Starting /dee2/code/volunteer_pipeline.sh SRR7171505 current disk space = 3088083951616 free memory = 1416899780 SRR7171505 SRAfilesize df925c048cdf717a219627f04ff9aee0 SRR7171505.sra SRR7171505.sra file validated SRR7171505 is paired end SRR7171505 is conventional basespace SRR7171505 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171505_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.664 33.0 33.0 34.0 32.0 34.0 2 32.86 33.0 33.0 34.0 32.0 34.0 3 32.463 33.0 33.0 34.0 31.0 34.0 4 32.90725 33.0 33.0 34.0 32.0 34.0 5 32.61175 33.0 33.0 34.0 32.0 34.0 6 36.41225 38.0 37.0 38.0 34.0 38.0 7 36.71725 38.0 37.0 38.0 34.0 38.0 8 37.02975 38.0 38.0 38.0 35.0 38.0 9 37.32925 38.0 38.0 38.0 36.0 38.0 10-14 37.40115 38.0 38.0 38.0 37.0 38.0 15-19 37.45205 38.0 38.0 38.0 37.0 38.0 20-24 37.4932 38.0 38.0 38.0 37.2 38.0 25-29 37.49889999999999 38.0 38.0 38.0 37.2 38.0 30-34 37.4711 38.0 38.0 38.0 37.2 38.0 35-39 37.456300000000006 38.0 38.0 38.0 37.2 38.0 40-44 37.46575 38.0 38.0 38.0 37.0 38.0 45-49 37.431 38.0 38.0 38.0 37.0 38.0 50-54 37.4165 38.0 38.0 38.0 37.0 38.0 55-59 37.34895 38.0 38.0 38.0 37.0 38.0 60-64 37.323899999999995 38.0 38.0 38.0 36.8 38.0 65-69 37.25165 38.0 38.0 38.0 36.4 38.0 70-74 37.1931 38.0 38.0 38.0 36.0 38.0 75-79 37.20675 38.0 38.0 38.0 36.0 38.0 80-84 37.09215 38.0 38.0 38.0 36.0 38.0 85-89 37.0512 38.0 38.0 38.0 36.0 38.0 90-94 37.026250000000005 38.0 38.0 38.0 36.0 38.0 95-99 36.8309 38.0 38.0 38.0 35.2 38.0 100-104 36.7742 38.0 38.0 38.0 34.8 38.0 105-109 36.7436 38.0 38.0 38.0 34.8 38.0 110-114 36.651300000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.41330000000001 38.0 37.8 38.0 34.0 38.0 120-124 36.3666 38.0 37.6 38.0 34.0 38.0 125-129 36.218450000000004 38.0 37.0 38.0 33.4 38.0 130-134 36.099000000000004 38.0 36.8 38.0 32.6 38.0 135-139 35.856950000000005 38.0 36.0 38.0 31.8 38.0 140-144 35.6824 38.0 36.0 38.0 31.0 38.0 145-149 35.471199999999996 38.0 36.0 38.0 30.6 38.0 150-151 33.439625 36.5 32.0 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 0.0 25 3.0 26 12.0 27 15.0 28 17.0 29 25.0 30 23.0 31 51.0 32 51.0 33 106.0 34 150.0 35 198.0 36 616.0 37 2730.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.72316531731522 13.058239749281796 11.099503786889526 36.11909114651345 2 20.674999999999997 16.375 32.65 30.3 3 18.25 20.95 26.674999999999997 34.125 4 22.575 27.1 23.599999999999998 26.724999999999998 5 21.3 31.525 24.25 22.925 6 18.95 35.325 25.525 20.200000000000003 7 14.674999999999999 25.474999999999998 40.875 18.975 8 16.75 27.125 30.625000000000004 25.5 9 17.575 25.900000000000002 32.85 23.674999999999997 10-14 20.36 29.665000000000003 26.565 23.41 15-19 19.405 28.67 27.805000000000003 24.12 20-24 20.01 28.62 28.005000000000003 23.365 25-29 19.835 29.15 27.46 23.555 30-34 19.605 28.634999999999998 27.994999999999997 23.765 35-39 20.015 28.625 27.865000000000002 23.494999999999997 40-44 19.825 28.585 27.965 23.625 45-49 20.474999999999998 28.194999999999997 27.555000000000003 23.775 50-54 19.62 29.025000000000002 27.245 24.11 55-59 19.79 28.754999999999995 27.744999999999997 23.71 60-64 19.744999999999997 28.95 27.55 23.755000000000003 65-69 20.28 28.134999999999998 