Starting /dee2/code/volunteer_pipeline.sh SRR7171503 current disk space = 3088242520064 free memory = 1535520460 SRR7171503 SRAfilesize 99bf800f0ec3b4baa94268b610f6475e SRR7171503.sra SRR7171503.sra file validated SRR7171503 is paired end SRR7171503 is conventional basespace SRR7171503 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171503_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.36975 33.0 33.0 34.0 32.0 34.0 2 32.86375 34.0 33.0 34.0 32.0 34.0 3 32.5475 33.0 33.0 34.0 30.0 34.0 4 31.9205 33.0 32.0 33.0 30.0 34.0 5 32.5975 33.0 33.0 33.0 32.0 34.0 6 36.49725 38.0 37.0 38.0 34.0 38.0 7 36.725 38.0 37.0 38.0 34.0 38.0 8 37.39025 38.0 38.0 38.0 37.0 38.0 9 37.50025 38.0 38.0 38.0 37.0 38.0 10-14 37.517700000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.5191 38.0 38.0 38.0 37.6 38.0 20-24 37.513799999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.50815 38.0 38.0 38.0 37.6 38.0 30-34 37.54554999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.499649999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.49294999999999 38.0 38.0 38.0 37.2 38.0 45-49 37.4188 38.0 38.0 38.0 37.0 38.0 50-54 37.387950000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.325149999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.3384 38.0 38.0 38.0 36.8 38.0 65-69 37.29735000000001 38.0 38.0 38.0 37.0 38.0 70-74 37.2374 38.0 38.0 38.0 36.4 38.0 75-79 37.13985 38.0 38.0 38.0 36.0 38.0 80-84 37.1308 38.0 38.0 38.0 36.0 38.0 85-89 37.074200000000005 38.0 38.0 38.0 36.0 38.0 90-94 37.041000000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.87885 38.0 38.0 38.0 35.2 38.0 100-104 36.78745 38.0 38.0 38.0 35.2 38.0 105-109 36.672 38.0 38.0 38.0 34.4 38.0 110-114 36.6797 38.0 38.0 38.0 34.2 38.0 115-119 36.5484 38.0 38.0 38.0 34.0 38.0 120-124 36.47935 38.0 38.0 38.0 34.0 38.0 125-129 36.36635 38.0 37.6 38.0 34.0 38.0 130-134 36.28 38.0 37.6 38.0 33.6 38.0 135-139 35.98535 38.0 36.4 38.0 33.0 38.0 140-144 35.84005 38.0 36.0 38.0 32.2 38.0 145-149 35.497749999999996 38.0 36.0 38.0 31.0 38.0 150-151 33.5655 36.5 32.0 38.0 21.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 0.0 24 6.0 25 8.0 26 13.0 27 8.0 28 14.0 29 23.0 30 30.0 31 46.0 32 55.0 33 64.0 34 132.0 35 215.0 36 571.0 37 2812.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.62796833773087 11.688654353562006 10.949868073878628 38.733509234828496 2 20.95 14.424999999999999 33.85 30.775000000000002 3 19.175 17.05 25.874999999999996 37.9 4 21.55 23.549999999999997 24.575 30.325000000000003 5 21.775 30.175 25.4 22.650000000000002 6 19.25 34.175 25.775 20.8 7 14.575 27.325 40.25 17.849999999999998 8 18.175 26.224999999999998 31.3 24.3 9 18.05 24.775 34.275 22.900000000000002 10-14 19.814999999999998 29.585 27.715 22.884999999999998 15-19 20.150000000000002 28.560000000000002 28.285 23.005 20-24 19.785 27.825 28.975 23.415 25-29 19.580000000000002 28.685 28.34 23.395 30-34 19.775000000000002 28.535 28.205000000000002 23.485 35-39 19.725 27.944999999999997 28.65 23.68 40-44 19.919999999999998 27.894999999999996 28.185 24.0 45-49 20.21 28.365000000000002 27.77 23.655 50-54 19.064999999999998 28.560000000000002 28.185 24.19 55-59 19.5 28.525 28.044999999999998 23.93 60-64 19.845 27.93 28.07 24.154999999999998 65-69 20.080000000000002 28.615000000000002 27.584999999999997 23.72 70-74 20.24 27.99 28.02 23.75 75-79 19.77 27.99 27.985 24.255 80-84 20.395 28.565 27.785 23.255 85-89 19.855 28.560000000000002 27.98 23.605 90-94 20.05 27.66 28.63 23.66 95-99 20.580000000000002 27.985 27.939999999999998 23.494999999999997 100-104 20.495 28.27 27.544999999999998 23.69 105-109 20.315 28.525 27.32 23.84 110-114 20.474999999999998 27.35 28.53 23.645 115-119 20.119999999999997 28.655 27.785 23.44 120-124 20.369999999999997 28.235 27.189999999999998 24.205 125-129 20.244999999999997 28.025 27.439999999999998 24.29 130-134 20.985 28.15 27.365000000000002 23.5 135-139 20.635 27.775 27.72 23.87 140-144 20.79 28.050000000000004 27.1 24.060000000000002 145-149 20.885 27.99 27.334999999999997 23.79 150-151 20.575 26.987499999999997 27.85 24.