Starting /dee2/code/volunteer_pipeline.sh SRR7171852 current disk space = 3088180101120 free memory = 1449163272 SRR7171852 SRAfilesize f3a9fd7175e09d5a7bd1a4127d147a89 SRR7171852.sra SRR7171852.sra file validated SRR7171852 is paired end SRR7171852 is conventional basespace SRR7171852 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171852_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.68325 32.0 25.0 33.0 18.0 34.0 2 32.283 33.0 32.0 33.0 32.0 34.0 3 32.33925 33.0 33.0 33.0 30.0 34.0 4 31.46825 33.0 31.0 33.0 29.0 33.0 5 32.54075 33.0 33.0 33.0 32.0 34.0 6 35.77225 37.0 35.0 38.0 31.0 38.0 7 37.19675 38.0 38.0 38.0 36.0 38.0 8 37.43975 38.0 38.0 38.0 37.0 38.0 9 37.5735 38.0 38.0 38.0 37.0 38.0 10-14 37.578500000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.53945 38.0 38.0 38.0 37.2 38.0 20-24 37.54395 38.0 38.0 38.0 37.8 38.0 25-29 37.4672 38.0 38.0 38.0 37.4 38.0 30-34 37.417899999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.38315 38.0 38.0 38.0 37.0 38.0 40-44 37.36585 38.0 38.0 38.0 37.0 38.0 45-49 37.35295 38.0 38.0 38.0 37.0 38.0 50-54 37.30565 38.0 38.0 38.0 37.0 38.0 55-59 37.237849999999995 38.0 38.0 38.0 36.8 38.0 60-64 37.2084 38.0 38.0 38.0 36.4 38.0 65-69 37.10755 38.0 38.0 38.0 36.0 38.0 70-74 37.10045 38.0 38.0 38.0 36.0 38.0 75-79 36.961149999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.96014999999999 38.0 38.0 38.0 35.8 38.0 85-89 36.874199999999995 38.0 38.0 38.0 35.4 38.0 90-94 36.74135 38.0 38.0 38.0 35.0 38.0 95-99 36.61755000000001 38.0 38.0 38.0 34.4 38.0 100-104 36.506550000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.325399999999995 38.0 37.6 38.0 34.0 38.0 110-114 36.23025 38.0 37.6 38.0 33.8 38.0 115-119 36.0351 38.0 37.2 38.0 33.2 38.0 120-124 35.83325 38.0 37.0 38.0 32.6 38.0 125-129 35.72265 38.0 36.6 38.0 32.0 38.0 130-134 35.4815 38.0 36.0 38.0 31.0 38.0 135-139 35.17985 38.0 36.0 38.0 29.4 38.0 140-144 34.736200000000004 38.0 35.0 38.0 27.8 38.0 145-149 34.265150000000006 38.0 35.0 38.0 26.2 38.0 150-151 31.013625 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 3.0 17 2.0 18 3.0 19 2.0 20 4.0 21 3.0 22 7.0 23 10.0 24 10.0 25 6.0 26 11.0 27 9.0 28 21.0 29 27.0 30 31.0 31 54.0 32 68.0 33 89.0 34 152.0 35 244.0 36 730.0 37 2507.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.875 13.200000000000001 10.875 31.05 2 21.226533166458072 17.04630788485607 35.91989987484355 25.807259073842303 3 18.85 24.3 27.525 29.325000000000003 4 24.075 30.325000000000003 23.45 22.15 5 21.475 32.725 25.424999999999997 20.375 6 18.5 36.15 25.4 19.950000000000003 7 14.649999999999999 23.825 42.825 18.7 8 18.224999999999998 23.9 30.175 27.700000000000003 9 18.55 23.425 32.074999999999996 25.95 10-14 20.794999999999998 29.32 26.919999999999998 22.965 15-19 20.44 28.015 28.075 23.47 20-24 21.075 28.26 27.900000000000002 22.765 25-29 20.77 28.26 27.63 23.34 30-34 20.255000000000003 28.185 28.37 23.189999999999998 35-39 20.66 28.04 27.675 23.625 40-44 20.830000000000002 28.27 28.015 22.884999999999998 45-49 20.74 28.189999999999998 28.005000000000003 23.064999999999998 50-54 20.985 28.18 27.71 23.125 55-59 20.44 28.384999999999998 27.76 23.415 60-64 