Starting /dee2/code/volunteer_pipeline.sh SRR7171506 current disk space = 3114728521728 free memory = 1280886856 SRR7171506 SRAfilesize 3af267c6681b2c5a2d21ab9b12d4d2f2 SRR7171506.sra SRR7171506.sra file validated SRR7171506 is paired end SRR7171506 is conventional basespace SRR7171506 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171506_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.42075 18.0 18.0 18.0 18.0 31.0 2 29.73325 32.0 27.0 32.0 27.0 33.0 3 30.877 31.0 30.0 33.0 28.0 33.0 4 31.90025 33.0 32.0 33.0 31.0 33.0 5 32.57675 33.0 33.0 33.0 32.0 34.0 6 36.677 38.0 37.0 38.0 34.0 38.0 7 37.27275 38.0 38.0 38.0 36.0 38.0 8 37.39475 38.0 38.0 38.0 37.0 38.0 9 37.51425 38.0 38.0 38.0 37.0 38.0 10-14 37.4439 38.0 38.0 38.0 37.0 38.0 15-19 37.42635 38.0 38.0 38.0 37.0 38.0 20-24 37.320949999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.4042 38.0 38.0 38.0 37.0 38.0 30-34 37.46495 38.0 38.0 38.0 37.2 38.0 35-39 36.215199999999996 38.0 37.2 38.0 31.4 38.0 40-44 36.945350000000005 38.0 38.0 38.0 34.2 38.0 45-49 37.32125 38.0 38.0 38.0 37.0 38.0 50-54 37.182849999999995 38.0 38.0 38.0 36.6 38.0 55-59 37.13895000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.17675 38.0 38.0 38.0 36.0 38.0 65-69 37.16025 38.0 38.0 38.0 36.0 38.0 70-74 34.430099999999996 33.6 33.6 37.8 31.8 38.0 75-79 35.19655 36.2 35.0 38.0 31.6 38.0 80-84 36.97945 38.0 38.0 38.0 35.8 38.0 85-89 36.99015 38.0 38.0 38.0 36.0 38.0 90-94 36.954750000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.89149999999999 38.0 38.0 38.0 35.6 38.0 100-104 36.75795000000001 38.0 38.0 38.0 35.0 38.0 105-109 36.74345 38.0 38.0 38.0 34.4 38.0 110-114 36.54084999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.448949999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.2298 38.0 37.6 38.0 33.2 38.0 125-129 36.0964 38.0 37.2 38.0 32.6 38.0 130-134 35.9256 38.0 36.4 38.0 32.2 38.0 135-139 35.983450000000005 38.0 36.2 38.0 33.0 38.0 140-144 35.80955 38.0 36.0 38.0 32.0 38.0 145-149 35.61235 38.0 36.0 38.0 31.0 38.0 150-151 33.297625 36.5 32.0 38.0 21.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 5.0 23 4.0 24 9.0 25 7.0 26 16.0 27 18.0 28 22.0 29 24.0 30 38.0 31 55.0 32 71.0 33 104.0 34 173.0 35 296.0 36 858.0 37 2298.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.910055583628093 10.864072764022234 16.927741283476504 40.29813036887317 2 23.3 13.5 33.35 29.849999999999998 3 20.575 18.35 25.474999999999998 35.6 4 22.0 26.150000000000002 24.075 27.775 5 22.325 30.575000000000003 24.075 23.025000000000002 6 20.150000000000002 33.275 24.85 21.725 7 14.075 26.200000000000003 41.55 18.175 8 17.9 26.25 31.55 24.3 9 18.025 24.8 34.025 23.150000000000002 10-14 19.86 30.095 27.27 22.775000000000002 15-19 19.545 28.13 28.689999999999998 23.635 20-24 20.015 28.694999999999997 27.665 23.625 25-29 19.75598779938997 28.54142707135357 27.486374318715935 24.216210810540527 30-34 19.607941191178675 28.519277891683753 27.659148872330853 24.213632044806722 35-39 19.70492623155789 29.48237059264816 26.916729182295573 23.895973993498373 40-44 20.388058208731312 28.05420813121968 28.084212631894783 23.473521028154224 45-49 20.158023703555532 28.379256888533277 27.889183377506626 23.57353603040456 50-54 20.58602930146507 28.451422571128553 27.586379318965946 23.376168808440422 55-59 20.305 28.810000000000002 27.644999999999996 23.24 60-64 20.015 28.4 27.73 23.855 65-69 20.515 28.275 27.72 23.49 70-74 20.32 29.185 26.834999999999997 23.66 75-79 20.03 28.055000000000003 27.51 