27.77 23.815 70-74 20.16 28.52 27.67 23.65 75-79 19.925 27.91 27.765 24.4 80-84 19.91 28.12 28.12 23.849999999999998 85-89 19.85 28.225 28.095 23.830000000000002 90-94 19.650000000000002 28.675 27.935 23.74 95-99 20.305 27.900000000000002 27.644999999999996 24.15 100-104 20.395 28.035 27.805000000000003 23.765 105-109 19.965 28.15 27.985 23.9 110-114 20.405 27.925 27.800000000000004 23.87 115-119 20.825 28.34 27.105 23.73 120-124 20.57 28.904999999999998 27.345000000000002 23.18 125-129 20.74 28.73 26.68 23.849999999999998 130-134 20.575 28.455000000000002 27.235 23.735 135-139 20.544999999999998 28.215 27.495000000000005 23.745 140-144 20.51 28.205000000000002 27.24 24.044999999999998 145-149 20.74 27.52 27.705000000000002 24.035 150-151 21.175 27.1375 26.937499999999996 24.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 1.0 24 1.5 25 1.0 26 3.5 27 6.0 28 7.0 29 7.5 30 10.0 31 18.5 32 26.0 33 34.5 34 48.0 35 70.5 36 87.5 37 110.5 38 147.0 39 175.5 40 199.5 41 233.0 42 253.0 43 256.5 44 276.0 45 287.5 46 279.0 47 253.5 48 229.5 49 221.5 50 176.5 51 119.5 52 105.5 53 96.0 54 68.0 55 43.0 56 36.0 57 32.0 58 21.0 59 15.5 60 12.5 61 6.5 62 3.0 63 2.0 64 2.5 65 3.0 66 3.5 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.037500000000000006 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.0875 0.0 0.0 0.025 0.0 90-91 0.1 0.0 0.0 0.025 0.0 92-93 0.16249999999999998 0.0 0.0 0.025 0.0 94-95 0.2625 0.0 0.0 0.025 0.0 96-97 0.3625 0.0 0.0 0.025 0.0 98-99 0.5 0.0 0.0 0.025 0.0 100-101 0.6875 0.0 0.0 0.025 0.0 102-103 0.875 0.0 0.0 0.025 0.0 104-105 1.0 0.0 0.0 0.025 0.0 106-107 1.175 0.0 0.0 0.025 0.0 108-109 1.5 0.0 0.0 0.025 0.0 110-111 1.7374999999999998 0.0 0.0 0.025 0.0 112-113 2.05 0.0 0.0 0.025 0.0 114-115 2.4 0.0 0.0 0.025 0.0 116-117 2.7625 0.0 0.0 0.025 0.0 118-119 3.1375 0.0 0.0 0.025 0.0 120-121 3.5374999999999996 0.0 0.0 0.025 0.0 122-123 3.9625 0.0 0.0 0.025 0.0 124-125 4.387499999999999 0.0 0.0 0.025 0.0 126-127 4.85 0.0 0.0 0.025 0.0 128-129 5.2375 0.0 0.0 0.025 0.0 130-131 5.6875 0.0 0.0 0.025 0.0 132-133 6.275 0.0 0.0 0.025 0.0 134-135 6.7 0.0 0.0 0.025 0.0 136-137 7.25 0.0 0.0 0.025 0.0 138-139 7.65 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171505 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171505_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9445 33.0 33.0 34.0 32.0 34.0 2 33.06025 34.0 33.0 34.0 32.0 34.0 3 33.061 34.0 33.0 34.0 32.0 34.0 4 32.9605 34.0 33.0 34.0 32.0 34.0 5 33.036 34.0 33.0 34.0 32.0 34.0 6 37.093 38.0 38.0 38.0 37.0 38.0 7 37.22675 38.0 38.0 38.0 37.0 38.0 8 37.1505 38.0 38.0 38.0 37.0 38.0 9 37.11025 38.0 38.0 38.0 36.0 38.0 10-14 37.077650000000006 38.0 38.0 38.0 36.4 38.0 15-19 37.13935 38.0 38.0 38.0 36.4 38.0 20-24 37.1754 38.0 38.0 38.0 36.8 38.0 25-29 37.1637 38.0 38.0 38.0 36.6 38.0 30-34 37.084500000000006 38.0 38.0 38.0 36.0 38.0 35-39 37.088049999999996 38.0 38.0 38.0 36.2 38.0 40-44 37.058 38.0 38.0 38.0 36.2 38.0 45-49 37.00485 38.0 38.0 38.0 36.0 38.0 50-54 36.9322 38.0 38.0 38.0 36.0 38.0 55-59 36.915049999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.8071 38.0 38.0 38.0 35.2 38.0 65-69 36.832499999999996 38.0 38.0 38.0 35.4 38.0 70-74 