273 0.47% 135 64359 0.49% 136 65121 0.49% 137 65136 0.49% 138 65619 0.50% 139 65378 0.50% 140 66235 0.50% 141 66348 0.50% 142 67629 0.51% 143 67978 0.52% 144 70076 0.53% 145 71281 0.54% 146 72296 0.55% 147 72528 0.55% 148 73037 0.55% 149 71940 0.55% 150 74105 0.56% 151 10423671 79.18% 13163825 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=24.91 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=5.1 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=33 prefix-density=0.36 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=189.07 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=27.1 sequence=GAGAAGAAGGAT SRR7171502 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:07:48 Started mapping on | Feb 13 21:07:48 Finished on | Feb 13 21:10:02 Mapping speed, Million of reads per hour | 353.65 Number of input reads | 13163825 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11963737 Uniquely mapped reads % | 90.88% Average mapped length | 290.89 Number of splices: Total | 11327963 Number of splices: Annotated (sjdb) | 11105487 Number of splices: GT/AG | 11135674 Number of splices: GC/AG | 150291 Number of splices: AT/AC | 8512 Number of splices: Non-canonical | 33486 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 349252 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 60965 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.84% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 850836 850836 850836 N_multimapping 349252 349252 349252 N_noFeature 319546 11853608 360346 N_ambiguous 129717 822 59946 UnstrandedReadsAssigned:11514474 PositiveStrandReadsAssigned:109307 NegativeStrandReadsAssigned:11543445 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7171502 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171502-trimmed-pair1.fastq SRR7171502-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,163,825 reads, 11,647,327 reads pseudoaligned [quant] estimated average fragment length: 203.661 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR7171502.ke.tsv 34699 SRR7171502.se.tsv 87100 total ==> SRR7171502.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1815.34 1102 52.89 Potri.005G024800.1.v4.1 1035 832.339 104 10.8864 Potri.004G059700.1.v4.1 961 758.339 11 1.2638 Potri.007G009000.2.v4.1 1416 1213.34 0 0 Potri.003G141000.2.v4.1 2943 2740.34 476.201 15.1404 Potri.016G087400.1.v4.1 270 94.6481 965.57 888.837 Potri.015G069301.1.v4.1 564 362.504 0 0 Potri.010G195200.1.v4.1 1773 1570.34 738 40.9461 Potri.012G127500.1.v4.1 977 774.339 5408 608.493 ==> SRR7171502.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 473 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 249 SRR7171502 completed mapping pipeline successfully