Starting /dee2/code/volunteer_pipeline.sh SRR7171509 current disk space = 3110612754432 free memory = 1572856980 SRR7171509 SRAfilesize 3889f950a2808466405c3761f73177bb SRR7171509.sra SRR7171509.sra file validated SRR7171509 is paired end SRR7171509 is conventional basespace SRR7171509 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171509_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5495 33.0 33.0 34.0 32.0 34.0 2 32.9035 34.0 33.0 34.0 32.0 34.0 3 31.9845 33.0 31.0 33.0 29.0 34.0 4 32.2225 33.0 33.0 33.0 31.0 34.0 5 32.5975 33.0 33.0 34.0 32.0 34.0 6 35.95025 37.0 36.0 38.0 33.0 38.0 7 37.0215 38.0 37.0 38.0 35.0 38.0 8 37.37575 38.0 38.0 38.0 37.0 38.0 9 37.55025 38.0 38.0 38.0 37.0 38.0 10-14 37.5767 38.0 38.0 38.0 38.0 38.0 15-19 37.529450000000004 38.0 38.0 38.0 37.8 38.0 20-24 37.5501 38.0 38.0 38.0 38.0 38.0 25-29 37.49995 38.0 38.0 38.0 37.4 38.0 30-34 37.53215 38.0 38.0 38.0 37.6 38.0 35-39 37.51369999999999 38.0 38.0 38.0 37.6 38.0 40-44 37.49555 38.0 38.0 38.0 37.0 38.0 45-49 37.4411 38.0 38.0 38.0 37.0 38.0 50-54 37.42265 38.0 38.0 38.0 37.0 38.0 55-59 37.3344 38.0 38.0 38.0 37.0 38.0 60-64 37.2877 38.0 38.0 38.0 37.0 38.0 65-69 37.299 38.0 38.0 38.0 37.0 38.0 70-74 37.157 38.0 38.0 38.0 36.2 38.0 75-79 37.1748 38.0 38.0 38.0 36.0 38.0 80-84 37.14035 38.0 38.0 38.0 36.0 38.0 85-89 37.06955 38.0 38.0 38.0 36.0 38.0 90-94 37.02575 38.0 38.0 38.0 36.0 38.0 95-99 36.83585 38.0 38.0 38.0 35.0 38.0 100-104 36.8546 38.0 38.0 38.0 35.0 38.0 105-109 36.660450000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.70870000000001 38.0 38.0 38.0 34.4 38.0 115-119 36.54095 38.0 38.0 38.0 34.0 38.0 120-124 36.41105 38.0 38.0 38.0 34.0 38.0 125-129 36.320449999999994 38.0 37.4 38.0 33.8 38.0 130-134 36.167950000000005 38.0 37.0 38.0 33.4 38.0 135-139 35.99725 38.0 36.2 38.0 33.0 38.0 140-144 35.764399999999995 38.0 36.0 38.0 31.4 38.0 145-149 35.570049999999995 38.0 36.0 38.0 31.0 38.0 150-151 33.73525 36.5 32.5 38.0 22.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 5.0 24 5.0 25 2.0 26 6.0 27 5.0 28 26.0 29 19.0 30 24.0 31 60.0 32 40.0 33 88.0 34 107.0 35 228.0 36 623.0 37 2759.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.998164175190134 11.696826645685812 10.988722790453712 38.31628638867034 2 22.5 14.424999999999999 32.324999999999996 30.75 3 20.95 19.725 24.75 34.575 4 24.025 26.025 23.175 26.775 5 23.849999999999998 30.775000000000002 22.6 22.775000000000002 6 19.625 35.125 24.3 20.95 7 13.625000000000002 26.55 42.699999999999996 17.125 8 18.775 24.9 31.1 25.224999999999998 9 16.55 25.025 33.875 24.55 10-14 19.61 30.080000000000002 27.439999999999998 22.869999999999997 15-19 19.845 28.395 27.71 24.05 20-24 20.275000000000002 28.575 28.035 23.115 25-29 20.560000000000002 29.03 27.495000000000005 22.915 30-34 20.544999999999998 29.04 27.439999999999998 22.975 35-39 19.965 28.970000000000002 27.500000000000004 23.565 40-44 19.97 28.754999999999995 27.785 23.49 45-49 19.865 28.93 27.565 23.64 50-54 20.455000000000002 28.994999999999997 26.974999999999998 23.575 55-59 20.119999999999997 28.49 27.215 24.175 60-64 19.97 29.035 27.279999999999998 23.715 65-69 20.36 28.410000000000004 27.900000000000002 23.330000000000002 