Starting /dee2/code/volunteer_pipeline.sh SRR7171504 current disk space = 3087918469120 free memory = 1482525028 SRR7171504 SRAfilesize 32dc9602617f3a1554b006ef8a12e2cd SRR7171504.sra SRR7171504.sra file validated SRR7171504 is paired end SRR7171504 is conventional basespace SRR7171504 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171504_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70175 33.0 33.0 34.0 32.0 34.0 2 32.97825 34.0 33.0 34.0 31.0 34.0 3 32.88725 33.0 33.0 34.0 32.0 34.0 4 31.88975 33.0 32.0 33.0 31.0 34.0 5 32.68425 33.0 33.0 33.0 32.0 34.0 6 36.54325 38.0 37.0 38.0 34.0 38.0 7 36.99 38.0 37.0 38.0 35.0 38.0 8 37.40225 38.0 38.0 38.0 37.0 38.0 9 37.4775 38.0 38.0 38.0 37.0 38.0 10-14 37.4987 38.0 38.0 38.0 37.8 38.0 15-19 37.369 38.0 38.0 38.0 37.0 38.0 20-24 37.502750000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.54055 38.0 38.0 38.0 38.0 38.0 30-34 37.5321 38.0 38.0 38.0 38.0 38.0 35-39 37.48275 38.0 38.0 38.0 37.8 38.0 40-44 37.37599999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.2984 38.0 38.0 38.0 37.0 38.0 50-54 37.1206 38.0 38.0 38.0 36.2 38.0 55-59 37.15605000000001 38.0 38.0 38.0 36.2 38.0 60-64 37.2906 38.0 38.0 38.0 37.0 38.0 65-69 37.288149999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.2278 38.0 38.0 38.0 36.6 38.0 75-79 37.15670000000001 38.0 38.0 38.0 36.2 38.0 80-84 37.13945 38.0 38.0 38.0 36.0 38.0 85-89 36.9528 38.0 38.0 38.0 35.8 38.0 90-94 36.9259 38.0 38.0 38.0 35.8 38.0 95-99 36.87375 38.0 38.0 38.0 35.0 38.0 100-104 36.81795 38.0 38.0 38.0 35.0 38.0 105-109 36.66205 38.0 38.0 38.0 34.2 38.0 110-114 36.483799999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.417899999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.3097 38.0 37.6 38.0 33.6 38.0 125-129 36.222300000000004 38.0 37.4 38.0 33.4 38.0 130-134 36.11595 38.0 37.0 38.0 33.0 38.0 135-139 35.87675 38.0 36.2 38.0 32.0 38.0 140-144 35.462900000000005 38.0 35.8 38.0 30.0 38.0 145-149 35.28305 38.0 35.6 38.0 29.8 38.0 150-151 32.571875 35.5 29.5 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 0.0 23 7.0 24 5.0 25 4.0 26 12.0 27 17.0 28 27.0 29 20.0 30 41.0 31 37.0 32 51.0 33 85.0 34 116.0 35 211.0 36 601.0 37 2759.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.56654947262682 11.526870919136112 9.367152184831742 36.53942742340532 2 22.95 13.65 32.85 30.55 3 19.75 19.15 26.8 34.300000000000004 4 22.475 27.325 22.825 27.375 5 22.95 31.4 23.625 22.025 6 19.625 35.375 23.925 21.075 7 14.524999999999999 25.025 42.699999999999996 17.75 8 18.275 25.900000000000002 30.325000000000003 25.5 9 17.299999999999997 24.575 33.275 24.85 10-14 19.84 29.765000000000004 26.47 23.925 15-19 19.515 28.610000000000003 28.035 23.84 20-24 20.07 28.199999999999996 27.944999999999997 23.785 25-29 19.75 28.655 27.405 24.19 30-34 20.061003050152507 29.206460323016152 27.171358567928394 23.561178058902946 35-39 19.744936234058514 28.16704176044011 27.666916729182294 24.42110527631908 40-44 19.86897379475895 29.170834166833366 27.340468093618725 23.61972394478896 45-49 20.2020202020202 28.472847284728473 27.117711771177117 24.207420742074206 50-54 20.369999999999997 28.575 27.384999999999998 23.669999999999998 55-59 20.3 28.98 27.029999999999998 23.69 60-64 19.86 28.535 27.575 24.03 65-69 19.814999999999998 28.035 27.939999999999998 24.21 70-74 19.735 28.325 27.825 24.115000000000002 75-79 19.919999999999998 27.79 28.060000000000002 24.23 80-84 20.630000000000003 27.92 27.884999999999998 