Starting /dee2/code/volunteer_pipeline.sh SRR7171853 current disk space = 3088202993664 free memory = 1449901684 SRR7171853 SRAfilesize 0004f5ee13b121c5b56a02cc583dfcaa SRR7171853.sra SRR7171853.sra file validated SRR7171853 is paired end SRR7171853 is conventional basespace SRR7171853 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171853_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.9385 32.0 18.0 33.0 18.0 33.0 2 32.146 33.0 32.0 33.0 31.0 34.0 3 32.2175 33.0 33.0 33.0 29.0 34.0 4 31.37725 33.0 31.0 33.0 29.0 33.0 5 32.74225 33.0 33.0 33.0 32.0 34.0 6 36.9735 38.0 37.0 38.0 35.0 38.0 7 37.348 38.0 38.0 38.0 36.0 38.0 8 37.4805 38.0 38.0 38.0 37.0 38.0 9 37.6305 38.0 38.0 38.0 38.0 38.0 10-14 37.60790000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.57735 38.0 38.0 38.0 38.0 38.0 20-24 37.5486 38.0 38.0 38.0 38.0 38.0 25-29 37.537549999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.499900000000004 38.0 38.0 38.0 37.6 38.0 35-39 37.5195 38.0 38.0 38.0 37.8 38.0 40-44 37.48965 38.0 38.0 38.0 37.2 38.0 45-49 37.4125 38.0 38.0 38.0 37.0 38.0 50-54 37.3739 38.0 38.0 38.0 37.0 38.0 55-59 37.293699999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.23245 38.0 38.0 38.0 36.6 38.0 65-69 37.223850000000006 38.0 38.0 38.0 36.2 38.0 70-74 37.161 38.0 38.0 38.0 36.0 38.0 75-79 37.08565 38.0 38.0 38.0 36.0 38.0 80-84 37.0539 38.0 38.0 38.0 36.0 38.0 85-89 36.9295 38.0 38.0 38.0 35.6 38.0 90-94 36.8605 38.0 38.0 38.0 35.0 38.0 95-99 36.750150000000005 38.0 38.0 38.0 34.8 38.0 100-104 36.67345 38.0 38.0 38.0 34.8 38.0 105-109 36.464999999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.38445 38.0 37.8 38.0 33.8 38.0 115-119 36.19375 38.0 37.2 38.0 33.8 38.0 120-124 36.0321 38.0 37.0 38.0 33.0 38.0 125-129 35.9793 38.0 37.0 38.0 33.0 38.0 130-134 35.668850000000006 38.0 36.2 38.0 31.4 38.0 135-139 35.4026 38.0 36.0 38.0 31.0 38.0 140-144 35.044599999999996 38.0 35.8 38.0 28.8 38.0 145-149 34.556149999999995 38.0 35.0 38.0 28.0 38.0 150-151 31.391374999999996 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 2.0 18 3.0 19 1.0 20 2.0 21 3.0 22 4.0 23 8.0 24 4.0 25 10.0 26 8.0 27 21.0 28 24.0 29 29.0 30 26.0 31 40.0 32 49.0 33 80.0 34 140.0 35 253.0 36 720.0 37 2571.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.35 12.625 11.575000000000001 33.45 2 19.78489244622311 18.98449224612306 37.81890945472736 23.411705852926463 3 20.599999999999998 25.35 25.124999999999996 28.925 4 23.875 31.95 22.55 21.625 5 21.45 34.975 24.65 18.925 6 18.125 34.5 25.25 22.125 7 14.399999999999999 22.8 43.275000000000006 19.525000000000002 8 18.625 21.8 31.6 27.975 9 18.525 22.125 31.6 27.750000000000004 10-14 21.22 27.41 27.384999999999998 23.985 15-19 20.665 27.384999999999998 28.215 23.735 20-24 20.945 28.005000000000003 27.77 23.28 25-29 20.244999999999997 28.665000000000003 27.834999999999997 23.255 30-34 20.849999999999998 27.515 27.815 23.82 35-39 20.485 27.49 27.845 24.18 40-44 20.945 27.474999999999998 27.92 23.66 45-49 21.44 27.975 27.650000000000002 22.935 50-54 20.325 28.21 28.08 23.385 55-59 20.544999999999998 27.229999999999997 28.315 23.91 60-64 20.645 27.685 28.144999999999996 23.525 65-69 21.0 27.08 27.91 24.01 70-74 20.84 27.650000000000002 28.02 23.49 75-79 20.880000000000003 27.529999999999998 27.785 23.805 80-84 21.13 27.229999999999997 27.700000000000003 