Starting /dee2/code/volunteer_pipeline.sh SRR7171508 current disk space = 3110875123712 free memory = 1571027608 SRR7171508 SRAfilesize c5ab9fe0e038356d08c7b985c2a95068 SRR7171508.sra SRR7171508.sra file validated SRR7171508 is paired end SRR7171508 is conventional basespace SRR7171508 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171508_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.76075 18.0 18.0 18.0 18.0 30.0 2 22.12175 18.0 18.0 25.0 18.0 32.0 3 28.551 29.0 27.0 30.0 27.0 31.0 4 31.5925 32.0 32.0 33.0 27.0 33.0 5 32.41425 33.0 33.0 33.0 32.0 33.0 6 36.77975 38.0 37.0 38.0 35.0 38.0 7 37.27425 38.0 38.0 38.0 36.0 38.0 8 37.40825 38.0 38.0 38.0 37.0 38.0 9 37.4505 38.0 38.0 38.0 37.0 38.0 10-14 37.52635 38.0 38.0 38.0 37.4 38.0 15-19 37.4696 38.0 38.0 38.0 37.6 38.0 20-24 37.40315 38.0 38.0 38.0 37.0 38.0 25-29 37.430899999999994 38.0 38.0 38.0 37.2 38.0 30-34 37.50385 38.0 38.0 38.0 38.0 38.0 35-39 36.2399 38.0 37.2 38.0 31.6 38.0 40-44 37.00345 38.0 38.0 38.0 34.4 38.0 45-49 37.396550000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.33155 38.0 38.0 38.0 37.0 38.0 55-59 37.217949999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.2503 38.0 38.0 38.0 36.8 38.0 65-69 37.25 38.0 38.0 38.0 37.0 38.0 70-74 34.53805 33.6 33.6 37.8 32.0 38.0 75-79 35.2645 36.2 35.0 38.0 31.8 38.0 80-84 37.13755 38.0 38.0 38.0 36.0 38.0 85-89 37.096349999999994 38.0 38.0 38.0 36.0 38.0 90-94 37.09695 38.0 38.0 38.0 36.0 38.0 95-99 37.037349999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.95 38.0 38.0 38.0 35.8 38.0 105-109 36.8543 38.0 38.0 38.0 35.0 38.0 110-114 36.60424999999999 38.0 38.0 38.0 34.2 38.0 115-119 36.575900000000004 38.0 38.0 38.0 34.2 38.0 120-124 36.4489 38.0 38.0 38.0 34.0 38.0 125-129 36.303149999999995 38.0 37.6 38.0 33.6 38.0 130-134 36.15615 38.0 37.0 38.0 33.2 38.0 135-139 36.257000000000005 38.0 37.4 38.0 33.4 38.0 140-144 36.0856 38.0 36.8 38.0 33.0 38.0 145-149 35.852250000000005 38.0 36.0 38.0 32.4 38.0 150-151 33.562 36.5 32.0 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 0.0 18 1.0 19 1.0 20 1.0 21 0.0 22 1.0 23 4.0 24 5.0 25 4.0 26 15.0 27 13.0 28 17.0 29 26.0 30 35.0 31 47.0 32 70.0 33 89.0 34 134.0 35 311.0 36 968.0 37 2255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.43073047858942 29.924433249370274 10.453400503778337 42.19143576826197 2 21.425 16.375 29.4 32.800000000000004 3 19.05 19.225 24.875 36.85 4 22.7 26.35 22.475 28.475 5 20.775 30.65 23.849999999999998 24.725 6 18.425 35.6 24.45 21.525 7 14.575 26.3 41.675000000000004 17.45 8 17.125 26.150000000000002 31.15 25.575 9 17.474999999999998 24.55 34.975 23.0 10-14 19.35 29.825000000000003 27.185 23.64 15-19 19.405 28.585 27.705000000000002 24.305 20-24 19.54 28.749999999999996 27.675 24.035 25-29 19.815990799539975 28.7764388219411 27.801390069503473 23.60618030901545 30-34 19.316760866303206 29.05516930925824 27.274546091131896 24.353523733306655 35-39 19.77384168918243 29.400580406284398 27.154007805463827 23.671570099069346 40-44 19.817972695904384 29.039355903385506 27.86918037705656 23.27349102365355 45-49 20.07202520882309 28.945130795778525 27.25453908868104 23.72830490671735 50-54 19.58097904895245 29.271463573178657 27.006350317515874 24.141207060353018 55-59 19.439999999999998 29.28 27.49 23.79 60-64 19.555 28.63 27.584999999999997 24.23 65-69 19.245 28.645 28.57 23.54 70-74 21.095 29.265 25.89 23.75 75-79 19.49 28.395 27.915 24.2 80-84 19.685 28.535 27.465 24.315 85-89 19.155 28.335 28.09 24.42 90-94 20.01 28.310000000000002 27.68 24.0 95-99 19.945 28.144999999999996 28.035 23.875 