70-74 20.345 28.585 27.200000000000003 23.87 75-79 19.825 28.17 28.03 23.974999999999998 80-84 20.715 28.37 27.700000000000003 23.215 85-89 20.49 27.71 27.755000000000003 24.044999999999998 90-94 20.669999999999998 28.585 27.325 23.419999999999998 95-99 20.735 28.144999999999996 27.785 23.335 100-104 20.645 28.970000000000002 26.755000000000003 23.630000000000003 105-109 21.04 28.689999999999998 27.35 22.919999999999998 110-114 21.404999999999998 28.435 26.840000000000003 23.32 115-119 21.240000000000002 28.849999999999998 26.745 23.165 120-124 21.255 28.59 26.395000000000003 23.76 125-129 20.880000000000003 28.09 27.175 23.855 130-134 21.52 28.22 26.340000000000003 23.919999999999998 135-139 21.115000000000002 27.88 26.755000000000003 24.25 140-144 21.195 27.67 26.979999999999997 24.154999999999998 145-149 21.285 28.355000000000004 26.445 23.915 150-151 21.852731591448933 27.315914489311165 26.16577072134017 24.66558319789974 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 3.0 25 4.0 26 4.0 27 4.5 28 7.5 29 14.5 30 15.5 31 23.5 32 35.5 33 43.0 34 55.5 35 73.0 36 81.5 37 90.5 38 136.0 39 170.0 40 190.0 41 217.5 42 241.5 43 277.5 44 279.0 45 261.0 46 265.0 47 254.5 48 221.0 49 196.0 50 168.5 51 139.5 52 130.5 53 95.5 54 68.5 55 61.5 56 42.5 57 28.5 58 19.0 59 20.0 60 19.0 61 13.0 62 7.5 63 5.5 64 3.5 65 1.5 66 2.0 67 1.0 68 1.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.11249999999999999 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.325 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.9124999999999999 0.0 0.0 0.0 0.0 104-105 2.325 0.0 0.0 0.0 0.0 106-107 2.8625 0.0 0.0 0.0 0.0 108-109 3.2125 0.0 0.0 0.0 0.0 110-111 3.5375 0.0 0.0 0.0 0.0 112-113 4.125 0.0 0.0 0.0 0.0 114-115 4.6875 0.0 0.0 0.0 0.0 116-117 5.574999999999999 0.0 0.0 0.0 0.0 118-119 6.3125 0.0 0.0 0.0 0.0 120-121 6.85 0.0 0.0 0.0 0.0 122-123 7.3 0.0 0.0 0.0 0.0 124-125 7.825 0.0 0.0 0.0 0.0 126-127 8.4875 0.0 0.0 0.0 0.0 128-129 9.100000000000001 0.0 0.0 0.0 0.0 130-131 9.662500000000001 0.0 0.0 0.0 0.0 132-133 10.475000000000001 0.0 0.0 0.0 0.0 134-135 11.35 0.0 0.0 0.0 0.0 136-137 12.0375 0.0 0.0 0.0 0.0 138-139 12.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAGAAT 10 0.005853838 152.57895 1 >>END_MODULE SRR7171509 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171509_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01275 33.0 33.0 34.0 32.0 34.0 2 33.13325 34.0 33.0 34.0 32.0 34.0 3 33.18325 34.0 33.0 34.0 33.0 34.0 4 33.15925 34.0 33.0 34.0 33.0 34.0 5 33.08075 34.0 33.0 34.0 33.0 34.0 6 37.31275 38.0 38.0 38.0 37.0 38.0 7 37.424 38.0 38.0 38.0 37.0 38.0 8 37.37275 38.0 38.0 38.0 37.0 38.0 9 37.344 38.0 38.0 38.0 37.0 38.0 10-14 37.25789999999999 38.0 38.0 38.0 36.8 38.0 15-19 37.3152 38.0 38.0 38.0 37.0 38.0 20-24 37.30185 38.0 38.0 38.0 37.0 38.0 25-29 37.268299999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.24945 38.0 38.0 38.0 37.0 38.0 35-39 37.224399999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.17125 38.0 38.0 38.0 36.6 38.0 45-49 37.1357 38.0 38.0 38.0 36.0 38.0 50-54 37.09285 38.0 38.0 38.0 36.0 38.0 55-59 36.9931 38.0 38.0 38.0 36.0 38.0 60-64 37.03055 38.0 38.0 38.0 36.0 38.0 65-69 36.955 38.0 38.0 38.0 