Starting /dee2/code/volunteer_pipeline.sh SRR7171854 current disk space = 3088218611712 free memory = 1463049152 SRR7171854 SRAfilesize d033d442e7967d3dbb70b8b1246eaaaf SRR7171854.sra SRR7171854.sra file validated SRR7171854 is paired end SRR7171854 is conventional basespace SRR7171854 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171854_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.02325 18.0 18.0 27.0 18.0 32.0 2 21.81825 18.0 18.0 27.0 18.0 31.0 3 25.594 27.0 18.0 29.0 18.0 31.0 4 26.8085 29.0 25.0 31.0 15.0 33.0 5 31.57225 32.0 32.0 33.0 28.0 33.0 6 35.1445 37.0 34.0 38.0 30.0 38.0 7 35.674 37.0 35.0 38.0 31.0 38.0 8 36.2055 38.0 36.0 38.0 33.0 38.0 9 36.652 38.0 37.0 38.0 34.0 38.0 10-14 37.18900000000001 38.0 38.0 38.0 35.6 38.0 15-19 37.39545 38.0 38.0 38.0 36.8 38.0 20-24 37.44945 38.0 38.0 38.0 37.0 38.0 25-29 37.510000000000005 38.0 38.0 38.0 37.2 38.0 30-34 37.4567 38.0 38.0 38.0 37.2 38.0 35-39 37.47565 38.0 38.0 38.0 37.0 38.0 40-44 37.44505 38.0 38.0 38.0 37.0 38.0 45-49 37.39135 38.0 38.0 38.0 37.0 38.0 50-54 37.29615 38.0 38.0 38.0 36.6 38.0 55-59 37.3194 38.0 38.0 38.0 36.6 38.0 60-64 37.184599999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.17645 38.0 38.0 38.0 36.0 38.0 70-74 37.0969 38.0 38.0 38.0 36.0 38.0 75-79 37.0039 38.0 38.0 38.0 36.0 38.0 80-84 36.9587 38.0 38.0 38.0 35.4 38.0 85-89 36.94375 38.0 38.0 38.0 35.6 38.0 90-94 36.84425 38.0 38.0 38.0 35.0 38.0 95-99 36.731100000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.604400000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.4483 38.0 37.8 38.0 34.0 38.0 110-114 36.3554 38.0 37.0 38.0 34.0 38.0 115-119 36.31175 38.0 37.2 38.0 33.6 38.0 120-124 36.114 38.0 37.0 38.0 33.0 38.0 125-129 35.8283 38.0 36.4 38.0 31.8 38.0 130-134 35.45725 38.0 36.0 38.0 30.6 38.0 135-139 35.28935 38.0 35.8 38.0 30.0 38.0 140-144 34.7937 38.0 35.0 38.0 27.8 38.0 145-149 34.1397 38.0 35.0 38.0 25.2 38.0 150-151 30.739624999999997 36.5 30.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 1.0 22 6.0 23 5.0 24 7.0 25 7.0 26 16.0 27 11.0 28 18.0 29 23.0 30 45.0 31 52.0 32 79.0 33 99.0 34 149.0 35 399.0 36 1143.0 37 1934.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.075000000000003 18.875 9.3 41.75 2 15.8 24.45 30.75 28.999999999999996 3 18.725 23.9 25.95 31.424999999999997 4 21.575 30.599999999999998 23.075000000000003 24.75 5 21.9 34.475 23.35 20.275000000000002 6 18.675 35.475 25.45 20.4 7 13.725000000000001 23.724999999999998 42.625 19.925 8 17.95 23.599999999999998 29.5 28.95 9 17.974999999999998 23.7 32.35 25.974999999999998 10-14 19.935 29.015 26.77 24.279999999999998 15-19 19.875 28.060000000000002 28.060000000000002 24.005000000000003 20-24 20.05 28.310000000000002 28.139999999999997 23.5 25-29 19.97 27.700000000000003 28.355000000000004 23.974999999999998 30-34 19.91 27.48 28.58 24.03 35-39 19.695 27.605 28.360000000000003 24.34 40-44 19.74 28.725 28.155 23.380000000000003 45-49 20.09 27.51 28.060000000000002 24.34 50-54 19.72 28.075 28.29 23.915 55-59 20.13 27.18 28.32 24.37 60-64 19.82 27.6 28.494999999999997 24.085 65-69 20.165 