100-104 20.080000000000002 28.875 27.0 24.044999999999998 105-109 20.635 27.994999999999997 27.855 23.515 110-114 20.135 28.28 27.92 23.665 115-119 20.265 28.035 27.72 23.98 120-124 20.335 28.575 27.155 23.935000000000002 125-129 21.17 27.96 26.87 24.0 130-134 20.91 28.410000000000004 27.01 23.669999999999998 135-139 20.965 28.365000000000002 26.745 23.925 140-144 20.565 28.035 27.315 24.085 145-149 21.32 28.235 26.845000000000002 23.599999999999998 150-151 20.375 28.175 26.237500000000004 25.2125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 3.0 26 4.0 27 3.5 28 4.0 29 13.5 30 19.5 31 19.0 32 33.0 33 44.5 34 50.0 35 64.5 36 88.0 37 112.0 38 146.0 39 176.5 40 207.0 41 243.5 42 259.0 43 254.0 44 260.0 45 291.5 46 289.0 47 258.0 48 223.5 49 192.5 50 160.0 51 127.0 52 104.0 53 84.0 54 73.0 55 55.0 56 34.0 57 23.5 58 19.0 59 11.0 60 7.5 61 9.5 62 9.0 63 5.0 64 2.5 65 2.5 66 2.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.0 72 1.5 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.034999999999999996 35-39 0.06999999999999999 40-44 0.015 45-49 0.034999999999999996 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.4875 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.6624999999999996 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.6875 0.0 0.0 0.0 0.0 126-127 5.125 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.137499999999999 0.0 0.0 0.0 0.0 132-133 6.7625 0.0 0.0 0.0 0.0 134-135 7.3 0.0 0.0 0.0 0.0 136-137 7.85 0.0 0.0 0.0 0.0 138-139 8.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTGAA 35 0.0033124194 62.14286 145 >>END_MODULE SRR7171508 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171508_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94525 33.0 33.0 34.0 32.0 34.0 2 33.055 34.0 33.0 34.0 32.0 34.0 3 33.10625 34.0 33.0 34.0 33.0 34.0 4 33.12075 34.0 33.0 34.0 33.0 34.0 5 33.123 34.0 33.0 34.0 33.0 34.0 6 37.20175 38.0 38.0 38.0 37.0 38.0 7 37.18025 38.0 38.0 38.0 37.0 38.0 8 37.165 38.0 38.0 38.0 37.0 38.0 9 37.197 38.0 38.0 38.0 37.0 38.0 10-14 37.152499999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.142700000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.13535 38.0 38.0 38.0 37.0 38.0 25-29 37.17495 38.0 38.0 38.0 37.0 38.0 30-34 37.24615 38.0 38.0 38.0 37.0 38.0 35-39 37.15045 38.0 38.0 38.0 36.8 38.0 40-44 37.00664999999999 38.0 38.0 38.0 36.2 38.0 45-49 37.0963 38.0 38.0 38.0 36.6 38.0 50-54 37.0721 38.0 38.0 38.0 36.8 38.0 55-59 37.0823 38.0 38.0 38.0 36.8 38.0 60-64 37.06015000000001 38.0 38.0 38.0 36.6 38.0 65-69 37.0242 38.0 38.0 38.0 36.2 38.0 70-74 36.9722 38.0 38.0 38.0 36.0 38.0 75-79 36.9459 38.0 38.0 38.0 36.0 38.0 80-84 36.8604 38.0 38.0 38.0 35.8 38.0 85-89 36.82655 38.0 38.0 38.0 35.6 38.0 90-94 36.71195 38.0 38.0 38.0 35.0 38.0 95-99 36.7111 38.0 38.0 38.0 35.2 38.0 100-104 36.565999999999995 38.0 38.0 38.0 34.6 38.0 105-109 36.564099999999996 38.0 38.0 38.0 34.6 38.0 110-114 36.4838 38.0 38.0 38.0 34.2 38.0 115-119 36.367450000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.15035 38.0 38.0 38.0 33.6 38.0 125-129 36.1419 38.0 38.0 38.0 33.2 38.0 130-134 36.061400000000006 38.0 37.8 38.0 33.2 38.0 135-139 35.838649999999994 38.0 37.0 38.0 32.2 38.0 140-144 35.640249999999995 38.0 36.0 38.0 31.0 38.0 145-149 35.2975 38.0 36.0 38.0 29.6 38.0 150-151 32.681125 35.5 30.5 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 4.0 16 3.0 17 4.0 18 1.0 19 2.0 20 7.0 21 4.0 22 3.0 23 7.0 24 7.0 25 23.0 26 19.0 27 26.0 28 26.0 29 23.0 30 34.0 31 43.0 32 68.0 33 90.0 34 99.0 35 171.0 36 411.0 37 2920.