23.94 85-89 20.93 27.425 27.825 23.82 90-94 21.005 28.249999999999996 27.555000000000003 23.189999999999998 95-99 20.830000000000002 27.250000000000004 28.105000000000004 23.815 100-104 20.635 27.985 27.439999999999998 23.94 105-109 21.345 27.46 27.37 23.825 110-114 21.404999999999998 27.345000000000002 27.805000000000003 23.445 115-119 21.365000000000002 27.694999999999997 27.515 23.425 120-124 21.3 27.16 27.865000000000002 23.674999999999997 125-129 21.095 27.155 28.405 23.345 130-134 20.979999999999997 27.67 27.37 23.98 135-139 21.154999999999998 27.865000000000002 27.21 23.77 140-144 20.89 27.005000000000003 28.110000000000003 23.995 145-149 21.525 27.24 27.815 23.419999999999998 150-151 21.8875 26.775 26.700000000000003 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 3.0 25 4.0 26 6.0 27 7.5 28 7.0 29 12.0 30 15.5 31 15.5 32 20.5 33 25.5 34 39.0 35 58.0 36 65.5 37 97.5 38 129.5 39 135.0 40 164.0 41 196.5 42 229.0 43 269.0 44 279.0 45 273.0 46 285.0 47 272.0 48 255.5 49 236.0 50 193.5 51 165.5 52 134.0 53 99.0 54 77.0 55 57.5 56 37.0 57 29.5 58 23.5 59 18.5 60 15.0 61 12.5 62 10.0 63 6.5 64 4.0 65 3.0 66 4.0 67 3.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.2750000000000004 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.1 0.0 0.0 0.0 0.0 138-139 3.3375000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCACA 10 0.006830828 145.0 2 TCTTAAG 10 0.006830828 145.0 7 >>END_MODULE SRR7171853 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171853_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03025 33.0 33.0 34.0 32.0 34.0 2 33.0575 34.0 33.0 34.0 33.0 34.0 3 33.0945 34.0 33.0 34.0 33.0 34.0 4 33.024 34.0 33.0 34.0 33.0 34.0 5 33.12775 34.0 33.0 34.0 33.0 34.0 6 37.3005 38.0 38.0 38.0 37.0 38.0 7 37.25925 38.0 38.0 38.0 37.0 38.0 8 37.25 38.0 38.0 38.0 38.0 38.0 9 37.1955 38.0 38.0 38.0 37.0 38.0 10-14 37.23525000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.19959999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.20504999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.19055 38.0 38.0 38.0 37.0 38.0 30-34 37.135799999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.055099999999996 38.0 38.0 38.0 37.0 38.0 40-44 36.8997 38.0 38.0 38.0 36.6 38.0 45-49 37.07595 38.0 38.0 38.0 37.0 38.0 50-54 37.02805000000001 38.0 38.0 38.0 37.0 38.0 55-59 36.97515 38.0 38.0 38.0 36.4 38.0 60-64 36.914049999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.89195 38.0 38.0 38.0 36.0 38.0 70-74 36.781600000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.74315 38.0 38.0 38.0 35.8 38.0 80-84 36.66435 38.0 38.0 38.0 35.4 38.0 85-89 36.53305 38.0 38.0 38.0 34.6 38.0 90-94 36.362849999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.30825 38.0 38.0 38.0 34.0 38.0 100-104 36.1985 38.0 38.0 38.0 34.0 38.0 105-109 35.96425 38.0 37.4 38.0 33.2 38.0 110-114 35.91695 38.0 37.2 38.0 33.2 38.0 115-119 35.6956 38.0 37.0 38.0 32.2 38.0 120-124 35.5811 38.0 37.0 38.0 31.4 38.0 125-129 35.4131 38.0 36.2 38.0 31.0 38.0 130-134 35.02035 38.0 36.0 38.0 28.2 38.0 135-139 34.728449999999995 38.0 35.2 38.0 28.0 38.0 140-144 34.4035 38.0 35.0 38.0 26.8 38.0 145-149 33.84035 38.0 35.0 38.0 22.8 38.0 150-151 29.927750000000003 36.