27.694999999999997 28.005000000000003 24.135 70-74 20.34 27.689999999999998 27.74 24.23 75-79 20.424999999999997 27.315 28.294999999999998 23.965 80-84 20.34 27.295 27.965 24.4 85-89 20.495 27.525 27.615000000000002 24.365000000000002 90-94 20.424999999999997 27.975 27.800000000000004 23.799999999999997 95-99 21.005 27.05 28.22 23.724999999999998 100-104 20.669999999999998 27.825 27.775 23.73 105-109 20.47 26.72 28.105000000000004 24.705 110-114 20.919999999999998 27.615000000000002 28.050000000000004 23.415 115-119 20.25 27.32 28.375 24.055 120-124 19.82 27.355 27.810000000000002 25.014999999999997 125-129 20.27 27.6 28.08 24.05 130-134 20.59 27.565 27.529999999999998 24.315 135-139 20.78 27.560000000000002 27.495000000000005 24.165 140-144 20.585 27.13 27.735 24.55 145-149 21.085 27.500000000000004 27.775 23.64 150-151 20.375 26.6 29.125 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 0.5 24 1.5 25 7.0 26 7.5 27 5.5 28 6.0 29 7.5 30 11.0 31 19.0 32 28.0 33 34.5 34 37.5 35 57.0 36 81.0 37 93.5 38 121.5 39 154.0 40 194.5 41 228.5 42 260.5 43 268.5 44 276.5 45 280.0 46 266.5 47 254.5 48 224.0 49 209.0 50 191.5 51 164.5 52 128.5 53 91.0 54 74.0 55 55.0 56 35.0 57 27.5 58 20.5 59 15.0 60 14.5 61 14.0 62 9.0 63 5.5 64 5.0 65 4.0 66 2.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.23750000000000002 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.8999999999999999 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.1125 0.0 0.0 0.0 0.0 126-127 1.3875 0.0 0.0 0.0 0.0 128-129 1.4874999999999998 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.8625 0.0 0.0 0.0 0.0 134-135 1.9249999999999998 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGTCA 10 0.006830828 145.0 145 >>END_MODULE SRR7171854 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171854_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9535 33.0 33.0 34.0 32.0 34.0 2 33.05025 34.0 33.0 34.0 32.0 34.0 3 33.0265 34.0 33.0 34.0 32.0 34.0 4 33.09025 34.0 33.0 34.0 32.0 34.0 5 33.02575 34.0 33.0 34.0 33.0 34.0 6 37.22325 38.0 38.0 38.0 37.0 38.0 7 37.22725 38.0 38.0 38.0 37.0 38.0 8 37.24825 38.0 38.0 38.0 37.0 38.0 9 37.298 38.0 38.0 38.0 37.0 38.0 10-14 37.238749999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.218900000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.21635 38.0 38.0 38.0 37.0 38.0 25-29 37.2336 38.0 38.0 38.0 37.0 38.0 30-34 37.170100000000005 38.0 38.0 38.0 36.8 38.0 35-39 36.91185 38.0 38.0 38.0 37.0 38.0 40-44 36.84735 38.0 38.0 38.0 36.2 38.0 45-49 37.083499999999994 38.0 38.0 38.0 36.6 38.0 50-54 37.055150000000005 38.0 38.0 38.0 36.6 38.0 55-59 37.00925000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.9516 38.0 38.0 38.0 36.0 38.0 65-69 36.93795 38.0 38.0 38.0 36.0 38.0 70-74 36.8733 38.0 38.0 38.0 35.8 38.0 75-79 36.83265 38.0 38.0 38.0 36.0 38.0 80-84 36.79469999999999 38.0 38.0 38.0 35.6 38.0 85-89 36.6798 38.0 38.0 38.0 35.0 38.0 90-94 36.556 38.0 38.0 38.0 34.8 38.0 95-99 36.39785 38.0 38.0 38.0 34.4 38.0 100-104 36.414550000000006 38.0 38.0 38.0 34.2 38.0 105-109 36.16795 38.0 38.0 38.0 33.8 38.0 