24.404999999999998 80-84 20.119999999999997 27.71 28.035 24.135 85-89 19.435 28.175 27.93 24.46 90-94 20.044999999999998 28.24 27.62 24.095 95-99 20.085 28.64 27.77 23.505000000000003 100-104 20.385 28.494999999999997 27.83 23.29 105-109 19.865 28.275 27.865000000000002 23.995 110-114 20.46 28.28 27.815 23.445 115-119 20.815 27.395000000000003 27.855 23.935000000000002 120-124 20.635 27.875 27.644999999999996 23.845 125-129 20.585 28.405 27.26 23.75 130-134 20.955 28.24 27.395000000000003 23.41 135-139 20.810000000000002 27.860000000000003 27.105 24.224999999999998 140-144 21.310000000000002 27.250000000000004 27.22 24.22 145-149 20.825 28.110000000000003 27.025 24.04 150-151 21.1875 27.925 26.187500000000004 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.5 22 3.5 23 2.0 24 2.0 25 3.5 26 3.0 27 3.0 28 6.0 29 7.5 30 13.5 31 22.0 32 24.5 33 34.0 34 55.0 35 70.5 36 91.0 37 116.0 38 130.0 39 161.0 40 187.5 41 212.5 42 245.0 43 258.5 44 277.0 45 302.0 46 285.5 47 250.5 48 238.5 49 213.5 50 173.5 51 133.5 52 109.0 53 84.0 54 62.5 55 51.5 56 41.0 57 32.5 58 20.5 59 17.0 60 14.0 61 11.5 62 8.0 63 5.5 64 5.0 65 2.0 66 1.5 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.015 35-39 0.025 40-44 0.015 45-49 0.015 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.1500000000000004 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.5875000000000004 0.0 0.0 0.0 0.0 128-129 3.8499999999999996 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.2125 0.0 0.0 0.0 0.0 136-137 5.675 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171506 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171506_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8415 33.0 33.0 34.0 32.0 34.0 2 32.905 34.0 33.0 34.0 32.0 34.0 3 32.96225 34.0 33.0 34.0 32.0 34.0 4 33.003 34.0 33.0 34.0 32.0 34.0 5 32.98125 34.0 33.0 34.0 32.0 34.0 6 37.15775 38.0 38.0 38.0 37.0 38.0 7 37.0475 38.0 38.0 38.0 37.0 38.0 8 37.08025 38.0 38.0 38.0 36.0 38.0 9 37.07475 38.0 38.0 38.0 37.0 38.0 10-14 37.064499999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.05865 38.0 38.0 38.0 36.8 38.0 20-24 36.9731 38.0 38.0 38.0 36.0 38.0 25-29 37.025099999999995 38.0 38.0 38.0 36.2 38.0 30-34 37.06595 38.0 38.0 38.0 36.4 38.0 35-39 36.932500000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.78745 38.0 38.0 38.0 35.4 38.0 45-49 36.8604 38.0 38.0 38.0 35.8 38.0 50-54 36.91615 38.0 38.0 38.0 35.8 38.0 55-59 36.8467 38.0 38.0 38.0 35.8 38.0 60-64 36.80135 38.0 38.0 38.0 36.0 38.0 65-69 36.812850000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.7518 38.0 38.0 38.0 35.0 38.0 75-79 36.7707 38.0 38.0 38.0 35.0 38.0 80-84 36.67225 38.0 38.0 38.0 34.6 38.0 85-89 36.718599999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.5327 38.0 38.0 38.0 34.2 38.0 95-99 36.464099999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.3755 38.0 38.0 38.0 34.0 38.0 105-109 36.2587 38.0 38.0 38.0 33.6 38.0 110-114 36.11285 38.0 38.0 38.0 33.4 38.0 115-119 36.0299 38.0 38.0 38.0 33.2 38.0 120-124 35.91855 38.0 37.6 38.0 31.8 38.0 125-129 35.857899999999994 38.0 37.0 38.0 31.0 38.0 130-134 35.78165 38.0 36.8 38.0 31.0 38.0 135-139 35.56875 38.0 36.0 38.0 30.2 38.0 140-144 35.3024 38.0 36.0 38.0 28.8 38.0 145-149 35.05485 38.0 35.4 38.0 28.0 38.0 150-151 32.5305 35.5 30.0 38.0 20.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 5.0 18 3.0 19 6.0 20 8.0 21 9.0 22 9.0 23 12.0 24 21.0 25 9.0 26 21.0 27 29.0 28 31.0 29 38.0 30 51.0 31 67.0 32 61.0 33 89.0 34 125.0 35 186.0 36 460.0 37 2754.