Starting /dee2/code/volunteer_pipeline.sh SRR7171507 current disk space = 3110904676352 free memory = 1570986868 SRR7171507 SRAfilesize 9c20dec7cb90fab018b0fdff94248ddc SRR7171507.sra SRR7171507.sra file validated SRR7171507 is paired end SRR7171507 is conventional basespace SRR7171507 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171507_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.822 18.0 18.0 18.0 18.0 32.0 2 22.71375 18.0 18.0 27.0 18.0 32.0 3 28.25 30.0 27.0 32.0 18.0 32.0 4 30.452 32.0 31.0 33.0 25.0 33.0 5 31.94175 33.0 32.0 33.0 31.0 33.0 6 36.40275 38.0 36.0 38.0 34.0 38.0 7 37.038 38.0 37.0 38.0 35.0 38.0 8 37.294 38.0 38.0 38.0 36.0 38.0 9 37.424 38.0 38.0 38.0 37.0 38.0 10-14 37.484399999999994 38.0 38.0 38.0 37.2 38.0 15-19 37.54945 38.0 38.0 38.0 37.8 38.0 20-24 37.5617 38.0 38.0 38.0 38.0 38.0 25-29 37.3841 38.0 38.0 38.0 37.4 38.0 30-34 37.3332 38.0 38.0 38.0 37.2 38.0 35-39 37.31765 38.0 38.0 38.0 37.0 38.0 40-44 37.402 38.0 38.0 38.0 37.0 38.0 45-49 37.4705 38.0 38.0 38.0 37.4 38.0 50-54 37.3969 38.0 38.0 38.0 37.0 38.0 55-59 37.24835 38.0 38.0 38.0 36.8 38.0 60-64 37.1923 38.0 38.0 38.0 36.4 38.0 65-69 37.25325 38.0 38.0 38.0 36.6 38.0 70-74 37.260999999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.2297 38.0 38.0 38.0 36.6 38.0 80-84 37.19895 38.0 38.0 38.0 36.0 38.0 85-89 37.17345 38.0 38.0 38.0 36.0 38.0 90-94 37.087450000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.93445 38.0 38.0 38.0 35.4 38.0 100-104 36.83365 38.0 38.0 38.0 34.8 38.0 105-109 36.806200000000004 38.0 38.0 38.0 34.8 38.0 110-114 36.64 38.0 38.0 38.0 34.0 38.0 115-119 36.3938 38.0 37.6 38.0 33.6 38.0 120-124 36.337849999999996 38.0 37.8 38.0 34.0 38.0 125-129 36.24745 38.0 37.4 38.0 33.6 38.0 130-134 36.18554999999999 38.0 37.2 38.0 33.2 38.0 135-139 35.9274 38.0 36.0 38.0 32.2 38.0 140-144 35.67725 38.0 36.0 38.0 31.0 38.0 145-149 35.46195 38.0 35.6 38.0 31.0 38.0 150-151 33.344375 36.5 31.5 38.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 5.0 24 3.0 25 2.0 26 10.0 27 13.0 28 15.0 29 27.0 30 30.0 31 46.0 32 73.0 33 77.0 34 163.0 35 293.0 36 737.0 37 2504.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.2406015037594 17.74436090225564 8.596491228070176 37.418546365914786 2 21.975 16.775000000000002 29.599999999999998 31.65 3 20.3 20.125 25.525 34.050000000000004 4 22.05 27.700000000000003 23.45 26.8 5 22.725 31.85 24.0 21.425 6 19.575 34.050000000000004 24.7 21.675 7 14.149999999999999 26.674999999999997 40.525 18.65 8 17.724999999999998 26.674999999999997 29.599999999999998 26.0 9 16.525000000000002 24.725 33.625 25.124999999999996 10-14 20.05 29.32 27.705000000000002 22.925 15-19 20.14 29.049999999999997 27.825 22.985 20-24 20.19 28.48 27.565 23.765 25-29 19.51890378075615 28.515703140628123 28.330666133226647 23.63472694538908 30-34 20.0200100050025 28.36418209104552 27.658829414707352 23.956978489244623 35-39 19.679839919959978 28.989494747373683 27.408704352176088 23.921960980490244 40-44 19.45472736368184 28.864432216108053 27.92896448224112 23.751875937968983 45-49 19.634817408704354 28.3591795897949 27.983991995997997 24.02201100550275 50-54 19.935 28.444999999999997 27.889999999999997 23.73 55-59 19.655 28.825 27.560000000000002 23.96 60-64 19.35 27.775 28.28 24.595 65-69 19.75 28.17 28.34 23.74 70-74 19.895 28.139999999999997 27.73 24.235 75-79 20.064999999999998 28.57 28.07 23.294999999999998 80-84 20.035 28.52 27.205000000000002 24.240000000000002 85-89 20.185 28.285 27.36 