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.66266266266266 20.57057057057057 15.04004004004004 26.726726726726728 2 26.351351351351347 26.476476476476474 29.504504504504503 17.667667667667665 3 20.27027027027027 29.07907907907908 29.554554554554553 21.096096096096094 4 23.673673673673672 35.28528528528528 23.1981981981982 17.842842842842842 5 26.007509386733418 34.71839799749687 23.00375469336671 16.270337922403 6 21.64328657314629 36.77354709418837 23.196392785571142 18.386773547094187 7 20.265531062124246 21.8436873747495 38.45190380761523 19.438877755511022 8 23.554443053817273 24.23028785982478 28.11013767209011 24.105131414267834 9 21.67376597344024 26.13380105236783 29.616637434227012 22.575795539964922 10-14 24.283279871692063 29.375501202886927 25.496190858059343 20.845028067361667 15-19 23.511427425821974 28.743985565356855 27.62129109863673 20.123295910184442 20-24 23.968930092708593 27.642194938611876 27.942871460786773 20.446003507892758 25-29 23.229490133226484 28.383251527596915 27.98257036962837 20.40468796954823 30-34 23.092711253504206 28.739487384861835 27.6231477773328 20.544653584301162 35-39 23.48848848848849 28.258258258258255 27.61761761761762 20.635635635635634 40-44 23.474648380799838 28.26968316732569 27.719105060313332 20.53656339156114 45-49 23.875588500450768 27.371531603726336 27.937493739356906 20.815386156465994 50-54 23.25884357150015 28.144102615492532 27.81340815712997 20.783645655877343 55-59 23.76704089815557 27.751603849238172 27.861868484362468 20.619486768243785 60-64 23.293233082706767 28.19047619047619 28.000000000000004 20.516290726817044 65-69 23.964334017933176 27.911636527576018 27.871562390422284 20.252467064068526 70-74 23.853853853853852 27.312312312312315 28.013013013013012 20.82082082082082 75-79 23.741870935467734 27.64382191095548 28.01400700350175 20.60030015007504 80-84 24.55991198239648 27.225445089017803 27.965593118623726 20.249049809961992 85-89 24.38194374937444 28.500650585526976 27.03433089780803 20.08307476729056 90-94 24.3342010412495 27.738285943131757 27.803364036844215 20.124148978774528 95-99 24.1120184359501 27.83928660888733 27.44852462301488 20.600170332147687 100-104 24.18045112781955 27.80952380952381 27.979949874686717 20.030075187969924 105-109 23.988772492606884 28.058743922610397 28.16400180442083 19.788481780361884 110-114 24.482430197002355 27.68058549300717 28.041505839891723 19.79547847009875 115-119 24.165413533834588 28.411027568922304 27.959899749373434 19.463659147869674 120-124 24.634341815267483 28.325986776197155 27.40933680625125 19.630334602284112 125-129 25.02503003604325 27.377853424108935 27.793352022426916 19.803764517420905 130-134 24.886130436958805 28.595024776014817 27.083437609489962 19.435407177536412 135-139 25.63871355575594 27.472197174631802 28.00320609157399 18.885883178038274 140-144 25.87356494710984 27.60314834310924 27.05168697047175 19.47159973930917 145-149 26.27067669172932 27.73934837092732 27.23809523809524 18.75187969924812 150-151 25.964912280701753 27.44360902255639 27.60651629072682 18.984962406015036 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 0.5 23 1.5 24 2.0 25 1.5 26 2.5 27 3.0 28 6.0 29 8.5 30 10.0 31 13.5 32 21.0 33 31.0 34 42.0 35 57.5 36 81.0 37 103.0 38 125.0 39 166.0 40 202.0 41 242.0 42 268.0 43 267.5 44 276.0 45 280.5 46 274.5 47 264.0 48 248.5 49 220.0 50 178.0 51 129.0 52 98.0 53 85.5 54 60.5 55 47.0 56 45.0 57 34.0 58 25.0 59 17.5 60 13.5 61 9.5 62 6.0 63 5.0 64 5.0 65 4.5 66 3.0 67 1.0 68 0.5 69 1.5 70 1.0 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.125 6 0.2 7 0.2 8 0.125 