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.80895223805952 19.004751187796952 17.05426356589147 28.132033008252062 2 27.656914228557138 27.581895473868467 28.08202050512628 16.67916979244811 3 21.880470117529384 28.782195548887223 29.582395598899723 19.754938734683673 4 22.892169126845133 34.00050037528146 23.567675756817614 19.53965474105579 5 24.34325744308231 35.40155116337253 23.54265699274456 16.7125344008006 6 20.876095118898625 37.571964956195245 22.853566958698373 18.69837296620776 7 20.435762584522916 21.61282243926872 38.94315051339844 19.00826446280992 8 23.91793845384038 25.719289467100324 26.09457092819615 24.26820115086315 9 22.069138276553108 26.703406813627257 30.160320641282567 21.067134268537075 10-14 23.68566130406455 29.374028968074978 25.695384152758983 21.24492557510149 15-19 23.63818591831621 28.2335254322225 27.356552242545728 20.77173640691556 20-24 23.296593186372746 28.021042084168336 27.4749498997996 21.207414829659317 25-29 23.207849419303166 27.758309971966362 27.958550260312375 21.0752903484181 30-34 23.066533266633314 29.21960980490245 27.293646823411706 20.420210105052526 35-39 23.63090772693173 28.507126781695426 27.38184546136534 20.4801200300075 40-44 23.763317161006352 28.454959235732506 27.70469664382534 20.077026959435802 45-49 23.290619681649815 29.071979177094804 27.23495845429973 20.402442686955652 50-54 23.192107371794872 28.22516025641026 27.62920673076923 20.953525641025642 55-59 23.521747845259572 28.407496492283023 27.66085387853277 20.40990178392463 60-64 23.824561403508774 28.270676691729324 27.493734335839598 20.411027568922304 65-69 23.745618427641464 27.831747621432147 27.651477215823732 20.771156735102654 70-74 23.435858964741186 28.017004251062765 28.16704176044011 20.38009502375594 75-79 23.814762952590517 27.750550110022004 27.870574114822965 20.56411282256451 80-84 23.742374237423743 28.297829782978294 27.61276127612761 20.347034703470346 85-89 24.306076519129782 27.881970492623154 27.76194048512128 20.05001250312578 90-94 23.926748724106876 27.434203942759932 27.93955769038327 20.699489642749924 95-99 23.921863260706235 28.01402454295016 27.4129727022289 20.6511394941147 100-104 23.790423665078965 28.28277763850589 27.39032338932063 20.53647530709451 105-109 24.523761780629638 27.712051333467013 27.52155604571887 20.242630840184482 110-114 24.645096563832457 28.076247805367444 27.338851266616505 19.939804364183598 115-119 24.181663241265227 27.354754624291942 27.91618627500125 20.547395859441576 120-124 24.241513968158607 27.761089416241113 27.600881145489137 20.396515470111147 125-129 24.390975939172627 28.167675453954278 27.08718923515582 20.354159371717273 130-134 24.788676036612813 27.974791176911918 26.969439303756314 20.267093482718952 135-139 25.035049068696175 27.838974564390146 27.122972161025437 20.003004205888246 140-144 24.633828250401287 28.42596308186196 27.4026886035313 19.537520064205456 145-149 25.477707006369428 28.26621194643663 26.887005366367422 19.36907568082652 150-151 25.435627428857966 28.09326814591952 26.93995236304375 19.531152062178762 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 1.0 23 0.5 24 3.0 25 3.0 26 1.5 27 3.5 28 5.5 29 5.5 30 7.0 31 15.5 32 23.0 33 32.0 34 43.0 35 63.0 36 87.0 37 103.0 38 126.5 39 163.0 40 200.0 41 241.0 42 270.5 43 284.5 44 298.0 45 295.5 46 275.0 47 245.0 48 222.0 49 195.5 50 167.5 51 137.0 52 102.5 53 88.5 54 67.5 55 48.5 56 42.0 57 31.5 58 29.0 59 22.0 60 12.0 61 7.0 62 6.5 63 8.0 64 4.5 65 1.