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 3.5 25 3.5 26 1.0 27 4.0 28 10.0 29 13.5 30 13.5 31 17.0 32 27.0 33 36.0 34 47.5 35 66.5 36 88.0 37 102.0 38 116.5 39 158.0 40 216.5 41 245.0 42 259.5 43 278.5 44 293.5 45 291.0 46 258.5 47 247.0 48 248.0 49 223.5 50 175.0 51 131.0 52 112.0 53 81.0 54 56.5 55 46.0 56 34.0 57 28.0 58 19.0 59 13.0 60 8.0 61 5.0 62 4.0 63 3.5 64 4.0 65 2.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7749999999999999 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.5499999999999998 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.425 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACAA 10 0.0060887975 150.61038 1 >>END_MODULE SRR7171503 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171503_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9385 33.0 33.0 34.0 32.0 34.0 2 33.04425 33.0 33.0 34.0 32.0 34.0 3 33.062 34.0 33.0 34.0 32.0 34.0 4 32.99975 34.0 33.0 34.0 32.0 34.0 5 32.97575 34.0 33.0 34.0 32.0 34.0 6 37.187 38.0 38.0 38.0 37.0 38.0 7 37.2035 38.0 38.0 38.0 37.0 38.0 8 37.20625 38.0 38.0 38.0 37.0 38.0 9 37.21875 38.0 38.0 38.0 37.0 38.0 10-14 37.0839 38.0 38.0 38.0 36.4 38.0 15-19 37.15925 38.0 38.0 38.0 36.4 38.0 20-24 37.19414999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.1644 38.0 38.0 38.0 36.6 38.0 30-34 37.15955 38.0 38.0 38.0 36.4 38.0 35-39 37.12425 38.0 38.0 38.0 36.4 38.0 40-44 37.06495 38.0 38.0 38.0 36.0 38.0 45-49 37.0367 38.0 38.0 38.0 36.0 38.0 50-54 37.03060000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.9311 38.0 38.0 38.0 35.6 38.0 60-64 36.869299999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.89735 38.0 38.0 38.0 35.6 38.0 70-74 36.78535 38.0 38.0 38.0 35.2 38.0 75-79 36.7664 38.0 38.0 38.0 35.0 38.0 80-84 36.73905 38.0 38.0 38.0 34.8 38.0 85-89 36.587450000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.4972 38.0 38.0 38.0 34.0 38.0 95-99 36.4103 38.0 38.0 38.0 34.0 38.0 100-104 36.32674999999999 38.0 37.8 38.0 33.8 38.0 105-109 36.21845 38.0 37.4 38.0 33.4 38.0 110-114 35.896150000000006 38.0 37.0 38.0 32.0 38.0 115-119 35.75075 38.0 36.6 38.0 31.2 38.0 120-124 35.5426 38.0 36.0 38.0 30.0 38.0 125-129 35.47865 38.0 36.0 38.0 29.4 38.0 130-134 35.2401 38.0 35.6 38.0 28.0 38.0 135-139 34.858799999999995 38.0 35.0 38.0 26.8 38.0 140-144 34.541450000000005 38.0 35.0 38.0 23.8 38.0 145-149 34.1269 38.0 33.6 38.0 23.0 38.0 150-151 31.313125 35.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 3.0 17 5.0 18 3.0 19 3.0 20 5.0 21 5.0 22 1.0 23 11.0 24 7.0 25 12.0 26 20.0 27 23.0 28 31.0 29 36.0 30 45.0 31 61.0 32 81.0 33 115.0 34 148.0 35 319.0 36 731.0 37 2334.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.375 20.25 16.55 25.825 2 25.8 26.275 29.325000000000003 18.6 3 21.349999999999998 28.425 29.9 20.325 4 23.875 34.55 23.875 17.7 5 24.925 34.375 22.95 17.75 6 21.375 38.3 22.275 18.05 7 20.225 21.775 38.675 19.325 8 21.6 25.474999999999998 27.525 25.4 9 21.7 25.525 30.225 22.55 10-14 24.01 29.580000000000002 25.669999999999998 20.74 15-19 23.52 28.794999999999998 27.405 20.28 20-24 22.720000000000002 28.96 27.6 20.72 25-29 23.294999999999998 28.92 27.025 20.76 30-34 22.88 28.355000000000004 27.975 20.79 35-39 23.135 28.71 27.615000000000002 20.54 40-44 23.02 28.610000000000003 27.565 20.805 45-49 23.575 28.505000000000003 26.985 20.935000000000002 50-54 23.54 28.435 27.375 20.65 55-59 23.655 27.650000000000002 27.865000000000002 20.830000000000002 60-64 23.3 28.349999999999998 27.675 20.674999999999997 65-69 23.305 28.035 27.775 20.885 70-74 23.505000000000003 28.465 27.92 20.11 75-79 23.51 28.325 