9 0.22499999999999998 10-14 0.24 15-19 0.24 20-24 0.22499999999999998 25-29 0.16999999999999998 30-34 0.12 35-39 0.1 40-44 0.105 45-49 0.16999999999999998 50-54 0.21 55-59 0.24 60-64 0.25 65-69 0.185 70-74 0.1 75-79 0.05 80-84 0.02 85-89 0.09 90-94 0.12 95-99 0.19499999999999998 100-104 0.25 105-109 0.245 110-114 0.255 115-119 0.25 120-124 0.18 125-129 0.12 130-134 0.105 135-139 0.19 140-144 0.265 145-149 0.25 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77375565610859 99.225 2 0.1256913021618904 0.25 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.050276520864756154 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 7 0.17500000000000002 No Hit GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8500000000000001 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.4875 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.65 0.0 0.0 0.0 0.0 118-119 3.0999999999999996 0.0 0.0 0.0 0.0 120-121 3.575 0.0 0.0 0.0 0.0 122-123 4.05 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 5.075 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.0625 0.0 0.0 0.0 0.0 132-133 6.6875 0.0 0.0 0.0 0.0 134-135 7.225 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.412500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTAGGG 45 0.008957279 48.333332 145 AAAAAAA 30 0.0014437955 24.166668 10-14 >>END_MODULE Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741109 spots for SRR7171508.sra Written 741109 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra Read 741096 spots for SRR7171508.sra Written 741096 spots for SRR7171508.sra SRR ids: ['SRR7171508.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_13y2ruuj SRR7171508.sra spots: 14821933 blocks: [[1, 741096], [741097, 1482192], [1482193, 2223288], [2223289, 2964384], [2964385, 3705480], [3705481, 4446576], [4446577, 5187672], [5187673, 5928768], [5928769, 6669864], [6669865, 7410960], [7410961, 8152056], [8152057, 8893152], [8893153, 9634248], [9634249, 10375344], [10375345, 11116440], [11116441, 11857536], [11857537, 12598632], [12598633, 13339728], [13339729, 14080824], [14080825, 14821933]] SRR7171508 file size 5000966 SRR7171508 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171508 SRR7171508_1.fastq SRR7171508_2.fastq Input file: SRR7171508_1.fastq Paired file: SRR7171508_2.fastq trimmed: SRR7171508-trimmed-pair1.fastq, SRR7171508-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:52:13 2025 >> started Fri Feb 14 12:52:36 2025 >> done (22.793s) 14821933 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 1211 ( 0.01%) empty read pairs filtered out after trimming by size control 14820702 (99.99%) read pairs available; of these: 1946522 (13.13%) trimmed read pairs available after processing 12874180 (86.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 2 0.00% 33 1 0.00% 34 8 0.00% 35 2 0.00% 36 0 0.00% 37 1 0.00% 38 4 0.00% 39 3 0.00% 40 8 0.00% 41 9 0.00% 42 1 0.00% 43 7 0.00% 44 9 0.00% 45 7 0.00% 46 3 0.00% 47 9 0.00% 48 11 0.00% 49 23 0.00% 50 16 0.00% 51 21 0.00% 52 21 0.00% 53 12 0.00% 54 25 0.00% 55 39 0.00% 56 36 0.00% 57 30 0.00% 58 42 0.00% 59 60 0.00% 60 65 0.00% 61 105 0.00% 62 97 0.00% 63 100 0.00% 64 127 0.00% 65 143 0.00% 66 154 0.00% 67 205 0.00% 68 224 0.00% 69 284 0.00% 70 343 0.00% 71 374 0.00% 72 473 0.00% 73 504 0.00% 74 597 0.00% 75 703 0.00% 76 769 0.01% 77 872 0.01% 78 1068 0.01% 79 1208 0.01% 80 1406 0.01% 81 1608 0.01% 82 1798 0.01% 83 2152 0.01% 84 2489 0.02% 85 2847 0.02% 86 3069 0.02% 87 3366 0.02% 88 3763 0.03% 89 4074 0.03% 90 4581 0.03% 91 5133 0.03% 92 5904 0.04% 93 6407 0.04% 94 7024 