24.169999999999998 90-94 19.39 28.194999999999997 28.38 24.035 95-99 20.29 28.23 27.295 24.185000000000002 100-104 19.98 28.185 27.605 24.23 105-109 20.31 28.09 27.694999999999997 23.905 110-114 20.474999999999998 27.529999999999998 28.110000000000003 23.885 115-119 20.415 28.244999999999997 27.515 23.825 120-124 20.424999999999997 28.005000000000003 27.644999999999996 23.925 125-129 20.625 28.544999999999998 27.405 23.425 130-134 20.995 28.365000000000002 26.845000000000002 23.794999999999998 135-139 21.105 27.985 27.35 23.56 140-144 20.75 27.98 27.32 23.95 145-149 21.435000000000002 27.79 26.715 24.060000000000002 150-151 20.6875 27.525 26.85 24.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 4.0 27 6.5 28 5.5 29 6.5 30 11.5 31 20.0 32 35.0 33 38.5 34 50.0 35 70.0 36 84.5 37 112.0 38 134.0 39 147.5 40 184.5 41 235.5 42 272.5 43 287.5 44 285.5 45 286.5 46 259.0 47 245.0 48 239.5 49 202.5 50 182.0 51 147.0 52 111.0 53 89.5 54 61.5 55 45.5 56 34.0 57 25.5 58 19.0 59 17.0 60 15.0 61 8.0 62 6.5 63 5.0 64 2.0 65 1.0 66 1.0 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.05 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.55 0.0 0.0 0.0 0.0 126-127 4.949999999999999 0.0 0.0 0.0 0.0 128-129 5.6 0.0 0.0 0.0 0.0 130-131 6.2625 0.0 0.0 0.0 0.0 132-133 7.025 0.0 0.0 0.0 0.0 134-135 7.6125 0.0 0.0 0.0 0.0 136-137 8.3375 0.0 0.0 0.0 0.0 138-139 8.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGTT 10 0.006830828 145.0 8 AACAAAC 10 0.006830828 145.0 2 TGCTCCT 10 0.006830828 145.0 3 GTAAACT 10 0.006830828 145.0 1 >>END_MODULE SRR7171507 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171507_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.926 33.0 33.0 34.0 32.0 34.0 2 32.89325 34.0 33.0 34.0 32.0 34.0 3 33.055 34.0 33.0 34.0 32.0 34.0 4 32.89725 34.0 33.0 34.0 32.0 34.0 5 32.84875 34.0 33.0 34.0 32.0 34.0 6 37.0635 38.0 38.0 38.0 36.0 38.0 7 36.981 38.0 38.0 38.0 36.0 38.0 8 36.96875 38.0 38.0 38.0 36.0 38.0 9 37.003 38.0 38.0 38.0 36.0 38.0 10-14 36.97005 38.0 38.0 38.0 36.4 38.0 15-19 36.9694 38.0 38.0 38.0 36.0 38.0 20-24 36.9772 38.0 38.0 38.0 36.2 38.0 25-29 37.025549999999996 38.0 38.0 38.0 36.4 38.0 30-34 37.1484 38.0 38.0 38.0 37.0 38.0 35-39 37.14515 38.0 38.0 38.0 37.0 38.0 40-44 37.1786 38.0 38.0 38.0 37.0 38.0 45-49 37.020199999999996 38.0 38.0 38.0 36.4 38.0 50-54 36.997550000000004 38.0 38.0 38.0 36.2 38.0 55-59 36.9037 38.0 38.0 38.0 36.0 38.0 60-64 36.72515 38.0 38.0 38.0 35.0 38.0 65-69 36.82685 38.0 38.0 38.0 35.8 38.0 70-74 36.86245 38.0 38.0 38.0 35.8 38.0 75-79 36.898199999999996 38.0 38.0 38.0 35.6 38.0 80-84 36.86275 38.0 38.0 38.0 35.2 38.0 85-89 36.8094 38.0 38.0 38.0 35.2 38.0 90-94 36.731199999999994 38.0 38.0 38.0 34.8 38.0 95-99 36.66465 38.0 38.0 38.0 35.0 38.0 100-104 36.4799 38.0 38.0 38.0 34.0 38.0 105-109 36.39615 38.0 38.0 38.0 33.8 38.0 110-114 36.1762 38.0 38.0 38.0 33.0 38.0 115-119 36.02825 38.0 37.4 38.0 33.0 38.0 120-124 35.7873 38.0 37.0 38.0 31.0 38.0 125-129 35.666650000000004 38.0 36.8 38.0 30.6 38.0 130-134 35.660700000000006 38.0 36.0 38.0 31.0 38.0 135-139 35.381099999999996 38.0 36.0 38.0 29.8 38.0 140-144 35.0291 38.0 35.0 38.0 27.6 38.0 145-149 34.67195 38.0 35.0 38.0 24.6 38.0 150-151 32.562125 36.5 30.0 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 1.0 18 6.0 19 5.0 20 3.0 21 4.0 22 7.0 23 7.0 24 14.0 25 19.0 26 23.0 27 32.0 28 25.0 29 22.0 30 43.0 31 57.0 32 65.0 33 108.0 34 148.0 35 223.0 36 522.0 37 2658.