Starting /dee2/code/volunteer_pipeline.sh SRR7171855 current disk space = 3088199442432 free memory = 1580180300 SRR7171855 SRAfilesize 75c8da45f79bc4c892d82aba19ee83de SRR7171855.sra SRR7171855.sra file validated SRR7171855 is paired end SRR7171855 is conventional basespace SRR7171855 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171855_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.58 33.0 33.0 34.0 32.0 34.0 2 32.89075 34.0 33.0 34.0 32.0 34.0 3 32.08525 33.0 33.0 34.0 29.0 34.0 4 32.8825 33.0 33.0 34.0 32.0 34.0 5 32.75225 33.0 33.0 34.0 32.0 34.0 6 36.6805 38.0 37.0 38.0 34.0 38.0 7 36.74325 38.0 37.0 38.0 34.0 38.0 8 37.31975 38.0 38.0 38.0 36.0 38.0 9 37.48475 38.0 38.0 38.0 37.0 38.0 10-14 37.5109 38.0 38.0 38.0 37.4 38.0 15-19 37.52395 38.0 38.0 38.0 37.6 38.0 20-24 37.485299999999995 38.0 38.0 38.0 37.2 38.0 25-29 37.451649999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.481399999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.441250000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.4568 38.0 38.0 38.0 37.6 38.0 45-49 37.390249999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.36505 38.0 38.0 38.0 37.0 38.0 55-59 37.289750000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.29345 38.0 38.0 38.0 37.0 38.0 65-69 37.2505 38.0 38.0 38.0 36.8 38.0 70-74 37.13175 38.0 38.0 38.0 36.0 38.0 75-79 37.1044 38.0 38.0 38.0 36.0 38.0 80-84 37.12265 38.0 38.0 38.0 36.0 38.0 85-89 37.072799999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.968500000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.898399999999995 38.0 38.0 38.0 35.6 38.0 100-104 36.84995 38.0 38.0 38.0 35.4 38.0 105-109 36.74085 38.0 38.0 38.0 35.0 38.0 110-114 36.6254 38.0 38.0 38.0 34.4 38.0 115-119 36.49925 38.0 38.0 38.0 34.0 38.0 120-124 36.425349999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.06775 38.0 37.4 38.0 33.0 38.0 130-134 35.9432 38.0 37.0 38.0 32.6 38.0 135-139 35.8687 38.0 37.0 38.0 33.0 38.0 140-144 35.65635 38.0 36.0 38.0 32.0 38.0 145-149 35.2828 38.0 36.0 38.0 31.0 38.0 150-151 32.320875 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 5.0 22 2.0 23 3.0 24 7.0 25 5.0 26 11.0 27 17.0 28 24.0 29 23.0 30 33.0 31 48.0 32 49.0 33 68.0 34 120.0 35 199.0 36 520.0 37 2857.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.668410041841007 14.670502092050208 11.872384937238493 41.78870292887029 2 19.075 20.7 35.099999999999994 25.124999999999996 3 20.025000000000002 25.8 23.799999999999997 30.375000000000004 4 22.6 32.4 21.349999999999998 23.65 5 21.4 34.050000000000004 24.0 20.549999999999997 6 17.7 36.825 25.174999999999997 20.3 7 13.15 23.325000000000003 45.45 18.075 8 18.8 23.65 29.875 27.675 9 17.75 23.674999999999997 33.7 24.875 10-14 19.585 29.585 27.05 23.78 15-19 19.15 28.605000000000004 27.79 24.455 20-24 19.41 28.92 28.325 23.345 25-29 19.08 29.494999999999997 27.800000000000004 23.625 30-34 20.04 28.720000000000002 27.55 23.69 35-39 19.869999999999997 28.675 27.889999999999997 23.565 40-44 19.56 28.660000000000004 28.065 23.715 45-49 19.939999999999998 28.26 27.834999999999997 23.965 50-54 20.044999999999998 28.555000000000003 27.425 23.974999999999998 55-59 19.41 28.535 28.185 23.87 60-64 20.31 