23.565 85-89 20.27 28.615000000000002 27.474999999999998 23.64 90-94 20.035 28.305000000000003 27.675 23.985 95-99 20.29 28.26 28.15 23.3 100-104 20.395 28.860000000000003 27.375 23.369999999999997 105-109 20.880000000000003 27.865000000000002 27.534999999999997 23.72 110-114 20.635 27.93 27.865000000000002 23.57 115-119 20.369999999999997 28.255000000000003 27.62 23.755000000000003 120-124 21.21 28.29 26.765 23.735 125-129 20.974999999999998 27.93 27.525 23.57 130-134 20.375 28.595 27.12 23.91 135-139 21.015 28.575 26.99 23.419999999999998 140-144 20.445 28.285 27.065 24.205 145-149 20.875 28.175 26.75 24.2 150-151 21.175 27.712500000000002 26.375 24.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 2.5 24 3.5 25 1.5 26 1.5 27 3.0 28 7.0 29 11.5 30 11.0 31 15.5 32 27.0 33 37.0 34 46.5 35 64.0 36 72.5 37 92.0 38 134.0 39 171.0 40 208.0 41 229.0 42 246.0 43 264.0 44 278.5 45 278.5 46 271.5 47 264.5 48 233.5 49 201.5 50 172.0 51 138.0 52 120.0 53 107.0 54 75.0 55 50.0 56 41.5 57 32.5 58 21.5 59 12.5 60 7.5 61 8.5 62 7.0 63 4.5 64 4.5 65 3.0 66 3.0 67 2.5 68 2.0 69 1.5 70 1.5 71 1.5 72 1.5 73 2.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.025 40-44 0.02 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.8875000000000002 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.3499999999999996 0.0 0.0 0.0 0.0 120-121 2.6 0.0 0.0 0.0 0.0 122-123 2.875 0.0 0.0 0.0 0.0 124-125 3.1625 0.0 0.0 0.0 0.0 126-127 3.4625 0.0 0.0 0.0 0.0 128-129 3.775 0.0 0.0 0.0 0.0 130-131 4.262499999999999 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.4 0.0 0.0 0.0 0.0 136-137 5.8625 0.0 0.0 0.0 0.0 138-139 6.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCTCC 10 0.006830828 145.0 5 GCTCGAG 10 0.006830828 145.0 145 >>END_MODULE SRR7171504 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171504_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98775 33.0 33.0 34.0 32.0 34.0 2 32.99275 34.0 33.0 34.0 32.0 34.0 3 33.08025 34.0 33.0 34.0 32.0 34.0 4 33.0315 34.0 33.0 34.0 32.0 34.0 5 33.00675 34.0 33.0 34.0 32.0 34.0 6 36.99825 38.0 38.0 38.0 36.0 38.0 7 37.1255 38.0 38.0 38.0 37.0 38.0 8 37.14275 38.0 38.0 38.0 37.0 38.0 9 37.086 38.0 38.0 38.0 37.0 38.0 10-14 37.04135 38.0 38.0 38.0 37.0 38.0 15-19 36.96895 38.0 38.0 38.0 36.6 38.0 20-24 37.04145 38.0 38.0 38.0 37.0 38.0 25-29 37.076350000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.058099999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.0107 38.0 38.0 38.0 36.8 38.0 40-44 36.9428 38.0 38.0 38.0 36.0 38.0 45-49 36.91025 38.0 38.0 38.0 36.0 38.0 50-54 36.8357 38.0 38.0 38.0 35.8 38.0 55-59 36.788050000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.77055 38.0 38.0 38.0 35.8 38.0 65-69 36.811400000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.766149999999996 38.0 38.0 38.0 35.4 38.0 75-79 36.802 38.0 38.0 38.0 35.8 38.0 80-84 36.77290000000001 38.0 38.0 38.0 35.6 38.0 85-89 36.6288 38.0 38.0 38.0 35.2 38.0 90-94 36.474599999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.43300000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.32965 38.0 38.0 38.0 34.0 38.0 105-109 36.25085 38.0 38.0 38.0 34.0 38.0 110-114 36.035199999999996 38.0 37.8 38.0 33.2 38.0 115-119 35.98955 38.0 37.0 38.0 33.0 38.0 120-124 35.834950000000006 38.0 37.2 38.0 31.6 38.0 125-129 35.63164999999999 38.0 36.4 38.0 30.6 38.0 130-134 35.63455 38.0 36.2 38.0 31.0 38.0 135-139 35.172900000000006 38.0 35.8 38.0 28.4 38.0 140-144 34.8301 38.0 34.6 38.0 27.0 38.0 145-149 34.43955 38.0 33.2 38.0 24.6 38.0 150-151 31.88025 35.5 28.0 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 5.0 16 12.0 17 8.0 18 9.0 19 10.0 20 5.0 21 4.0 22 10.0 23 8.0 24 13.0 25 13.0 26 20.0 27 25.0 28 33.0 29 21.0 30 36.0 31 49.0 32 64.0 33 79.0 34 114.0 35 243.0 36 537.0 37 2676.