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 2.0 4 5.0 5 3.0 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 3.0 12 0.0 13 2.0 14 2.0 15 4.0 16 5.0 17 1.0 18 5.0 19 7.0 20 3.0 21 6.0 22 4.0 23 12.0 24 12.0 25 6.0 26 14.0 27 12.0 28 19.0 29 28.0 30 40.0 31 47.0 32 48.0 33 86.0 34 144.0 35 253.0 36 661.0 37 2548.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.85 16.075 15.950000000000001 28.125 2 23.125 24.8 33.650000000000006 18.425 3 21.175 27.900000000000002 30.075000000000003 20.849999999999998 4 26.075 34.975 19.425 19.525000000000002 5 24.025 36.199999999999996 22.55 17.224999999999998 6 19.25 36.199999999999996 24.8 19.75 7 19.85 19.225 39.550000000000004 21.375 8 20.7 21.3 27.55 30.45 9 22.3 25.4 27.650000000000002 24.65 10-14 23.18 28.685 26.029999999999998 22.105 15-19 23.125 28.62 26.44 21.815 20-24 23.185 27.87 26.91 22.035 25-29 22.825 28.485 26.815 21.875 30-34 22.89 28.235 27.450000000000003 21.425 35-39 22.510129558301237 28.207693462057925 27.467360312140464 21.814816667500374 40-44 23.466880609737753 28.20538534824249 26.766283909141052 21.561450132878704 45-49 23.035 27.29 28.060000000000002 21.615000000000002 50-54 22.71 28.345 26.995 21.95 55-59 22.57 28.199999999999996 27.455000000000002 21.775 60-64 22.96 28.665000000000003 26.790000000000003 21.584999999999997 65-69 23.369999999999997 28.63 27.04 20.96 70-74 23.65 28.110000000000003 27.015 21.224999999999998 75-79 23.325000000000003 27.99 27.26 21.425 80-84 23.505000000000003 27.800000000000004 27.655 21.04 85-89 23.494999999999997 28.050000000000004 26.724999999999998 21.73 90-94 24.060000000000002 28.08 26.795 21.065 95-99 23.565 28.17 27.405 20.86 100-104 24.01 27.834999999999997 26.979999999999997 21.175 105-109 23.585 27.63 27.355 21.43 110-114 23.925 28.49 26.590000000000003 20.995 115-119 23.595 27.96 26.924999999999997 21.52 120-124 24.29 27.61 27.315 20.785 125-129 23.745 28.144999999999996 27.54 20.57 130-134 24.305 27.735 27.089999999999996 20.87 135-139 24.13 28.444999999999997 26.52 20.905 140-144 24.36 27.839999999999996 27.41 20.39 145-149 24.305 28.22 27.015 20.46 150-151 24.175 28.537499999999998 26.3 20.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 3.0 27 3.0 28 2.0 29 6.5 30 8.0 31 8.5 32 14.5 33 22.5 34 32.5 35 48.0 36 66.0 37 84.5 38 123.5 39 158.5 40 184.5 41 211.5 42 246.5 43 283.0 44 297.5 45 299.0 46 285.0 47 269.5 48 244.5 49 206.5 50 171.5 51 150.0 52 124.0 53 99.5 54 85.5 55 69.0 56 49.5 57 35.5 58 26.0 59 15.5 60 12.0 61 9.5 62 7.5 63 6.5 64 6.5 65 7.0 66 4.5 67 1.5 68 1.0 69 1.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.045 40-44 0.28500000000000003 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49507700075738 98.52499999999999 2 0.35344609946983085 0.7000000000000001 3 0.025246149962130777 0.075 4 0.050492299924261554 0.2 5 0.050492299924261554 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025246149962130777 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 10 0.25 No Hit GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 5 0.125 No Hit GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0125 0.0 0.0 88-89 0.075 0.0 0.025 0.0 0.0 90-91 0.075 0.0 0.025 0.0 0.0 92-93 0.075 0.0 0.025 0.0 0.0 94-95 0.1 0.0 0.025 0.0 0.0 96-97 0.1375 0.0 0.025 0.0 0.0 98-99 0.16249999999999998 0.0 0.025 0.0 0.0 100-101 0.1875 0.0 0.025 0.0 0.0 102-103 0.225 0.0 0.025 0.0 0.0 104-105 0.2625 0.0 0.025 0.0 0.0 106-107 0.3375 0.0 0.025 0.0 0.0 108-109 0.3875 