36.84225 38.0 38.0 38.0 35.4 38.0 75-79 36.73005 38.0 38.0 38.0 35.0 38.0 80-84 36.700700000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.542699999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.43485 38.0 38.0 38.0 34.0 38.0 95-99 36.39705 38.0 38.0 38.0 34.0 38.0 100-104 36.246 38.0 37.6 38.0 33.4 38.0 105-109 36.120999999999995 38.0 37.0 38.0 33.0 38.0 110-114 35.804649999999995 38.0 37.0 38.0 31.2 38.0 115-119 35.75755 38.0 36.6 38.0 31.0 38.0 120-124 35.612100000000005 38.0 36.0 38.0 30.6 38.0 125-129 35.45935000000001 38.0 36.0 38.0 29.0 38.0 130-134 35.2371 38.0 35.6 38.0 28.2 38.0 135-139 34.81025 38.0 35.0 38.0 26.0 38.0 140-144 34.61845 38.0 34.8 38.0 24.4 38.0 145-149 34.040850000000006 38.0 33.4 38.0 22.6 38.0 150-151 31.427625 35.5 28.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 5.0 18 6.0 19 4.0 20 9.0 21 5.0 22 7.0 23 15.0 24 10.0 25 19.0 26 15.0 27 21.0 28 34.0 29 20.0 30 44.0 31 59.0 32 79.0 33 109.0 34 180.0 35 274.0 36 708.0 37 2375.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.324999999999996 22.075 14.399999999999999 24.2 2 27.200000000000003 27.075 28.825 16.900000000000002 3 21.099999999999998 29.025000000000002 30.8 19.075 4 23.1 33.800000000000004 23.65 19.45 5 24.55 34.9 23.200000000000003 17.349999999999998 6 21.575 36.55 22.85 19.025 7 19.725 21.6 38.85 19.825 8 22.35 24.7 27.200000000000003 25.75 9 22.0 26.075 28.875 23.05 10-14 23.78 29.095 26.07 21.055 15-19 23.455000000000002 27.905 27.38 21.26 20-24 23.695 28.749999999999996 27.265 20.29 25-29 23.794999999999998 28.255000000000003 27.73 20.22 30-34 23.23 28.645 27.24 20.885 35-39 22.95 28.910000000000004 27.474999999999998 20.665 40-44 23.485 28.025 28.17 20.32 45-49 23.445 27.529999999999998 28.275 20.75 50-54 23.605 28.035 27.735 20.625 55-59 23.119999999999997 28.599999999999998 27.779999999999998 20.5 60-64 23.235 27.52 28.725 20.52 65-69 24.13 27.834999999999997 28.005000000000003 20.03 70-74 23.46 27.439999999999998 28.689999999999998 20.41 75-79 23.400000000000002 27.865000000000002 28.095 20.64 80-84 24.099999999999998 28.175 27.529999999999998 20.195 85-89 24.235 27.455000000000002 27.91 20.4 90-94 23.11 28.744999999999997 27.650000000000002 20.495 95-99 24.235 28.410000000000004 27.339999999999996 20.015 100-104 23.849999999999998 28.904999999999998 27.05 20.195 105-109 24.05 27.595 27.950000000000003 20.405 110-114 24.51 28.294999999999998 27.165 20.03 115-119 24.26 27.675 28.02 20.044999999999998 120-124 24.295 27.85 27.779999999999998 20.075000000000003 125-129 24.905 28.249999999999996 27.115000000000002 19.73 130-134 25.095 28.17 27.169999999999998 19.564999999999998 135-139 24.55 27.605 27.92 19.925 140-144 25.03 27.96 27.91 19.1 145-149 25.619999999999997 27.384999999999998 27.779999999999998 19.215 150-151 25.7875 27.0875 27.1 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 3.5 26 3.0 27 4.0 28 7.0 29 10.0 30 14.0 31 16.5 32 23.5 33 35.0 34 45.0 35 51.5 36 74.0 37 94.0 38 126.0 39 165.0 40 211.5 41 256.0 42 279.5 43 288.0 44 281.5 45 288.5 46 291.0 47 262.0 48 215.5 49 190.5 50 166.0 51 135.5 52 108.0 53 82.0 54 62.5 55 48.5 56 36.0 57 26.0 58 20.0 59 17.0 60 14.5 61 10.0 62 7.0 63 7.0 64 7.0 65 4.0 66 1.0 67 1.