27.400000000000002 20.765 80-84 23.585 28.32 28.025 20.07 85-89 23.73 28.83 27.139999999999997 20.3 90-94 23.52 28.904999999999998 27.91 19.665 95-99 23.735 27.839999999999996 27.865000000000002 20.560000000000002 100-104 23.945 28.48 27.325 20.25 105-109 23.735 28.265 27.68 20.32 110-114 23.93 28.035 27.735 20.3 115-119 24.095 28.53 27.365000000000002 20.01 120-124 24.51 28.29 27.16 20.04 125-129 24.235 28.37 27.605 19.79 130-134 24.705 27.88 27.529999999999998 19.885 135-139 24.32 28.465 26.905 20.31 140-144 24.935 28.365000000000002 27.189999999999998 19.509999999999998 145-149 25.2 28.13 27.200000000000003 19.470000000000002 150-151 25.3 28.000000000000004 27.462500000000002 19.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 0.0 24 1.5 25 2.0 26 2.5 27 4.0 28 4.0 29 3.0 30 6.0 31 9.0 32 12.0 33 29.0 34 42.5 35 51.5 36 79.5 37 109.5 38 137.0 39 177.0 40 214.5 41 244.0 42 287.0 43 320.0 44 310.5 45 295.5 46 290.0 47 261.0 48 213.0 49 181.0 50 161.5 51 139.5 52 110.0 53 84.0 54 62.5 55 39.5 56 28.0 57 23.5 58 18.0 59 11.0 60 9.0 61 7.0 62 3.0 63 2.5 64 3.0 65 2.5 66 2.0 67 2.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16687705124968 98.2 2 0.7321383489017925 1.4500000000000002 3 0.07573844988639232 0.22499999999999998 4 0.0 0.0 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.725 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.3499999999999996 0.0 0.0 0.0 0.0 126-127 3.725 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.5375 0.0 0.0 0.0 0.0 132-133 5.025 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.1375 0.0 0.0 0.0 0.0 138-139 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTGT 10 0.006830828 145.0 3 TTTGATG 10 0.006830828 145.0 2 >>END_MODULE Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854632 spots for SRR7171503.sra Written 854632 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra Read 854629 spots for SRR7171503.sra Written 854629 spots for SRR7171503.sra SRR ids: ['SRR7171503.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qhlijv9q SRR7171503.sra spots: 17092583 blocks: [[1, 854629], [854630, 1709258], [1709259, 2563887], [2563888, 3418516], [3418517, 4273145], [4273146, 5127774], [5127775, 5982403], [5982404, 6837032], [6837033, 7691661], [7691662, 8546290], [8546291, 9400919], [9400920, 10255548], [10255549, 11110177], [11110178, 11964806], [11964807, 12819435], [12819436, 13674064], [13674065, 14528693], [14528694, 15383322], [15383323, 16237951], [16237952, 17092583]] SRR7171503 file size 5770415 SRR7171503 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171503 SRR7171503_1.fastq SRR7171503_2.fastq Input file: SRR7171503_1.fastq Paired file: SRR7171503_2.fastq trimmed: SRR7171503-trimmed-pair1.fastq, SRR7171503-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:16:47 2025 >> started Thu Feb 13 21:17:05 2025 >> done (18.050s) 17092583 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 1627 ( 0.01%) empty read pairs filtered out after trimming by size control 17090929 (99.99%) read pairs available; of these: 2001855 (11.71%) trimmed read pairs available after processing 15089074 (88.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 5 0.00% 24 0 0.00% 25 1 0.00% 26 2 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 3 0.00% 31 1 0.00% 32 1 0.00% 33 3 0.00% 34 0 0.00% 35 1 0.00% 36 5 0.00% 37 1 0.00% 38 2 0.00% 39 3 0.00% 40 3 0.00% 41 3 0.00% 42 1 0.00% 43 6 0.00% 44 7 0.00% 45 5 0.00% 46 11 0.00% 47 6 0.00% 48 5 0.00% 49 16 0.00% 50 13 0.00% 51 16 0.00% 52 18 0.00% 53 19 0.00% 54 32 0.00% 55 26 0.00% 56 32 0.00% 57 35 0.00% 58 41 0.00% 59 58 0.00% 60 65 0.00% 61 65 0.00% 62 102 0.00% 63 122 0.00% 64 136 0.00% 65 140 0.00% 66 169 0.00% 67 221 0.00% 68 211 0.00% 69 253 0.00% 70 328 0.00% 71 382 0.00% 72 470 0.00% 73 577 0.00% 74 619 0.00% 75 717 0.00% 76 839 0.00% 77 926 