0.0 0.025 0.0 0.0 110-111 0.475 0.0 0.025 0.0 0.0 112-113 0.55 0.0 0.025 0.0 0.0 114-115 0.675 0.0 0.025 0.0 0.0 116-117 0.8 0.0 0.025 0.0 0.0 118-119 1.0125 0.0 0.025 0.0 0.0 120-121 1.2 0.0 0.025 0.0 0.0 122-123 1.4625 0.0 0.025 0.0 0.0 124-125 1.6875 0.0 0.025 0.0 0.0 126-127 1.9625 0.0 0.025 0.0 0.0 128-129 2.25 0.0 0.025 0.0 0.0 130-131 2.4125 0.0 0.025 0.0 0.0 132-133 2.55 0.0 0.025 0.0 0.0 134-135 2.775 0.0 0.025 0.0 0.0 136-137 3.0625 0.0 0.025 0.0 0.0 138-139 3.275 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATGC 10 0.006830828 145.0 4 TAAAGTA 10 0.006830828 145.0 9 >>END_MODULE Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 743006 spots for SRR7171853.sra Written 743006 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra Read 742988 spots for SRR7171853.sra Written 742988 spots for SRR7171853.sra SRR ids: ['SRR7171853.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uk7jhvt4 SRR7171853.sra spots: 14859778 blocks: [[1, 742988], [742989, 1485976], [1485977, 2228964], [2228965, 2971952], [2971953, 3714940], [3714941, 4457928], [4457929, 5200916], [5200917, 5943904], [5943905, 6686892], [6686893, 7429880], [7429881, 8172868], [8172869, 8915856], [8915857, 9658844], [9658845, 10401832], [10401833, 11144820], [11144821, 11887808], [11887809, 12630796], [12630797, 13373784], [13373785, 14116772], [14116773, 14859778]] SRR7171853 file size 5013790 SRR7171853 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171853 SRR7171853_1.fastq SRR7171853_2.fastq Input file: SRR7171853_1.fastq Paired file: SRR7171853_2.fastq trimmed: SRR7171853-trimmed-pair1.fastq, SRR7171853-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:08:46 2025 >> started Thu Feb 13 21:09:03 2025 >> done (16.478s) 14859778 read pairs processed; of these: 14368 ( 0.10%) short read pairs filtered out after trimming by size control 13008 ( 0.09%) empty read pairs filtered out after trimming by size control 14832402 (99.82%) read pairs available; of these: 5904617 (39.81%) trimmed read pairs available after processing 8927785 (60.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 11 0.00% 24 3 0.00% 25 4 0.00% 26 3 0.00% 27 8 0.00% 28 3 0.00% 29 5 0.00% 30 10 0.00% 31 4 0.00% 32 7 0.00% 33 3 0.00% 34 11 0.00% 35 7 0.00% 36 9 0.00% 37 10 0.00% 38 8 0.00% 39 8 0.00% 40 5 0.00% 41 7 0.00% 42 15 0.00% 43 7 0.00% 44 13 0.00% 45 9 0.00% 46 13 0.00% 47 9 0.00% 48 16 0.00% 49 12 0.00% 50 15 0.00% 51 26 0.00% 52 20 0.00% 53 28 0.00% 54 38 0.00% 55 40 0.00% 56 29 0.00% 57 43 0.00% 58 48 0.00% 59 73 0.00% 60 70 0.00% 61 70 0.00% 62 67 0.00% 63 107 0.00% 64 93 0.00% 65 114 0.00% 66 128 0.00% 67 155 0.00% 68 178 0.00% 69 188 0.00% 70 209 0.00% 71 235 0.00% 72 287 0.00% 73 327 0.00% 74 358 0.00% 75 413 0.00% 76 542 0.00% 77 612 0.00% 78 618 0.00% 79 663 0.00% 80 766 0.01% 81 831 0.01% 82 954 0.01% 83 1163 0.01% 84 1864 0.01% 85 2349 0.02% 86 2540 0.02% 87 2870 0.02% 88 2998 0.02% 89 3129 0.02% 90 3284 0.02% 91 3510 0.02% 92 3756 0.03% 93 3992 0.03% 94 4177 0.03% 95 4486 0.03% 96 4758 0.03% 97 5057 0.03% 98 5189 0.03% 99 5730 0.04% 100 5989 0.04% 101 6344 0.04% 102 6759 0.05% 103 7267 0.05% 104 7954 0.05% 105 8402 0.06% 106 8840 0.06% 107 9317 0.06% 108 9688 0.07% 109 10455 0.07% 110 10894 0.07% 111 11641 0.08% 112 12085 0.08% 113 13002 0.09% 114 13910 0.09% 115 14760 0.10% 116 15542 0.10% 117 15870 