20.585 28.544999999999998 27.29 23.580000000000002 65-69 20.380000000000003 27.96 27.529999999999998 24.13 70-74 20.794999999999998 28.08 27.62 23.505000000000003 75-79 20.61 27.99 27.46 23.94 80-84 21.04 28.155 27.355 23.45 85-89 20.72 28.21 27.529999999999998 23.54 90-94 21.085 27.689999999999998 27.235 23.990000000000002 95-99 21.19 28.215 27.41 23.185 100-104 21.105 27.800000000000004 27.525 23.57 105-109 21.065 27.42 27.779999999999998 23.735 110-114 20.71 28.055000000000003 28.08 23.155 115-119 21.245 28.395 27.334999999999997 23.025000000000002 120-124 21.135 27.365000000000002 28.075 23.425 125-129 21.18 27.675 27.655 23.49 130-134 21.41 27.415 27.935 23.24 135-139 21.404999999999998 28.310000000000002 26.595000000000002 23.69 140-144 20.985 27.42 27.775 23.82 145-149 21.59 27.83 27.505000000000003 23.075000000000003 150-151 21.349999999999998 27.925 26.6 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.5 23 3.5 24 1.5 25 4.0 26 6.5 27 5.0 28 7.0 29 14.5 30 19.5 31 19.5 32 27.0 33 42.5 34 47.5 35 57.0 36 78.5 37 101.0 38 129.5 39 155.5 40 174.5 41 215.5 42 244.0 43 250.0 44 260.0 45 270.0 46 278.0 47 261.5 48 238.5 49 219.0 50 182.5 51 138.0 52 116.5 53 102.0 54 75.5 55 56.5 56 43.0 57 35.0 58 31.5 59 23.0 60 15.5 61 14.0 62 13.5 63 5.0 64 2.0 65 2.0 66 1.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 0.9875 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.5750000000000002 0.0 0.0 0.0 0.0 130-131 1.7000000000000002 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 2.05 0.0 0.0 0.0 0.0 136-137 2.2625 0.0 0.0 0.0 0.0 138-139 2.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATCCA 10 0.006830828 145.0 4 >>END_MODULE SRR7171852 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171852_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.984 33.0 33.0 34.0 32.0 34.0 2 33.02875 34.0 33.0 34.0 32.0 34.0 3 33.025 34.0 33.0 34.0 32.0 34.0 4 32.90575 34.0 33.0 34.0 32.0 34.0 5 32.9905 34.0 33.0 34.0 32.0 34.0 6 37.22675 38.0 38.0 38.0 37.0 38.0 7 37.06525 38.0 38.0 38.0 37.0 38.0 8 37.1085 38.0 38.0 38.0 37.0 38.0 9 37.09025 38.0 38.0 38.0 37.0 38.0 10-14 37.1486 38.0 38.0 38.0 37.0 38.0 15-19 37.097 38.0 38.0 38.0 37.0 38.0 20-24 37.06985 38.0 38.0 38.0 37.0 38.0 25-29 37.06365 38.0 38.0 38.0 37.0 38.0 30-34 37.033249999999995 38.0 38.0 38.0 37.0 38.0 35-39 36.930150000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.7455 38.0 38.0 38.0 36.0 38.0 45-49 36.92465 38.0 38.0 38.0 36.2 38.0 50-54 36.89675 38.0 38.0 38.0 36.0 38.0 55-59 36.829600000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.77745 38.0 38.0 38.0 35.6 38.0 65-69 36.66295 38.0 38.0 38.0 35.4 38.0 70-74 36.602050000000006 38.0 38.0 38.0 35.0 38.0 75-79 36.56155 38.0 38.0 38.0 35.0 38.0 80-84 36.4865 38.0 38.0 38.0 34.6 38.0 85-89 36.34615 38.0 38.0 38.0 34.2 38.0 90-94 36.171 38.0 38.0 38.0 34.0 38.0 95-99 36.015499999999996 38.0 37.8 38.0 33.6 38.0 100-104 35.79765 38.0 37.2 38.0 32.6 38.0 105-109 35.703700000000005 38.0 37.0 38.0 32.2 38.0 110-114 35.6342 38.0 37.0 38.0 32.0 38.0 115-119 35.4302 38.0 37.0 38.0 31.0 38.0 120-124 35.2502 38.0 36.4 38.0 29.4 38.0 125-129 35.002050000000004 38.0 36.0 38.0 28.4 38.0 