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.075 5 0.075 6 0.125 7 0.17500000000000002 8 0.075 9 0.2 10-14 0.23500000000000001 15-19 0.22499999999999998 20-24 0.2 25-29 0.12 30-34 0.05 35-39 0.025 40-44 0.034999999999999996 45-49 0.11 50-54 0.16 55-59 0.22 60-64 0.25 65-69 0.15 70-74 0.025 75-79 0.02 80-84 0.01 85-89 0.025 90-94 0.06999999999999999 95-99 0.17500000000000002 100-104 0.27499999999999997 105-109 0.26 110-114 0.325 115-119 0.255 120-124 0.13 125-129 0.045 130-134 0.034999999999999996 135-139 0.13999999999999999 140-144 0.32 145-149 0.305 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74893296510167 99.325 2 0.1506402209389907 0.3 3 0.07532011046949535 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025106703489831784 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.5125 0.0 0.0 0.0 0.0 128-129 3.7750000000000004 0.0 0.0 0.0 0.0 130-131 4.1625 0.0 0.0 0.0 0.0 132-133 4.6625 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.5 0.0 0.0 0.0 0.0 138-139 5.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGACCA 10 0.006830828 145.0 7 >>END_MODULE Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796588 spots for SRR7171506.sra Written 796588 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra Read 796584 spots for SRR7171506.sra Written 796584 spots for SRR7171506.sra SRR ids: ['SRR7171506.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f60_aj71 SRR7171506.sra spots: 15931684 blocks: [[1, 796584], [796585, 1593168], [1593169, 2389752], [2389753, 3186336], [3186337, 3982920], [3982921, 4779504], [4779505, 5576088], [5576089, 6372672], [6372673, 7169256], [7169257, 7965840], [7965841, 8762424], [8762425, 9559008], [9559009, 10355592], [10355593, 11152176], [11152177, 11948760], [11948761, 12745344], [12745345, 13541928], [13541929, 14338512], [14338513, 15135096], [15135097, 15931684]] SRR7171506 file size 5377024 SRR7171506 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171506 SRR7171506_1.fastq SRR7171506_2.fastq Input file: SRR7171506_1.fastq Paired file: SRR7171506_2.fastq trimmed: SRR7171506-trimmed-pair1.fastq, SRR7171506-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:20:20 2025 >> started Fri Feb 14 11:20:39 2025 >> done (19.147s) 15931684 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 1311 ( 0.01%) empty read pairs filtered out after trimming by size control 15930351 (99.99%) read pairs available; of these: 1752315 (11.00%) trimmed read pairs available after processing 14178036 (89.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 4 0.00% 21 0 0.00% 22 1 0.00% 23 3 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 2 0.00% 33 1 0.00% 34 0 0.00% 35 1 0.00% 36 3 0.00% 37 1 0.00% 38 4 0.00% 39 5 0.00% 40 1 0.00% 41 6 0.00% 42 9 0.00% 43 5 0.00% 44 5 0.00% 45 10 0.00% 46 7 0.00% 47 10 0.00% 48 9 0.00% 49 18 0.00% 50 15 0.00% 51 14 0.00% 52 15 0.00% 53 19 0.00% 54 31 0.00% 55 27 0.00% 56 28 0.00% 57 50 0.00% 58 46 0.00% 59 36 0.00% 60 66 0.00% 61 87 0.00% 62 92 0.00% 63 91 0.00% 64 142 0.00% 65 157 0.00% 66 158 0.00% 67 188 0.00% 68 206 0.00% 69 294 0.00% 70 327 0.00% 71 375 0.00% 72 435 0.00% 73 529 0.00% 74 592 0.00% 75 672 0.00% 76 789 0.00% 77 900 0.01% 78 1008 0.01% 79 1189 0.01% 80 1317 0.01% 81 1572 0.01% 82 1762 0.01% 83 1930 0.01% 84 2281 0.01% 85 2559 0.02% 86 2935 0.02% 87 3039 0.02% 88 3396 0.02% 89 3705 0.02% 90 4263 0.03% 91 4655 0.03% 92 5154 0.03% 93 5729 0.04% 94 6470 0.04% 95 6924 0.04% 96 7346 0.05% 97 8045 0.05% 98 8506 0.05% 99 8963 0.06% 100 9923 0.06% 101 10355 0.07% 102 