35.8 38.0 70-74 36.9373 38.0 38.0 38.0 35.8 38.0 75-79 36.83365 38.0 38.0 38.0 35.2 38.0 80-84 36.78645 38.0 38.0 38.0 34.8 38.0 85-89 36.65875 38.0 38.0 38.0 34.2 38.0 90-94 36.59885 38.0 38.0 38.0 34.0 38.0 95-99 36.44175 38.0 38.0 38.0 34.0 38.0 100-104 36.31035 38.0 37.6 38.0 33.6 38.0 105-109 36.1211 38.0 37.0 38.0 33.0 38.0 110-114 35.9522 38.0 37.0 38.0 32.2 38.0 115-119 35.752750000000006 38.0 36.6 38.0 31.0 38.0 120-124 35.508050000000004 38.0 36.0 38.0 29.8 38.0 125-129 35.476600000000005 38.0 36.0 38.0 29.6 38.0 130-134 35.122099999999996 38.0 35.4 38.0 28.0 38.0 135-139 34.67375 38.0 35.0 38.0 24.8 38.0 140-144 34.518750000000004 38.0 35.0 38.0 24.0 38.0 145-149 33.9881 38.0 33.4 38.0 23.0 38.0 150-151 31.1905 35.5 27.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 6.0 18 3.0 19 0.0 20 5.0 21 5.0 22 5.0 23 3.0 24 5.0 25 19.0 26 17.0 27 23.0 28 22.0 29 34.0 30 48.0 31 62.0 32 67.0 33 106.0 34 176.0 35 316.0 36 741.0 37 2335.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.35 19.3 16.625 26.724999999999998 2 26.25 26.125 29.125 18.5 3 21.8 27.875 29.375 20.95 4 22.6 34.375 23.25 19.775000000000002 5 24.3 34.775 22.15 18.775 6 21.575 36.0 23.775 18.65 7 20.7 20.7 39.0 19.6 8 23.025000000000002 24.15 27.750000000000004 25.074999999999996 9 21.875 25.474999999999998 30.0 22.650000000000002 10-14 23.43 28.62 26.72 21.23 15-19 23.405 27.62 27.83 21.145 20-24 23.69 27.82 27.815 20.674999999999997 25-29 23.78 28.16 27.27 20.79 30-34 23.189999999999998 28.255000000000003 27.384999999999998 21.17 35-39 22.555 28.315 27.810000000000002 21.32 40-44 22.919999999999998 27.985 27.775 21.32 45-49 23.044999999999998 28.02 27.88 21.055 50-54 23.635 27.750000000000004 27.735 20.880000000000003 55-59 23.155 28.1 27.6 21.145 60-64 23.235 27.500000000000004 28.17 21.095 65-69 23.794999999999998 28.065 27.625 20.515 70-74 23.419999999999998 28.29 27.900000000000002 20.39 75-79 23.735 27.71 27.560000000000002 20.995 80-84 23.45 27.1 28.355000000000004 21.095 85-89 24.305 27.62 27.345000000000002 20.73 90-94 24.05 27.750000000000004 27.084999999999997 21.115000000000002 95-99 23.97 27.79 27.650000000000002 20.59 100-104 23.665 28.345 27.33 20.66 105-109 23.69 27.68 28.08 20.549999999999997 110-114 24.47 28.23 27.265 20.035 115-119 24.9 27.24 27.794999999999998 20.064999999999998 120-124 25.195 27.48 27.029999999999998 20.294999999999998 125-129 24.825 28.349999999999998 27.055 19.77 130-134 25.124999999999996 27.79 27.315 19.77 135-139 25.965 27.655 26.900000000000002 19.48 140-144 26.545 27.965 26.565 18.925 145-149 26.61 27.315 27.05 19.025 150-151 26.4625 26.875 26.724999999999998 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 1.5 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 2.0 27 2.5 28 2.5 29 5.0 30 8.0 31 16.0 32 23.5 33 24.5 34 31.5 35 43.5 36 68.0 37 100.0 38 132.5 39 158.5 40 194.5 41 233.0 42 260.0 43 280.5 44 275.5 45 294.0 46 298.5 47 271.0 48 246.0 49 223.0 50 183.0 51 136.0 52 119.0 53 97.5 54 65.5 55 47.5 56 38.0 57 24.0 58 19.5 59 16.5 60 13.0 61 13.5 62 8.0 63 3.5 64 2.5 65 1.5 66 3.0 67 5.5 68 3.