130-134 34.60385 38.0 35.2 38.0 27.0 38.0 135-139 34.3146 38.0 35.0 38.0 24.8 38.0 140-144 33.8471 38.0 35.0 38.0 22.2 38.0 145-149 33.34015000000001 38.0 34.4 38.0 15.8 38.0 150-151 29.658749999999998 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 6.0 5 2.0 6 1.0 7 2.0 8 2.0 9 4.0 10 1.0 11 3.0 12 2.0 13 2.0 14 5.0 15 6.0 16 6.0 17 5.0 18 3.0 19 6.0 20 10.0 21 8.0 22 7.0 23 11.0 24 14.0 25 15.0 26 22.0 27 26.0 28 18.0 29 25.0 30 33.0 31 50.0 32 67.0 33 91.0 34 180.0 35 283.0 36 633.0 37 2441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.425 18.099999999999998 16.275000000000002 24.2 2 24.25 24.175 31.0 20.575 3 22.025 26.424999999999997 30.45 21.099999999999998 4 24.05 35.0 21.45 19.5 5 24.45 36.25 21.65 17.65 6 20.05 35.725 24.175 20.05 7 18.85 18.925 39.175 23.05 8 21.925 22.650000000000002 26.85 28.575 9 21.125 24.625 28.775000000000002 25.474999999999998 10-14 22.875 28.76 25.935000000000002 22.43 15-19 23.24 28.549999999999997 27.229999999999997 20.979999999999997 20-24 23.16 27.935 27.485 21.42 25-29 23.189999999999998 28.17 27.084999999999997 21.555 30-34 23.64 27.810000000000002 26.695 21.855 35-39 22.938028309908468 28.259890961836643 27.109488320912316 21.69259240734257 40-44 22.79655068685451 27.855209064474078 27.489220896420335 21.859019352251078 45-49 22.884999999999998 27.93 27.465 21.72 50-54 22.99 28.439999999999998 27.405 21.165 55-59 23.82 28.12 26.855 21.205 60-64 23.44 27.625 27.565 21.37 65-69 22.865 27.855 27.74 21.54 70-74 23.95 28.360000000000003 26.765 20.925 75-79 23.685000000000002 27.560000000000002 27.045 21.709999999999997 80-84 23.14 28.525 27.145000000000003 21.19 85-89 23.465 27.77 27.279999999999998 21.485000000000003 90-94 23.345 28.505000000000003 27.029999999999998 21.12 95-99 23.494999999999997 28.075 27.229999999999997 21.2 100-104 23.515 27.839999999999996 27.400000000000002 21.245 105-109 23.66 27.705000000000002 27.24 21.395 110-114 23.275000000000002 28.215 27.495000000000005 21.015 115-119 24.035 27.334999999999997 27.48 21.15 120-124 23.645 27.805000000000003 27.439999999999998 21.11 125-129 23.54 28.16 27.22 21.08 130-134 23.580000000000002 27.900000000000002 27.439999999999998 21.08 135-139 23.465 28.37 27.005000000000003 21.16 140-144 23.875 28.17 27.445000000000004 20.51 145-149 24.385 28.005000000000003 27.07 20.54 150-151 24.0375 27.500000000000004 27.762500000000003 20.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.5 22 2.5 23 1.5 24 0.5 25 0.5 26 2.0 27 3.0 28 6.0 29 9.5 30 11.5 31 16.5 32 17.0 33 24.5 34 36.0 35 50.0 36 65.5 37 76.0 38 100.5 39 129.5 40 188.5 41 238.5 42 245.0 43 268.0 44 290.5 45 287.5 46 292.5 47 289.0 48 257.5 49 217.5 50 168.5 51 136.5 52 117.5 53 96.0 54 77.0 55 57.5 56 43.5 57 39.0 58 30.0 59 22.0 60 18.5 61 12.5 62 13.0 63 13.0 64 7.5 65 3.0 66 5.0 67 4.5 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.034999999999999996 40-44 0.27 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7491219267436 99.4 2 0.2007024586051179 0.4 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.025087807325639738 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 0.9875 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.075 0.0 0.0 0.0 0.0 136-137 2.3125 0.0 0.0 0.0 0.0 138-139 2.