110-114 36.18235 38.0 38.0 38.0 33.8 38.0 115-119 35.8596 38.0 37.0 38.0 32.6 38.0 120-124 35.76039999999999 38.0 37.0 38.0 32.2 38.0 125-129 35.4936 38.0 36.2 38.0 31.0 38.0 130-134 35.3438 38.0 36.0 38.0 30.8 38.0 135-139 34.9621 38.0 35.6 38.0 28.4 38.0 140-144 34.57965 38.0 35.0 38.0 27.0 38.0 145-149 34.0828 38.0 35.0 38.0 24.0 38.0 150-151 30.80825 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 0.0 6 2.0 7 3.0 8 0.0 9 1.0 10 1.0 11 1.0 12 3.0 13 1.0 14 2.0 15 4.0 16 1.0 17 1.0 18 7.0 19 6.0 20 5.0 21 5.0 22 6.0 23 10.0 24 4.0 25 10.0 26 17.0 27 10.0 28 18.0 29 33.0 30 38.0 31 53.0 32 67.0 33 76.0 34 154.0 35 262.0 36 616.0 37 2573.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.0 19.75 14.85 25.4 2 23.974999999999998 26.674999999999997 32.275 17.075000000000003 3 20.1 29.7 29.299999999999997 20.9 4 23.7 36.475 21.45 18.375 5 23.849999999999998 37.875 21.099999999999998 17.175 6 19.55 36.55 25.2 18.7 7 19.6 19.15 38.65 22.6 8 21.7 24.975 26.025 27.3 9 22.55 26.200000000000003 27.675 23.575 10-14 23.53 29.154999999999998 25.814999999999998 21.5 15-19 23.400000000000002 28.605000000000004 27.1 20.895 20-24 22.605 29.48 27.04 20.875 25-29 23.62 28.275 26.674999999999997 21.43 30-34 22.811059907834103 28.651572831095972 27.339210579042277 21.19815668202765 35-39 23.150753768844222 28.37185929648241 27.381909547738694 21.095477386934675 40-44 22.74669481727241 28.462273161413563 27.67807771577942 21.112954305534608 45-49 23.169999999999998 28.76 27.175 20.895 50-54 23.244999999999997 29.054999999999996 26.884999999999998 20.815 55-59 23.810000000000002 27.595 27.584999999999997 21.01 60-64 23.65 28.465 26.85 21.035 65-69 23.189999999999998 28.15 27.644999999999996 21.015 70-74 23.48 28.860000000000003 26.695 20.965 75-79 23.794999999999998 28.439999999999998 26.895000000000003 20.87 80-84 23.565 28.975 26.75 20.71 85-89 23.625 28.965000000000003 26.619999999999997 20.79 90-94 23.845 28.384999999999998 27.305 20.465 95-99 24.195 28.575 26.82 20.41 100-104 24.29 28.194999999999997 27.12 20.395 105-109 24.37 28.57 27.065 19.994999999999997 110-114 24.065 27.839999999999996 27.62 20.474999999999998 115-119 24.16 28.74 26.795 20.305 120-124 23.65 28.09 27.169999999999998 21.09 125-129 24.099999999999998 28.38 26.795 20.724999999999998 130-134 24.099999999999998 27.88 27.400000000000002 20.62 135-139 24.11 27.775 27.93 20.185 140-144 24.169999999999998 28.125 27.435 20.27 145-149 24.18 28.410000000000004 27.32 20.09 150-151 24.775 28.4125 27.025 19.787499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 1.5 25 1.0 26 4.5 27 6.0 28 4.5 29 9.5 30 13.0 31 13.5 32 16.5 33 23.0 34 34.5 35 46.0 36 68.5 37 87.5 38 119.0 39 182.5 40 224.0 41 236.5 42 267.0 43 293.5 44 286.0 45 278.5 46 276.0 47 256.5 48 224.5 49 201.0 50 186.5 51 149.5 52 105.5 53 91.5 54 74.5 55 49.0 56 47.0 57 31.5 58 17.5 59 21.5 60 12.0 61 8.5 62 6.5 63 3.5 64 5.0 65 4.0 66 3.0 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.18 35-39 0.5 40-44 0.5349999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74918485076498 99.425 2 0.2257336343115124 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.025081514923501375 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.1875 0.0 0.0 0.0 0.0 126-127 1.4625 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.7625000000000002 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.175 0.0 0.0 0.0 0.0 138-139 2.