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.6125 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.4 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.5875000000000004 0.0 0.0 0.0 0.0 112-113 4.1875 0.0 0.0 0.0 0.0 114-115 4.737500000000001 0.0 0.0 0.0 0.0 116-117 5.65 0.0 0.0 0.0 0.0 118-119 6.4 0.0 0.0 0.0 0.0 120-121 6.9 0.0 0.0 0.0 0.0 122-123 7.3625 0.0 0.0 0.0 0.0 124-125 7.85 0.0 0.0 0.0 0.0 126-127 8.462499999999999 0.0 0.0 0.0 0.0 128-129 9.05 0.0 0.0 0.0 0.0 130-131 9.6375 0.0 0.0 0.0 0.0 132-133 10.425 0.0 0.0 0.0 0.0 134-135 11.2375 0.0 0.0 0.0 0.0 136-137 11.95 0.0 0.0 0.0 0.0 138-139 12.962499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 759391 spots for SRR7171509.sra Written 759391 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra Read 759382 spots for SRR7171509.sra Written 759382 spots for SRR7171509.sra SRR ids: ['SRR7171509.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sgc6qox1 SRR7171509.sra spots: 15187649 blocks: [[1, 759382], [759383, 1518764], [1518765, 2278146], [2278147, 3037528], [3037529, 3796910], [3796911, 4556292], [4556293, 5315674], [5315675, 6075056], [6075057, 6834438], [6834439, 7593820], [7593821, 8353202], [8353203, 9112584], [9112585, 9871966], [9871967, 10631348], [10631349, 11390730], [11390731, 12150112], [12150113, 12909494], [12909495, 13668876], [13668877, 14428258], [14428259, 15187649]] SRR7171509 file size 5124895 SRR7171509 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171509 SRR7171509_1.fastq SRR7171509_2.fastq Input file: SRR7171509_1.fastq Paired file: SRR7171509_2.fastq trimmed: SRR7171509-trimmed-pair1.fastq, SRR7171509-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:05:29 2025 >> started Fri Feb 14 13:05:46 2025 >> done (17.327s) 15187649 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 1319 ( 0.01%) empty read pairs filtered out after trimming by size control 15186295 (99.99%) read pairs available; of these: 2819950 (18.57%) trimmed read pairs available after processing 12366345 (81.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 5 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 4 0.00% 30 4 0.00% 31 2 0.00% 32 4 0.00% 33 0 0.00% 34 3 0.00% 35 3 0.00% 36 5 0.00% 37 3 0.00% 38 2 0.00% 39 6 0.00% 40 9 0.00% 41 13 0.00% 42 9 0.00% 43 11 0.00% 44 10 0.00% 45 22 0.00% 46 16 0.00% 47 15 0.00% 48 21 0.00% 49 41 0.00% 50 26 0.00% 51 43 0.00% 52 53 0.00% 53 71 0.00% 54 64 0.00% 55 68 0.00% 56 108 0.00% 57 129 0.00% 58 142 0.00% 59 146 0.00% 60 198 0.00% 61 242 0.00% 62 264 0.00% 63 301 0.00% 64 365 0.00% 65 462 0.00% 66 500 0.00% 67 601 0.00% 68 757 0.00% 69 836 0.01% 70 891 0.01% 71 1108 0.01% 72 1334 0.01% 73 1591 0.01% 74 1744 0.01% 75 2022 0.01% 76 2321 0.02% 77 2598 0.02% 78 2923 0.02% 79 3266 0.02% 80 3836 0.03% 81 4193 0.03% 82 4797 0.03% 83 5504 0.04% 84 6147 0.04% 85 6842 0.05% 86 7372 0.05% 87 8126 0.05% 88 8836 0.06% 89 9681 0.06% 90 10469 0.07% 91 11528 0.08% 92 12797 0.08% 93 14110 0.09% 94 15398 0.10% 95 16407 0.11% 96 17259 0.11% 97 18214 0.12% 98 18923 0.12% 99 20279 0.13% 100 21391 0.14% 101 22797 0.15% 102 24257 0.16% 103 25836 0.17% 104 27737 0.18% 105 28475 0.19% 106 30234 0.20% 107 31093 0.20% 108 31782 0.21% 109 33067 0.22% 110 33345 0.22% 111 35010 0.23% 112 36368 0.24% 113 38468 0.25% 114 40085 0.26% 115 41578 0.27% 116 