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTAGA 10 0.006830828 145.0 5 TCTCTAG 10 0.006830828 145.0 4 >>END_MODULE Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735937 spots for SRR7171852.sra Written 735937 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra Read 735935 spots for SRR7171852.sra Written 735935 spots for SRR7171852.sra SRR ids: ['SRR7171852.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pfbpc2bm SRR7171852.sra spots: 14718702 blocks: [[1, 735935], [735936, 1471870], [1471871, 2207805], [2207806, 2943740], [2943741, 3679675], [3679676, 4415610], [4415611, 5151545], [5151546, 5887480], [5887481, 6623415], [6623416, 7359350], [7359351, 8095285], [8095286, 8831220], [8831221, 9567155], [9567156, 10303090], [10303091, 11039025], [11039026, 11774960], [11774961, 12510895], [12510896, 13246830], [13246831, 13982765], [13982766, 14718702]] SRR7171852 file size 4965984 SRR7171852 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171852 SRR7171852_1.fastq SRR7171852_2.fastq Input file: SRR7171852_1.fastq Paired file: SRR7171852_2.fastq trimmed: SRR7171852-trimmed-pair1.fastq, SRR7171852-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:04:10 2025 >> started Thu Feb 13 21:04:27 2025 >> done (17.494s) 14718702 read pairs processed; of these: 29098 ( 0.20%) short read pairs filtered out after trimming by size control 19536 ( 0.13%) empty read pairs filtered out after trimming by size control 14670068 (99.67%) read pairs available; of these: 5914227 (40.31%) trimmed read pairs available after processing 8755841 (59.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 8 0.00% 22 7 0.00% 23 11 0.00% 24 10 0.00% 25 9 0.00% 26 9 0.00% 27 8 0.00% 28 5 0.00% 29 4 0.00% 30 6 0.00% 31 7 0.00% 32 5 0.00% 33 5 0.00% 34 0 0.00% 35 11 0.00% 36 15 0.00% 37 11 0.00% 38 4 0.00% 39 6 0.00% 40 13 0.00% 41 11 0.00% 42 7 0.00% 43 10 0.00% 44 12 0.00% 45 15 0.00% 46 17 0.00% 47 27 0.00% 48 23 0.00% 49 18 0.00% 50 24 0.00% 51 31 0.00% 52 22 0.00% 53 41 0.00% 54 41 0.00% 55 37 0.00% 56 47 0.00% 57 56 0.00% 58 52 0.00% 59 52 0.00% 60 74 0.00% 61 85 0.00% 62 78 0.00% 63 112 0.00% 64 85 0.00% 65 119 0.00% 66 146 0.00% 67 151 0.00% 68 171 0.00% 69 191 0.00% 70 212 0.00% 71 254 0.00% 72 272 0.00% 73 317 0.00% 74 355 0.00% 75 431 0.00% 76 489 0.00% 77 564 0.00% 78 550 0.00% 79 638 0.00% 80 702 0.00% 81 812 0.01% 82 900 0.01% 83 1108 0.01% 84 2361 0.02% 85 3175 0.02% 86 3425 0.02% 87 3711 0.03% 88 3766 0.03% 89 3916 0.03% 90 3806 0.03% 91 3938 0.03% 92 4141 0.03% 93 4246 0.03% 94 4509 0.03% 95 4576 0.03% 96 4916 0.03% 97 5143 0.04% 98 5284 0.04% 99 5593 0.04% 100 5827 0.04% 101 6206 0.04% 102 6765 0.05% 103 7041 0.05% 104 7483 0.05% 105 8138 0.06% 106 8558 0.06% 107 9073 0.06% 108 9357 0.06% 109 10038 0.07% 110 10685 0.07% 111 11495 0.08% 112 11712 0.08% 113 12784 0.09% 114 13670 0.09% 115 14621 0.10% 116 15271 0.10% 117 15825 0.11% 118 16191 0.11% 119 17007 0.12% 120 17805 0.12% 121 18512 0.13% 122 19463 0.13% 123 20098 0.14% 124 21623 0.15% 125 22231 0.15% 126 24038 0.16% 127 24694 0.17% 128 25990 0.18% 129 27301 0.19% 130 28858 0.20% 