11256 0.07% 103 12090 0.08% 104 12736 0.08% 105 13679 0.09% 106 14448 0.09% 107 14881 0.09% 108 15672 0.10% 109 16647 0.10% 110 17268 0.11% 111 17854 0.11% 112 19156 0.12% 113 19934 0.13% 114 21288 0.13% 115 22466 0.14% 116 24035 0.15% 117 27445 0.17% 118 29066 0.18% 119 26911 0.17% 120 26340 0.17% 121 26693 0.17% 122 27849 0.17% 123 29243 0.18% 124 30417 0.19% 125 31429 0.20% 126 32803 0.21% 127 33172 0.21% 128 33956 0.21% 129 35207 0.22% 130 35920 0.23% 131 36323 0.23% 132 37440 0.24% 133 39014 0.24% 134 40133 0.25% 135 41365 0.26% 136 42429 0.27% 137 43061 0.27% 138 44241 0.28% 139 44714 0.28% 140 46570 0.29% 141 51667 0.32% 142 51344 0.32% 143 52922 0.33% 144 52318 0.33% 145 54704 0.34% 146 51317 0.32% 147 53034 0.33% 148 56534 0.35% 149 53899 0.34% 150 59899 0.38% 151 14178036 89.00% 15930351 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=28 prefix-density=0.69 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=27.95 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=TTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAAGAAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATG criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=24 prefix-density=1.13 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=27 fanout-score=22.55 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=9.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171506 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:22:02 Started mapping on | Feb 14 11:22:02 Finished on | Feb 14 11:24:57 Mapping speed, Million of reads per hour | 327.71 Number of input reads | 15930351 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14732900 Uniquely mapped reads % | 92.48% Average mapped length | 295.92 Number of splices: Total | 14980702 Number of splices: Annotated (sjdb) | 14709845 Number of splices: GT/AG | 14743407 Number of splices: GC/AG | 189830 Number of splices: AT/AC | 11664 Number of splices: Non-canonical | 35801 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 370433 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 136308 % of reads mapped to too many loci | 0.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 827018 827018 827018 N_multimapping 370433 370433 370433 N_noFeature 392890 14593186 450997 N_ambiguous 151020 713 68987 UnstrandedReadsAssigned:14188990 PositiveStrandReadsAssigned:139001 NegativeStrandReadsAssigned:14212916 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171506 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171506-trimmed-pair1.fastq SRR7171506-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,930,351 reads, 14,275,557 reads pseudoaligned [quant] estimated average fragment length: 237.469 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52401 SRR7171506.ke.tsv 34699 SRR7171506.se.tsv 87100 total ==> SRR7171506.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.53 1289 44.7099 Potri.005G024800.1.v4.1 1035 798.531 279 21.5902 Potri.004G059700.1.v4.1 961 724.542 9 0.767579 Potri.007G009000.2.v4.1 1416 1179.53 0 0 Potri.003G141000.2.v4.1 2943 2706.53 844.549 19.2822 Potri.016G087400.1.v4.1 270 81.5231 1086.74 823.734 Potri.015G069301.1.v4.1 564 331.511 0 0 Potri.010G195200.1.v4.1 1773 1536.53 459 18.4593 Potri.012G127500.1.v4.1 977 740.542 3842 320.591 ==> SRR7171506.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 110 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 488 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 290 SRR7171506 completed mapping pipeline successfully