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7374999999999998 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.4124999999999996 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.9 0.0 0.0 0.0 0.0 128-129 5.2625 0.0 0.0 0.0 0.0 130-131 5.7125 0.0 0.0 0.0 0.0 132-133 6.300000000000001 0.0 0.0 0.0 0.0 134-135 6.699999999999999 0.0 0.0 0.0 0.0 136-137 7.225 0.0 0.0 0.0 0.0 138-139 7.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731297 spots for SRR7171505.sra Written 731297 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra Read 731284 spots for SRR7171505.sra Written 731284 spots for SRR7171505.sra SRR ids: ['SRR7171505.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pt7_j46e SRR7171505.sra spots: 14625693 blocks: [[1, 731284], [731285, 1462568], [1462569, 2193852], [2193853, 2925136], [2925137, 3656420], [3656421, 4387704], [4387705, 5118988], [5118989, 5850272], [5850273, 6581556], [6581557, 7312840], [7312841, 8044124], [8044125, 8775408], [8775409, 9506692], [9506693, 10237976], [10237977, 10969260], [10969261, 11700544], [11700545, 12431828], [12431829, 13163112], [13163113, 13894396], [13894397, 14625693]] SRR7171505 file size 4934467 SRR7171505 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171505 SRR7171505_1.fastq SRR7171505_2.fastq Input file: SRR7171505_1.fastq Paired file: SRR7171505_2.fastq trimmed: SRR7171505-trimmed-pair1.fastq, SRR7171505-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:59:09 2025 >> started Thu Feb 13 20:59:34 2025 >> done (25.238s) 14625693 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 1377 ( 0.01%) empty read pairs filtered out after trimming by size control 14624289 (99.99%) read pairs available; of these: 1855829 (12.69%) trimmed read pairs available after processing 12768460 (87.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 3 0.00% 25 2 0.00% 26 1 0.00% 27 3 0.00% 28 5 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 3 0.00% 33 1 0.00% 34 0 0.00% 35 2 0.00% 36 3 0.00% 37 0 0.00% 38 3 0.00% 39 3 0.00% 40 4 0.00% 41 3 0.00% 42 3 0.00% 43 2 0.00% 44 6 0.00% 45 11 0.00% 46 10 0.00% 47 11 0.00% 48 4 0.00% 49 5 0.00% 50 15 0.00% 51 17 0.00% 52 14 0.00% 53 21 0.00% 54 27 0.00% 55 38 0.00% 56 29 0.00% 57 44 0.00% 58 45 0.00% 59 50 0.00% 60 79 0.00% 61 100 0.00% 62 105 0.00% 63 113 0.00% 64 164 0.00% 65 139 0.00% 66 207 0.00% 67 218 0.00% 68 296 0.00% 69 323 0.00% 70 393 0.00% 71 434 0.00% 72 533 0.00% 73 622 0.00% 74 710 0.00% 75 741 0.01% 76 927 0.01% 77 934 0.01% 78 1108 0.01% 79 1303 0.01% 80 1581 0.01% 81 1764 0.01% 82 2021 0.01% 83 2294 0.02% 84 2671 0.02% 85 2895 0.02% 86 3359 0.02% 87 3455 0.02% 88 3828 0.03% 89 4327 0.03% 90 4826 0.03% 91 5261 0.04% 92 5997 0.04% 93 6735 0.05% 94 7280 0.05% 95 7989 0.05% 96 8459 0.06% 97 8949 0.06% 98 9376 0.06% 99 10074 0.07% 100 10771 0.07% 101 11696 0.08% 102 12700 0.09% 103 13627 0.09% 104 14789 0.10% 105 15262 0.10% 106 16151 0.11% 107 16837 0.12% 108 17266 0.12% 109 17978 0.12% 110 19121 0.13% 111 20180 0.14% 112 21143 0.14% 113 22655 0.15% 114 23758 0.16% 115 25059 0.17% 116 25624 0.18% 117 26226 0.18% 118 26821 0.18% 119 27600 0.19% 120 28235 0.19% 121 29541 