131 30257 0.21% 132 32271 0.22% 133 34624 0.24% 134 36867 0.25% 135 38696 0.26% 136 41863 0.29% 137 44824 0.31% 138 47722 0.33% 139 52411 0.36% 140 56182 0.38% 141 62064 0.42% 142 70505 0.48% 143 79621 0.54% 144 93199 0.64% 145 112461 0.77% 146 142642 0.97% 147 196366 1.34% 148 309812 2.11% 149 638076 4.35% 150 3249378 22.15% 151 8755841 59.69% 14670068 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=14 prefix-density=0.38 prefix-fanout=3.5 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=33.22 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.1 sequence=AACTCCAGCAGGTTGATAGAAAGTACTTTACAGGGCGAGCACAGTTCATGGTCTTCACTCTTCAAGGTAAAGTATAAGCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTGATTGA criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=32 prefix-density=0.52 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=221.20 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=12.6 sequence=GAAAAATGGCGACTCCAATGAAGTACATTTGCTTGTTTATGTTTCTTGCAATTCTCAGCATTGCTGGGCTCAATCAAGTTGACGGGGCTGGTGAATGTGGGAAAAACACCACTCCTGACATGGAGGCTTTCAAGATGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGGAGCTTATACTTTACCTTGAAGAGTGAAGACC SRR7171852 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:05:13 Started mapping on | Feb 13 21:05:14 Finished on | Feb 13 21:07:16 Mapping speed, Million of reads per hour | 432.89 Number of input reads | 14670068 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13396883 Uniquely mapped reads % | 91.32% Average mapped length | 296.51 Number of splices: Total | 13318282 Number of splices: Annotated (sjdb) | 13065314 Number of splices: GT/AG | 13107836 Number of splices: GC/AG | 168213 Number of splices: AT/AC | 10489 Number of splices: Non-canonical | 31744 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381078 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 64653 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.55% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 918640 918640 918640 N_multimapping 381078 381078 381078 N_noFeature 316213 13251112 394883 N_ambiguous 142942 1811 74331 UnstrandedReadsAssigned:12937728 PositiveStrandReadsAssigned:143960 NegativeStrandReadsAssigned:12927669 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171852 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171852-trimmed-pair1.fastq SRR7171852-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,670,068 reads, 12,875,581 reads pseudoaligned [quant] estimated average fragment length: 261.898 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7171852.ke.tsv 34699 SRR7171852.se.tsv 87100 total ==> SRR7171852.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.1 1132 45.8392 Potri.005G024800.1.v4.1 1035 774.102 246 22.6112 Potri.004G059700.1.v4.1 961 700.124 11 1.11791 Potri.007G009000.2.v4.1 1416 1155.1 0 0 Potri.003G141000.2.v4.1 2943 2682.1 432 11.4603 Potri.016G087400.1.v4.1 270 67.9936 890 931.342 Potri.015G069301.1.v4.1 564 307.92 0 0 Potri.010G195200.1.v4.1 1773 1512.1 275.817 12.9786 Potri.012G127500.1.v4.1 977 716.113 8677 862.135 ==> SRR7171852.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 395 SRR7171852 completed mapping pipeline successfully