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.525 20.1 14.174999999999999 25.2 2 26.34610568494866 26.72176308539945 27.64838467317806 19.28374655647383 3 20.485850237916353 28.67518156774355 30.879038317054846 19.959929877285248 4 24.718256949661907 34.78587528174305 23.56624092161282 16.929626846982217 5 25.97044828449787 34.68569997495617 21.162033558727774 18.181818181818183 6 21.42142142142142 36.38638638638639 24.624624624624623 17.56756756756757 7 20.77596996245307 22.327909887359198 37.42177722152691 19.474342928660825 8 22.453066332916144 26.558197747183982 26.633291614518146 24.355444305381727 9 22.002503128911137 26.408010012515643 28.21026282853567 23.379224030037545 10-14 23.58448060075094 29.216520650813514 25.817271589486857 21.381727158948685 15-19 23.55944931163955 28.235294117647058 26.963704630788488 21.241551939924904 20-24 23.14355815933103 28.71663912673376 27.30459165790396 20.835211056031245 25-29 23.875068822263376 28.93538215125882 26.552880524550776 20.636668501927026 30-34 23.011505752876438 29.119559779889947 27.178589294647328 20.690345172586294 35-39 23.626813406703352 28.684342171085543 27.028514257128567 20.66033016508254 40-44 23.52646852796958 28.564995496847796 27.414189932953064 20.494346042229562 45-49 23.874843554443054 28.215269086357946 27.44430538172716 20.46558197747184 50-54 23.062287202082913 28.544962948127377 27.788904466252756 20.60384538353695 55-59 23.971162511264644 27.42064684089316 27.505757484730147 21.102433163112046 60-64 23.479349186483102 28.120150187734666 27.899874843554446 20.500625782227786 65-69 24.250312891113893 27.37421777221527 27.98498122653317 20.39048811013767 70-74 24.07703851925963 27.583791895947975 27.56378189094547 20.775387693846923 75-79 23.58707612283685 28.223467040112034 27.938381514454335 20.25107532259678 80-84 24.246061515378845 28.00200050012503 27.58689672418104 20.16504126031508 85-89 23.821910955477737 27.78389194597299 27.788894447223612 20.605302651325662 90-94 24.361925733159843 27.599839855870282 27.769992993694327 20.268241417275547 95-99 24.570713391739673 28.260325406758447 27.244055068836044 19.924906132665832 100-104 24.177475086383897 28.38399519254845 27.462566978817165 19.975962742250488 105-109 24.51299514247083 28.469127147077973 27.27727978366468 19.740597926786517 110-114 24.061091637456183 27.96695042563846 27.74161241862794 20.230345518277414 115-119 24.836012217715687 28.376145410845727 27.419758650042564 19.368083721396022 120-124 24.60575719649562 28.335419274092615 27.334167709637047 19.72465581977472 125-129 24.67603942562666 28.18832240956622 27.612948416470708 19.52268974833642 130-134 25.367757430201145 28.02962073451416 26.85880116081257 19.743820674472133 135-139 25.60200250312891 27.80976220275344 27.619524405506883 18.96871088861076 140-144 25.184035254644698 28.023436326305774 27.542691171315536 19.249837247733986 145-149 26.283367556468175 27.66564831972755 27.059648419892824 18.991335703911457 150-151 26.558978211870777 26.3961933383421 28.36213373403456 18.682694715752568 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 1.0 26 1.5 27 2.0 28 2.5 29 5.0 30 9.5 31 11.0 32 11.5 33 18.5 34 32.0 35 50.0 36 68.5 37 85.5 38 117.5 39 156.0 40 189.5 41 233.0 42 288.0 43 315.0 44 321.0 45 312.5 46 289.5 47 267.5 48 234.5 49 201.5 50 175.5 51 146.0 52 110.5 53 79.0 54 58.5 55 48.5 56 40.0 57 33.5 58 22.0 59 13.5 60 11.0 61 6.5 62 3.0 63 4.5 64 6.5 65 3.0 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.1 7 0.125 8 0.125 9 0.125 10-14 0.125 