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.475 20.625 15.950000000000001 25.95 2 27.795846885163872 25.41906429822367 29.09682261696272 17.68826619964974 3 19.73980485364023 30.197648236177134 29.797348011008257 20.26519889917438 4 25.03751875937969 32.06603301650826 23.686843421710854 19.209604802401202 5 23.88694347173587 36.06803401700851 22.436218109054526 17.608804402201102 6 20.826032540675847 37.02127659574468 23.454317897371716 18.69837296620776 7 20.480721081622434 21.081622433650477 39.00851276915373 19.42914371557336 8 22.102628285356694 24.680851063829788 27.734668335419272 25.481852315394242 9 21.056584877315974 25.31296945418127 29.494241362043066 24.13620430645969 10-14 23.31380501727505 28.44624705823444 26.53347353662811 21.7064743878624 15-19 22.745255145475486 28.023436326305774 27.89323451349592 21.33807401472282 20-24 23.09964947421132 28.292438657986978 27.356034051076616 21.251877816725088 25-29 23.158526821457166 28.753002401921535 27.04163330664532 21.046837469975983 30-34 23.00920368147259 27.67607042817127 28.11124449779912 21.203481392557023 35-39 23.006902070621184 28.093428028408525 27.643292987896366 21.25637691307392 40-44 23.533533533533532 27.78778778778779 27.862862862862865 20.815815815815817 45-49 23.234852278417627 27.801702553830747 28.022033049574365 20.941412118177265 50-54 23.303450693644514 28.071317674162366 27.95111934692242 20.674112285270695 55-59 23.650205349093458 28.04267254332365 27.917459681458478 20.38966242612441 60-64 23.08193108974359 28.01983173076923 28.084935897435898 20.813301282051285 65-69 23.521754368397335 28.238121463976366 27.882641566114252 20.357482601512043 70-74 23.643003652008606 27.825303917154436 27.86032317774776 20.6713692530892 75-79 23.12731273127313 28.12281228122812 28.112811281128113 20.637063706370636 80-84 23.236161808090404 28.41642082104105 27.661383069153455 20.686034301715086 85-89 24.551047971587213 28.31274073333 27.07718473312991 20.059026561952876 90-94 23.31147048515496 28.698743303459672 27.502127872628044 20.487658338757324 95-99 23.726521412471826 27.918858001502628 27.58327072376659 20.771349862258955 100-104 24.1196212994039 28.101988679056255 27.285478134548914 20.49291188699093 105-109 23.965534515579602 27.642520789500054 27.862939585211905 20.529005109708446 110-114 23.43569961424778 27.989579680376735 28.059716447071793 20.515004258303694 115-119 24.420177328056905 28.20718328908481 27.46581175174072 19.90682763111757 120-124 24.48161875187819 27.797255334067916 27.737153160372635 19.983972753681257 125-129 24.534441329595513 27.843412094513415 27.352823388065676 20.269323187825393 130-134 24.24667133847232 27.94073480828912 27.54529982981279 20.26729402342577 135-139 24.77588020233385 27.1147393198778 28.071317674162366 20.038062803625984 140-144 24.356276926159705 27.968139464983473 27.45716862037872 20.21841498847811 145-149 24.62424849699399 27.5250501002004 27.635270541082164 20.215430861723448 150-151 24.840285606914694 27.195289991231363 27.771514468245023 20.19290993360892 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 1.5 20 1.0 21 1.0 22 1.0 23 0.5 24 1.5 25 