0.01% 78 1115 0.01% 79 1203 0.01% 80 1417 0.01% 81 1656 0.01% 82 1891 0.01% 83 2121 0.01% 84 2415 0.01% 85 2842 0.02% 86 3049 0.02% 87 3345 0.02% 88 3717 0.02% 89 4075 0.02% 90 4579 0.03% 91 4982 0.03% 92 5714 0.03% 93 6177 0.04% 94 7055 0.04% 95 7546 0.04% 96 8090 0.05% 97 8967 0.05% 98 9407 0.06% 99 9894 0.06% 100 10880 0.06% 101 11570 0.07% 102 12553 0.07% 103 13344 0.08% 104 14283 0.08% 105 15149 0.09% 106 16496 0.10% 107 17103 0.10% 108 17855 0.10% 109 18798 0.11% 110 19559 0.11% 111 20400 0.12% 112 21318 0.12% 113 23022 0.13% 114 23930 0.14% 115 25426 0.15% 116 26677 0.16% 117 27657 0.16% 118 28831 0.17% 119 29458 0.17% 120 30271 0.18% 121 31409 0.18% 122 32859 0.19% 123 34124 0.20% 124 35706 0.21% 125 36513 0.21% 126 38212 0.22% 127 39629 0.23% 128 41020 0.24% 129 41567 0.24% 130 42351 0.25% 131 43392 0.25% 132 44618 0.26% 133 46043 0.27% 134 47299 0.28% 135 48645 0.28% 136 49793 0.29% 137 51529 0.30% 138 52582 0.31% 139 53122 0.31% 140 54127 0.32% 141 55152 0.32% 142 56613 0.33% 143 57295 0.34% 144 59050 0.35% 145 60573 0.35% 146 60771 0.36% 147 62071 0.36% 148 63606 0.37% 149 63762 0.37% 150 65851 0.39% 151 15089074 88.29% 17090929 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=25 prefix-density=1.00 prefix-fanout=1.6 sequence=TTCTCAGCACCAAAGTTCATCTCAGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=21.20 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.5 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=26 prefix-density=0.68 prefix-fanout=3.1 sequence=TGCAAGTGCGGCAGTGGCTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=24.89 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=9.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171503 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:17:51 Started mapping on | Feb 13 21:17:51 Finished on | Feb 13 21:20:08 Mapping speed, Million of reads per hour | 449.10 Number of input reads | 17090929 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15792670 Uniquely mapped reads % | 92.40% Average mapped length | 295.75 Number of splices: Total | 15456807 Number of splices: Annotated (sjdb) | 15134783 Number of splices: GT/AG | 15208200 Number of splices: GC/AG | 197274 Number of splices: AT/AC | 11420 Number of splices: Non-canonical | 39913 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403451 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 129498 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.31% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 894808 894808 894808 N_multimapping 403451 403451 403451 N_noFeature 422721 15638931 482790 N_ambiguous 168018 965 73779 UnstrandedReadsAssigned:15201931 PositiveStrandReadsAssigned:152774 NegativeStrandReadsAssigned:15236101 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171503 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171503-trimmed-pair1.fastq SRR7171503-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,090,929 reads, 15,287,898 reads pseudoaligned [quant] estimated average fragment length: 228.913 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7171503.ke.tsv 34699 SRR7171503.se.tsv 87100 total ==> SRR7171503.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.09 1407 47.1219 Potri.005G024800.1.v4.1 1035 807.087 214 15.8963 Potri.004G059700.1.v4.1 961 733.087 22 1.79916 Potri.007G009000.2.v4.1 1416 1188.09 0 0 Potri.003G141000.2.v4.1 2943 2715.09 694.946 15.3451 Potri.016G087400.1.v4.1 270 81.8981 1128 825.731 Potri.015G069301.1.v4.1 564 338.153 0 0 Potri.010G195200.1.v4.1 1773 1545.09 401.868 15.5931 Potri.012G127500.1.v4.1 977 749.087 7146 571.918 ==> SRR7171503.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 68 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 610 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 537 SRR7171503 completed mapping pipeline successfully