15-19 0.125 20-24 0.145 25-29 0.105 30-34 0.05 35-39 0.05 40-44 0.06999999999999999 45-49 0.125 50-54 0.13999999999999999 55-59 0.13 60-64 0.125 65-69 0.125 70-74 0.05 75-79 0.03 80-84 0.025 85-89 0.05 90-94 0.09 95-99 0.125 100-104 0.155 105-109 0.155 110-114 0.15 115-119 0.145 120-124 0.125 125-129 0.065 130-134 0.06999999999999999 135-139 0.125 140-144 0.155 145-149 0.165 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.45 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.3 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 4.112500000000001 0.0 0.0 0.0 0.0 124-125 4.5125 0.0 0.0 0.0 0.0 126-127 4.8875 0.0 0.0 0.0 0.0 128-129 5.487500000000001 0.0 0.0 0.0 0.0 130-131 6.125 0.0 0.0 0.0 0.0 132-133 6.925 0.0 0.0 0.0 0.0 134-135 7.5625 0.0 0.0 0.0 0.0 136-137 8.3125 0.0 0.0 0.0 0.0 138-139 8.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCAA 10 0.006830828 145.0 4 >>END_MODULE Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995972 spots for SRR7171507.sra Written 995972 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra Read 995954 spots for SRR7171507.sra Written 995954 spots for SRR7171507.sra SRR ids: ['SRR7171507.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__cotui5n SRR7171507.sra spots: 19919098 blocks: [[1, 995954], [995955, 1991908], [1991909, 2987862], [2987863, 3983816], [3983817, 4979770], [4979771, 5975724], [5975725, 6971678], [6971679, 7967632], [7967633, 8963586], [8963587, 9959540], [9959541, 10955494], [10955495, 11951448], [11951449, 12947402], [12947403, 13943356], [13943357, 14939310], [14939311, 15935264], [15935265, 16931218], [16931219, 17927172], [17927173, 18923126], [18923127, 19919098]] SRR7171507 file size 6728228 SRR7171507 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171507 SRR7171507_1.fastq SRR7171507_2.fastq Input file: SRR7171507_1.fastq Paired file: SRR7171507_2.fastq trimmed: SRR7171507-trimmed-pair1.fastq, SRR7171507-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:53:55 2025 >> started Fri Feb 14 12:54:20 2025 >> done (24.058s) 19919098 read pairs processed; of these: 522 ( 0.00%) short read pairs filtered out after trimming by size control 3084 ( 0.02%) empty read pairs filtered out after trimming by size control 19915492 (99.98%) read pairs available; of these: 2742631 (13.77%) trimmed read pairs available after processing 17172861 (86.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 4 0.00% 21 0 0.00% 22 4 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 2 0.00% 28 2 0.00% 29 4 0.00% 30 0 0.00% 31 1 0.00% 32 2 0.00% 33 6 0.00% 34 0 0.00% 35 1 0.00% 36 6 0.00% 37 2 0.00% 38 3 0.00% 39 8 0.00% 40 4 0.00% 41 11 0.00% 42 9 0.00% 43 10 0.00% 44 15 0.00% 45 21 0.00% 46 11 0.00% 47 17 0.00% 48 23 0.00% 49 22 0.00% 50 34 0.00% 51 44 0.00% 52 38 0.00% 53 52 0.00% 54 54 0.00% 55 64 0.00% 56 73 0.00% 57 83 0.00% 58 112 0.00% 59 117 0.00% 60 172 0.00% 61 152 0.00% 62 213 0.00% 63 247 0.00% 64 281 0.00% 65 289 0.00% 66 364 0.00% 67 382 0.00% 68 436 0.00% 69 557 0.00% 70 640 0.00% 71 732 0.00% 72 1008 0.01% 73 1009 0.01% 74 1213 0.01% 75 1510 0.01% 76 1583 0.01% 77 1810 0.01% 78 2061 0.01% 79 2357 0.01% 80 2608 0.01% 81 2971 0.01% 82 3489 0.02% 83 3945 0.02% 84 4505 0.02% 85 4927 0.02% 86 5264 0.03% 87 5892 0.03% 88 6396 0.03% 89 7021 0.04% 90 7720 0.04% 91 8581 0.04% 92 9644 0.05% 93 10521 0.05% 94 11543 0.06% 95 12213 0.06% 96 13231 0.07% 97 14027 0.07% 98 14684 0.07% 99 15804 0.08% 100 16894 0.08% 101 17788 0.09% 102 19704 0.10% 103 