2.0 26 2.5 27 3.0 28 4.5 29 8.0 30 9.5 31 15.0 32 25.5 33 31.0 34 37.5 35 54.5 36 87.5 37 106.0 38 127.5 39 167.0 40 199.5 41 221.5 42 244.5 43 287.5 44 303.5 45 287.5 46 281.5 47 267.5 48 245.5 49 215.0 50 161.5 51 123.5 52 112.5 53 99.0 54 70.5 55 46.5 56 32.5 57 23.0 58 18.5 59 13.0 60 11.0 61 7.0 62 5.0 63 7.0 64 6.5 65 4.0 66 2.0 67 2.5 68 2.0 69 1.0 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.05 5 0.05 6 0.125 7 0.15 8 0.125 9 0.15 10-14 0.145 15-19 0.155 20-24 0.15 25-29 0.08 30-34 0.04 35-39 0.03 40-44 0.1 45-49 0.15 50-54 0.165 55-59 0.16999999999999998 60-64 0.16 65-69 0.135 70-74 0.055 75-79 0.01 80-84 0.005 85-89 0.045 90-94 0.135 95-99 0.17500000000000002 100-104 0.185 105-109 0.19 110-114 0.19499999999999998 115-119 0.185 120-124 0.16999999999999998 125-129 0.12 130-134 0.11 135-139 0.165 140-144 0.19 145-149 0.2 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.2125 0.0 0.0 0.0 0.0 126-127 3.5250000000000004 0.0 0.0 0.0 0.0 128-129 3.8375 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.8625 0.0 0.0 0.0 0.0 134-135 5.425 0.0 0.0 0.0 0.0 136-137 5.8875 0.0 0.0 0.0 0.0 138-139 6.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826901 spots for SRR7171504.sra Written 826901 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra Read 826889 spots for SRR7171504.sra Written 826889 spots for SRR7171504.sra SRR ids: ['SRR7171504.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rbr7ozi0 SRR7171504.sra spots: 16537792 blocks: [[1, 826889], [826890, 1653778], [1653779, 2480667], [2480668, 3307556], [3307557, 4134445], [4134446, 4961334], [4961335, 5788223], [5788224, 6615112], [6615113, 7442001], [7442002, 8268890], [8268891, 9095779], [9095780, 9922668], [9922669, 10749557], [10749558, 11576446], [11576447, 12403335], [12403336, 13230224], [13230225, 14057113], [14057114, 14884002], [14884003, 15710891], [15710892, 16537792]] SRR7171504 file size 5582414 SRR7171504 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171504 SRR7171504_1.fastq SRR7171504_2.fastq Input file: SRR7171504_1.fastq Paired file: SRR7171504_2.fastq trimmed: SRR7171504-trimmed-pair1.fastq, SRR7171504-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:54:14 2025 >> started Thu Feb 13 20:54:33 2025 >> done (18.759s) 16537792 read pairs processed; of these: 116 ( 0.00%) short read pairs filtered out after trimming by size control 1454 ( 0.01%) empty read pairs filtered out after trimming by size control 16536222 (99.99%) read pairs available; of these: 1748243 (10.57%) trimmed read pairs available after processing 14787979 (89.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 4 0.00% 30 1 0.00% 31 3 0.00% 32 0 0.00% 33 1 0.00% 34 1 0.00% 35 2 0.00% 36 1 0.00% 37 3 0.00% 38 5 0.00% 39 1 0.00% 40 6 0.00% 41 2 0.00% 42 3 0.00% 43 4 0.00% 44 1 0.00% 45 5 0.00% 46 3 0.00% 47 7 0.00% 48 9 0.00% 49 9 0.00% 50 13 0.00% 51 11 0.00% 52 23 0.00% 53 28 0.00% 54 27 0.00% 55 28 0.00% 56 39 0.00% 57 41 0.00% 58 38 0.00% 59 52 0.00% 60 64 0.00% 61 64 0.00% 62 94 0.00% 63 109 0.00% 64 111 0.00% 65 129 0.00% 66 161 0.00% 67 197 0.00% 68 206 0.00% 69 251 0.00% 70 315 0.00% 71 339 0.00% 72 416 0.00% 73 446 0.00% 74 557 0.00% 75 638 0.00% 76 706 0.00% 77 883 0.01% 78 908 0.01% 79 1120 0.01% 80 1278 0.01% 81 1533 0.01% 82 1618 0.01% 83 1893 0.01% 84 2170 0.01% 85 2365 0.01% 86 2656 0.02% 87 2990 0.02% 88 3221 0.02% 89 3559 0.02% 90 3847 0.02% 91 4472 0.03% 92 4974 0.03% 93 5633 0.03% 94 6066 0.04% 95 6662 0.04% 