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAATT 10 0.006830828 145.0 8 >>END_MODULE Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716669 spots for SRR7171854.sra Written 716669 spots for SRR7171854.sra Read 716686 spots for SRR7171854.sra Written 716686 spots for SRR7171854.sra SRR ids: ['SRR7171854.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lv0bf1hs SRR7171854.sra spots: 14333397 blocks: [[1, 716669], [716670, 1433338], [1433339, 2150007], [2150008, 2866676], [2866677, 3583345], [3583346, 4300014], [4300015, 5016683], [5016684, 5733352], [5733353, 6450021], [6450022, 7166690], [7166691, 7883359], [7883360, 8600028], [8600029, 9316697], [9316698, 10033366], [10033367, 10750035], [10750036, 11466704], [11466705, 12183373], [12183374, 12900042], [12900043, 13616711], [13616712, 14333397]] SRR7171854 file size 4835417 SRR7171854 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171854 SRR7171854_1.fastq SRR7171854_2.fastq Input file: SRR7171854_1.fastq Paired file: SRR7171854_2.fastq trimmed: SRR7171854-trimmed-pair1.fastq, SRR7171854-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:16:31 2025 >> started Thu Feb 13 21:16:47 2025 >> done (16.519s) 14333397 read pairs processed; of these: 15180 ( 0.11%) short read pairs filtered out after trimming by size control 10187 ( 0.07%) empty read pairs filtered out after trimming by size control 14308030 (99.82%) read pairs available; of these: 6141659 (42.92%) trimmed read pairs available after processing 8166371 (57.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 2 0.00% 24 5 0.00% 25 1 0.00% 26 0 0.00% 27 6 0.00% 28 3 0.00% 29 3 0.00% 30 8 0.00% 31 2 0.00% 32 4 0.00% 33 4 0.00% 34 2 0.00% 35 2 0.00% 36 3 0.00% 37 6 0.00% 38 6 0.00% 39 3 0.00% 40 5 0.00% 41 6 0.00% 42 11 0.00% 43 5 0.00% 44 9 0.00% 45 7 0.00% 46 11 0.00% 47 10 0.00% 48 14 0.00% 49 17 0.00% 50 16 0.00% 51 18 0.00% 52 18 0.00% 53 19 0.00% 54 15 0.00% 55 20 0.00% 56 25 0.00% 57 30 0.00% 58 22 0.00% 59 37 0.00% 60 33 0.00% 61 47 0.00% 62 43 0.00% 63 58 0.00% 64 71 0.00% 65 77 0.00% 66 77 0.00% 67 73 0.00% 68 104 0.00% 69 118 0.00% 70 132 0.00% 71 164 0.00% 72 198 0.00% 73 214 0.00% 74 302 0.00% 75 278 0.00% 76 389 0.00% 77 380 0.00% 78 405 0.00% 79 447 0.00% 80 556 0.00% 81 602 0.00% 82 674 0.00% 83 900 0.01% 84 1464 0.01% 85 2012 0.01% 86 2076 0.01% 87 2133 0.01% 88 2274 0.02% 89 2418 0.02% 90 2569 0.02% 91 2740 0.02% 92 2820 0.02% 93 3026 0.02% 94 3229 0.02% 95 3434 0.02% 96 3649 0.03% 97 3884 0.03% 98 4144 0.03% 99 4519 0.03% 100 4731 0.03% 101 5032 0.04% 102 5433 0.04% 103 5972 0.04% 104 6221 0.04% 105 6569 0.05% 106 7060 0.05% 107 7219 0.05% 108 7821 0.05% 109 8060 0.06% 110 8571 0.06% 111 9165 0.06% 112 9793 0.07% 113 10317 0.07% 114 11230 0.08% 115 11794 0.08% 116 12494 0.09% 117 