0.11% 118 16491 0.11% 119 17319 0.12% 120 18191 0.12% 121 18748 0.13% 122 19731 0.13% 123 20783 0.14% 124 22035 0.15% 125 23033 0.16% 126 24411 0.16% 127 25011 0.17% 128 26733 0.18% 129 27946 0.19% 130 29284 0.20% 131 30793 0.21% 132 32398 0.22% 133 34824 0.23% 134 37320 0.25% 135 39725 0.27% 136 42210 0.28% 137 44605 0.30% 138 48085 0.32% 139 52316 0.35% 140 56383 0.38% 141 61930 0.42% 142 68715 0.46% 143 78314 0.53% 144 91360 0.62% 145 110205 0.74% 146 140394 0.95% 147 192533 1.30% 148 304542 2.05% 149 626266 4.22% 150 3263831 22.00% 151 8927785 60.19% 14832402 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=4.49 fanout-score-rank=20 prefix-density=1.10 prefix-fanout=1.7 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=47.00 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.5 sequence=GATATCATAATGACTGAAAAACATCTTACATTGCTTAATCAAACACACGCTAGCTCGCTTATAAGCGCCCCTAGTTAAGGGAAACCTTTATTTAATAAAGTCACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACCATTGTCATAAGATGTA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=28 prefix-density=0.86 prefix-fanout=2.2 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=72.49 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.1 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATG SRR7171853 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:09:51 Started mapping on | Feb 13 21:09:52 Finished on | Feb 13 21:12:50 Mapping speed, Million of reads per hour | 299.98 Number of input reads | 14832402 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13549112 Uniquely mapped reads % | 91.35% Average mapped length | 296.68 Number of splices: Total | 14067372 Number of splices: Annotated (sjdb) | 13828360 Number of splices: GT/AG | 13852799 Number of splices: GC/AG | 172050 Number of splices: AT/AC | 10992 Number of splices: Non-canonical | 31531 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340772 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 37040 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.05% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 955910 955910 955910 N_multimapping 340772 340772 340772 N_noFeature 277298 13417539 339122 N_ambiguous 141471 914 71052 UnstrandedReadsAssigned:13130343 PositiveStrandReadsAssigned:130659 NegativeStrandReadsAssigned:13138938 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171853 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171853-trimmed-pair1.fastq SRR7171853-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,832,402 reads, 13,001,166 reads pseudoaligned [quant] estimated average fragment length: 254.645 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7171853.ke.tsv 34699 SRR7171853.se.tsv 87100 total ==> SRR7171853.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.36 1007 37.2761 Potri.005G024800.1.v4.1 1035 781.355 134 11.2006 Potri.004G059700.1.v4.1 961 707.372 19 1.75426 Potri.007G009000.2.v4.1 1416 1162.36 0 0 Potri.003G141000.2.v4.1 2943 2689.36 622.194 15.11 Potri.016G087400.1.v4.1 270 70.4356 1258 1166.47 Potri.015G069301.1.v4.1 564 314.676 0 0 Potri.010G195200.1.v4.1 1773 1519.36 318.838 13.7056 Potri.012G127500.1.v4.1 977 723.361 2466 222.651 ==> SRR7171853.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 337 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 257 SRR7171853 completed mapping pipeline successfully