0.20% 122 30739 0.21% 123 32751 0.22% 124 34242 0.23% 125 34564 0.24% 126 36095 0.25% 127 36721 0.25% 128 37299 0.26% 129 37941 0.26% 130 38447 0.26% 131 39404 0.27% 132 41368 0.28% 133 42307 0.29% 134 43567 0.30% 135 45114 0.31% 136 45451 0.31% 137 46325 0.32% 138 46796 0.32% 139 46861 0.32% 140 47843 0.33% 141 48513 0.33% 142 49665 0.34% 143 51393 0.35% 144 52618 0.36% 145 54308 0.37% 146 54710 0.37% 147 55384 0.38% 148 56258 0.38% 149 55918 0.38% 150 57195 0.39% 151 12768460 87.31% 14624289 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=15 prefix-density=0.67 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=14.93 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.9 sequence=CTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCCTATTGGGATACCTCCCGTCCATTAAGTTAGGGCTTTCAGCCCTAATTAA criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=18 prefix-density=0.59 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=14 fanout-score=40.25 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.5 sequence=TTGGTGCTGAGA SRR7171505 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:00:20 Started mapping on | Feb 13 21:00:21 Finished on | Feb 13 21:02:27 Mapping speed, Million of reads per hour | 417.84 Number of input reads | 14624289 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13441741 Uniquely mapped reads % | 91.91% Average mapped length | 294.99 Number of splices: Total | 13363274 Number of splices: Annotated (sjdb) | 13105860 Number of splices: GT/AG | 13154328 Number of splices: GC/AG | 166940 Number of splices: AT/AC | 10237 Number of splices: Non-canonical | 31769 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 333734 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 170733 % of reads mapped to too many loci | 1.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.44% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 848814 848814 848814 N_multimapping 333734 333734 333734 N_noFeature 378207 13325762 421407 N_ambiguous 144885 1067 71471 UnstrandedReadsAssigned:12918649 PositiveStrandReadsAssigned:114912 NegativeStrandReadsAssigned:12948863 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171505 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171505-trimmed-pair1.fastq SRR7171505-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,624,289 reads, 13,037,404 reads pseudoaligned [quant] estimated average fragment length: 228.076 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,017 rounds 52401 SRR7171505.ke.tsv 34699 SRR7171505.se.tsv 87100 total ==> SRR7171505.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.92 1459 59.0791 Potri.005G024800.1.v4.1 1035 807.924 1008 90.4786 Potri.004G059700.1.v4.1 961 733.93 11 1.08691 Potri.007G009000.2.v4.1 1416 1188.92 0 0 Potri.003G141000.2.v4.1 2943 2715.92 967.285 25.8281 Potri.016G087400.1.v4.1 270 84.591 892 764.71 Potri.015G069301.1.v4.1 564 339.499 0 0 Potri.010G195200.1.v4.1 1773 1545.92 360.831 16.9266 Potri.012G127500.1.v4.1 977 749.93 1677 162.169 ==> SRR7171505.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 380 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 198 SRR7171505 completed mapping pipeline successfully