20942 0.11% 104 22215 0.11% 105 23577 0.12% 106 24425 0.12% 107 25287 0.13% 108 26448 0.13% 109 27259 0.14% 110 28242 0.14% 111 29729 0.15% 112 31247 0.16% 113 32634 0.16% 114 35052 0.18% 115 36709 0.18% 116 38122 0.19% 117 42777 0.21% 118 42091 0.21% 119 42761 0.21% 120 41448 0.21% 121 42953 0.22% 122 44678 0.22% 123 46764 0.23% 124 48888 0.25% 125 49806 0.25% 126 51691 0.26% 127 52871 0.27% 128 53284 0.27% 129 53913 0.27% 130 55240 0.28% 131 56317 0.28% 132 58673 0.29% 133 60778 0.31% 134 62059 0.31% 135 65167 0.33% 136 66046 0.33% 137 66992 0.34% 138 67409 0.34% 139 67949 0.34% 140 68619 0.34% 141 75405 0.38% 142 73007 0.37% 143 79505 0.40% 144 79498 0.40% 145 79790 0.40% 146 78730 0.40% 147 81325 0.41% 148 80250 0.40% 149 81214 0.41% 150 85584 0.43% 151 17172861 86.23% 19915492 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=24.16 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=9.2 sequence=TTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=24 prefix-density=0.40 prefix-fanout=2.8 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=38.60 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.6 sequence=AAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCGAGGGTTGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCCCGCAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCGTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCTC SRR7171507 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:55:49 Started mapping on | Feb 14 12:55:49 Finished on | Feb 14 12:58:02 Mapping speed, Million of reads per hour | 539.07 Number of input reads | 19915492 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16709492 Uniquely mapped reads % | 83.90% Average mapped length | 291.91 Number of splices: Total | 16813173 Number of splices: Annotated (sjdb) | 16498726 Number of splices: GT/AG | 16538849 Number of splices: GC/AG | 219666 Number of splices: AT/AC | 12349 Number of splices: Non-canonical | 42309 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471353 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 193018 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.56% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2734647 2734647 2734647 N_multimapping 471353 471353 471353 N_noFeature 395001 16560972 447718 N_ambiguous 267197 2216 169886 UnstrandedReadsAssigned:16047294 PositiveStrandReadsAssigned:146304 NegativeStrandReadsAssigned:16091888 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=147 echo kmer=143 SRR7171507 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171507-trimmed-pair1.fastq SRR7171507-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,915,492 reads, 17,852,129 reads pseudoaligned [quant] estimated average fragment length: 219.147 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR7171507.ke.tsv 34699 SRR7171507.se.tsv 87100 total ==> SRR7171507.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.85 1383 39.7597 Potri.005G024800.1.v4.1 1035 816.853 509 32.2427 Potri.004G059700.1.v4.1 961 742.881 25 1.74132 Potri.007G009000.2.v4.1 1416 1197.85 0 0 Potri.003G141000.2.v4.1 2943 2724.85 684 12.9888 Potri.016G087400.1.v4.1 270 89.3603 1743 1009.28 Potri.015G069301.1.v4.1 564 348.222 0 0 Potri.010G195200.1.v4.1 1773 1554.85 580.904 19.3318 Potri.012G127500.1.v4.1 977 758.862 5393 367.727 ==> SRR7171507.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 677 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 288 SRR7171507 completed mapping pipeline successfully