12934 0.09% 118 14794 0.10% 119 12638 0.09% 120 14827 0.10% 121 15577 0.11% 122 16495 0.12% 123 17819 0.12% 124 18885 0.13% 125 19653 0.14% 126 20799 0.15% 127 22015 0.15% 128 22939 0.16% 129 24011 0.17% 130 26074 0.18% 131 27864 0.19% 132 29280 0.20% 133 32039 0.22% 134 34171 0.24% 135 34633 0.24% 136 37671 0.26% 137 40753 0.28% 138 44133 0.31% 139 48376 0.34% 140 53628 0.37% 141 59344 0.41% 142 68206 0.48% 143 79136 0.55% 144 94818 0.66% 145 115383 0.81% 146 151695 1.06% 147 215228 1.50% 148 345178 2.41% 149 724234 5.06% 150 3455829 24.15% 151 8166371 57.08% 14308030 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.44 fanout-score-rank=15 prefix-density=0.33 prefix-fanout=3.6 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=11.03 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=3.7 sequence=TTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=29 prefix-density=0.43 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=41.29 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.0 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATG SRR7171854 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:17:35 Started mapping on | Feb 13 21:17:35 Finished on | Feb 13 21:19:47 Mapping speed, Million of reads per hour | 390.22 Number of input reads | 14308030 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13132505 Uniquely mapped reads % | 91.78% Average mapped length | 296.95 Number of splices: Total | 13159457 Number of splices: Annotated (sjdb) | 12923681 Number of splices: GT/AG | 12952515 Number of splices: GC/AG | 165587 Number of splices: AT/AC | 10166 Number of splices: Non-canonical | 31189 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361633 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 34645 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.35% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 827345 827345 827345 N_multimapping 361633 361633 361633 N_noFeature 271587 13023620 321224 N_ambiguous 133465 737 73813 UnstrandedReadsAssigned:12727453 PositiveStrandReadsAssigned:108148 NegativeStrandReadsAssigned:12737468 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171854 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171854-trimmed-pair1.fastq SRR7171854-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,308,030 reads, 12,678,532 reads pseudoaligned [quant] estimated average fragment length: 261.62 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR7171854.ke.tsv 34699 SRR7171854.se.tsv 87100 total ==> SRR7171854.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.38 1254 52.2583 Potri.005G024800.1.v4.1 1035 774.38 594 56.1766 Potri.004G059700.1.v4.1 961 700.38 14 1.46392 Potri.007G009000.2.v4.1 1416 1155.38 0 0 Potri.003G141000.2.v4.1 2943 2682.38 570 15.5624 Potri.016G087400.1.v4.1 270 68.5348 855.198 913.858 Potri.015G069301.1.v4.1 564 308.439 0 0 Potri.010G195200.1.v4.1 1773 1512.38 300 14.5272 Potri.012G127500.1.v4.1 977 716.38 6333 647.424 ==> SRR7171854.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 311 SRR7171854 completed mapping pipeline successfully