0.05% 95 7440 0.05% 96 8300 0.06% 97 8850 0.06% 98 9417 0.06% 99 10359 0.07% 100 10884 0.07% 101 11566 0.08% 102 12513 0.08% 103 13612 0.09% 104 14519 0.10% 105 15564 0.11% 106 16344 0.11% 107 17293 0.12% 108 17878 0.12% 109 18530 0.13% 110 19527 0.13% 111 20534 0.14% 112 21612 0.15% 113 22632 0.15% 114 24016 0.16% 115 25406 0.17% 116 26916 0.18% 117 29302 0.20% 118 30240 0.20% 119 29523 0.20% 120 29390 0.20% 121 30702 0.21% 122 31847 0.21% 123 33017 0.22% 124 34720 0.23% 125 35519 0.24% 126 37102 0.25% 127 37721 0.25% 128 38822 0.26% 129 39321 0.27% 130 40369 0.27% 131 41045 0.28% 132 42972 0.29% 133 44086 0.30% 134 45159 0.30% 135 46226 0.31% 136 47697 0.32% 137 48706 0.33% 138 49517 0.33% 139 50436 0.34% 140 51399 0.35% 141 54853 0.37% 142 55428 0.37% 143 56368 0.38% 144 56873 0.38% 145 59394 0.40% 146 57276 0.39% 147 58394 0.39% 148 60726 0.41% 149 59690 0.40% 150 64511 0.44% 151 12874180 86.87% 14820702 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=12 prefix-density=1.03 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=7.40 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=1.1 sequence=CAGCCATTCTCGGCTCCCACGACCGTCTCAGCAGCTCCCGCAAAGTGACCCTTCTCTGGTGCCACACCAAGAACCAGAGTTTCGTTGGTGATCGTCTCTGAGGAGCTCATGTCAGGGTACA criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=22 prefix-density=0.88 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=17 fanout-score=44.12 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=13.4 sequence=TTGGTGCTGAGA SRR7171508 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:54:18 Started mapping on | Feb 14 12:54:18 Finished on | Feb 14 12:55:50 Mapping speed, Million of reads per hour | 579.94 Number of input reads | 14820702 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 12490523 Uniquely mapped reads % | 84.28% Average mapped length | 288.08 Number of splices: Total | 12229903 Number of splices: Annotated (sjdb) | 11993045 Number of splices: GT/AG | 12032871 Number of splices: GC/AG | 151943 Number of splices: AT/AC | 8898 Number of splices: Non-canonical | 36191 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305328 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 115095 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.71% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2024943 2024943 2024943 N_multimapping 305328 305328 305328 N_noFeature 347159 12376482 388730 N_ambiguous 205786 1527 132314 UnstrandedReadsAssigned:11937578 PositiveStrandReadsAssigned:112514 NegativeStrandReadsAssigned:11969479 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171508 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171508-trimmed-pair1.fastq SRR7171508-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,820,702 reads, 13,364,523 reads pseudoaligned [quant] estimated average fragment length: 218.071 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7171508.ke.tsv 34699 SRR7171508.se.tsv 87100 total ==> SRR7171508.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.93 1147 43.6425 Potri.005G024800.1.v4.1 1035 817.929 887 74.3106 Potri.004G059700.1.v4.1 961 743.934 10 0.921102 Potri.007G009000.2.v4.1 1416 1198.93 0 0 Potri.003G141000.2.v4.1 2943 2725.93 940.297 23.637 Potri.016G087400.1.v4.1 270 90.0965 1075 817.603 Potri.015G069301.1.v4.1 564 349.42 0 0 Potri.010G195200.1.v4.1 1773 1555.93 379.921 16.7319 Potri.012G127500.1.v4.1 977 759.934 4421 398.646 ==> SRR7171508.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 361 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 123 SRR7171508 completed mapping pipeline successfully