96 7091 0.04% 97 7683 0.05% 98 8157 0.05% 99 8888 0.05% 100 9327 0.06% 101 10106 0.06% 102 10677 0.06% 103 11925 0.07% 104 12667 0.08% 105 13367 0.08% 106 13996 0.08% 107 14816 0.09% 108 15353 0.09% 109 16011 0.10% 110 16887 0.10% 111 17678 0.11% 112 18759 0.11% 113 19836 0.12% 114 20957 0.13% 115 22314 0.13% 116 23555 0.14% 117 25391 0.15% 118 26607 0.16% 119 26901 0.16% 120 26066 0.16% 121 27005 0.16% 122 27839 0.17% 123 29312 0.18% 124 30825 0.19% 125 31704 0.19% 126 32555 0.20% 127 33670 0.20% 128 33792 0.20% 129 34728 0.21% 130 35837 0.22% 131 36925 0.22% 132 37883 0.23% 133 39531 0.24% 134 41105 0.25% 135 42082 0.25% 136 42889 0.26% 137 43795 0.26% 138 44901 0.27% 139 45531 0.28% 140 46672 0.28% 141 48920 0.30% 142 49695 0.30% 143 53495 0.32% 144 54151 0.33% 145 55502 0.34% 146 52816 0.32% 147 55443 0.34% 148 56805 0.34% 149 55745 0.34% 150 59042 0.36% 151 14787979 89.43% 16536222 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=30 prefix-density=0.19 prefix-fanout=2.8 sequence=GCATCTCTCATTGCCTTCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=376.50 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=32.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.10 fanout-score-rank=20 prefix-density=0.31 prefix-fanout=4.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=312.89 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=30.1 sequence=GAAGAAGAAGAAA SRR7171504 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:55:15 Started mapping on | Feb 13 20:55:15 Finished on | Feb 13 20:56:52 Mapping speed, Million of reads per hour | 613.72 Number of input reads | 16536222 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15501894 Uniquely mapped reads % | 93.75% Average mapped length | 296.17 Number of splices: Total | 15691864 Number of splices: Annotated (sjdb) | 15447389 Number of splices: GT/AG | 15452998 Number of splices: GC/AG | 191511 Number of splices: AT/AC | 10661 Number of splices: Non-canonical | 36694 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393702 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 147965 % of reads mapped to too many loci | 0.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 640627 640627 640627 N_multimapping 393702 393702 393702 N_noFeature 332747 15376232 384813 N_ambiguous 140827 1002 66545 UnstrandedReadsAssigned:15028320 PositiveStrandReadsAssigned:124660 NegativeStrandReadsAssigned:15050536 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171504 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171504-trimmed-pair1.fastq SRR7171504-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,536,222 reads, 15,165,527 reads pseudoaligned [quant] estimated average fragment length: 236.661 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7171504.ke.tsv 34699 SRR7171504.se.tsv 87100 total ==> SRR7171504.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.34 646.509 23.4228 Potri.005G024800.1.v4.1 1035 799.339 125 10.098 Potri.004G059700.1.v4.1 961 725.351 26 2.31462 Potri.007G009000.2.v4.1 1416 1180.34 0 0 Potri.003G141000.2.v4.1 2943 2707.34 562.126 13.4074 Potri.016G087400.1.v4.1 270 81.0557 1235 983.871 Potri.015G069301.1.v4.1 564 331.523 0 0 Potri.010G195200.1.v4.1 1773 1537.34 159 6.67854 Potri.012G127500.1.v4.1 977 741.339 2565 223.421 ==> SRR7171504.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 341 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 171 SRR7171504 completed mapping pipeline successfully