42744 0.28% 117 43421 0.29% 118 43842 0.29% 119 44903 0.30% 120 45124 0.30% 121 47243 0.31% 122 48278 0.32% 123 50086 0.33% 124 51888 0.34% 125 53198 0.35% 126 53792 0.35% 127 54547 0.36% 128 55691 0.37% 129 56277 0.37% 130 56444 0.37% 131 57533 0.38% 132 59045 0.39% 133 60831 0.40% 134 61480 0.40% 135 62628 0.41% 136 63518 0.42% 137 64361 0.42% 138 64904 0.43% 139 65092 0.43% 140 65417 0.43% 141 66209 0.44% 142 67246 0.44% 143 67453 0.44% 144 69128 0.46% 145 70313 0.46% 146 70948 0.47% 147 71642 0.47% 148 72408 0.48% 149 71896 0.47% 150 72782 0.48% 151 12366345 81.43% 15186295 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=16 prefix-density=0.49 prefix-fanout=3.2 sequence=CCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=84.11 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.4 sequence=CTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAG criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=31 prefix-density=0.52 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=55.36 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.4 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCG SRR7171509 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:06:59 Started mapping on | Feb 14 13:06:59 Finished on | Feb 14 13:09:07 Mapping speed, Million of reads per hour | 427.11 Number of input reads | 15186295 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13838512 Uniquely mapped reads % | 91.13% Average mapped length | 291.43 Number of splices: Total | 13004332 Number of splices: Annotated (sjdb) | 12741592 Number of splices: GT/AG | 12791307 Number of splices: GC/AG | 165544 Number of splices: AT/AC | 9424 Number of splices: Non-canonical | 38057 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376076 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 67707 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.83% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 971708 971708 971708 N_multimapping 376076 376076 376076 N_noFeature 384065 13701375 444294 N_ambiguous 144509 716 67215 UnstrandedReadsAssigned:13309938 PositiveStrandReadsAssigned:136421 NegativeStrandReadsAssigned:13327003 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171509 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171509-trimmed-pair1.fastq SRR7171509-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,186,295 reads, 13,354,126 reads pseudoaligned [quant] estimated average fragment length: 208.582 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR7171509.ke.tsv 34699 SRR7171509.se.tsv 87100 total ==> SRR7171509.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.42 1444 57.8236 Potri.005G024800.1.v4.1 1035 827.418 211 18.4873 Potri.004G059700.1.v4.1 961 753.423 18 1.73201 Potri.007G009000.2.v4.1 1416 1208.42 0 0 Potri.003G141000.2.v4.1 2943 2735.42 442 11.7143 Potri.016G087400.1.v4.1 270 92.4316 876.566 687.513 Potri.015G069301.1.v4.1 564 357.492 0 0 Potri.010G195200.1.v4.1 1773 1565.42 659 30.5191 Potri.012G127500.1.v4.1 977 769.423 9430 888.513 ==> SRR7171509.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 651 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 381 SRR7171509 completed mapping pipeline successfully