28.13 27.58 23.98 65-69 19.835 28.88 27.61 23.674999999999997 70-74 20.325 27.685 28.194999999999997 23.794999999999998 75-79 20.47 27.815 27.884999999999998 23.830000000000002 80-84 19.925 28.660000000000004 27.52 23.895 85-89 20.125 28.155 27.68 24.04 90-94 20.91 28.205000000000002 27.435 23.45 95-99 20.16 28.904999999999998 27.439999999999998 23.494999999999997 100-104 20.265 28.03 27.625 24.08 105-109 20.355 27.85 27.689999999999998 24.104999999999997 110-114 20.44 28.33 27.715 23.515 115-119 20.215 28.265 27.73 23.79 120-124 20.11 28.349999999999998 28.025 23.515 125-129 20.810000000000002 27.485 28.050000000000004 23.655 130-134 20.495 27.900000000000002 27.965 23.64 135-139 20.605 27.584999999999997 28.03 23.78 140-144 20.945 27.735 27.395000000000003 23.925 145-149 20.544999999999998 27.894999999999996 28.065 23.494999999999997 150-151 20.3875 28.3875 27.3625 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 2.5 25 3.0 26 5.0 27 6.5 28 7.0 29 12.0 30 18.0 31 22.0 32 32.5 33 49.5 34 60.5 35 75.5 36 101.0 37 117.0 38 134.5 39 150.0 40 198.0 41 242.0 42 249.5 43 263.5 44 277.5 45 267.0 46 252.0 47 247.0 48 223.0 49 199.5 50 182.5 51 160.0 52 111.5 53 76.5 54 70.5 55 49.0 56 31.5 57 27.5 58 18.0 59 11.0 60 9.5 61 8.5 62 6.0 63 4.0 64 5.0 65 3.5 66 1.0 67 0.5 68 1.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3999999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.7999999999999998 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.1625 0.0 0.0 0.0 0.0 136-137 2.4375 0.0 0.0 0.0 0.0 138-139 2.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGAAA 10 0.0068343505 144.975 6 >>END_MODULE SRR7171855 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171855_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.924 33.0 33.0 34.0 32.0 34.0 2 33.033 34.0 33.0 34.0 32.0 34.0 3 33.06075 34.0 33.0 34.0 33.0 34.0 4 33.035 34.0 33.0 34.0 33.0 34.0 5 32.9595 34.0 33.0 34.0 32.0 34.0 6 37.157 38.0 38.0 38.0 37.0 38.0 7 37.12225 38.0 38.0 38.0 37.0 38.0 8 37.13825 38.0 38.0 38.0 37.0 38.0 9 37.23975 38.0 38.0 38.0 37.0 38.0 10-14 37.08445 38.0 38.0 38.0 36.8 38.0 15-19 37.066700000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.0061 38.0 38.0 38.0 37.0 38.0 25-29 37.0036 38.0 38.0 38.0 37.0 38.0 30-34 36.99465 38.0 38.0 38.0 37.0 38.0 35-39 36.93679999999999 38.0 38.0 38.0 36.8 38.0 40-44 36.93295 38.0 38.0 38.0 36.8 38.0 45-49 36.92 38.0 38.0 38.0 37.0 38.0 50-54 36.8686 38.0 38.0 38.0 36.0 38.0 55-59 36.890100000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.839549999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.783750000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.722350000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.6841 38.0 38.0 38.0 35.6 38.0 80-84 36.68165 38.0 38.0 38.0 35.2 38.0 85-89 36.5312 38.0 38.0 38.0 34.6 38.0 90-94 36.4493 38.0 38.0 38.0 34.4 38.0 95-99 36.39 38.0 38.0 38.0 34.4 38.0 100-104 36.213 38.0 38.0 38.0 34.0 38.0 105-109 36.10565 38.0 38.0 38.0 34.0 38.0 110-114 36.048750000000005 38.0 38.0 38.0 33.8 38.0 115-119 35.902499999999996 38.0 37.2 38.0 33.0 38.0 120-124 35.796 38.0 37.0 38.0 32.6 38.0 125-129 35.5818 38.0 36.8 38.0 31.4 38.0 130-134 35.31575 38.0 36.0 38.0 31.0 38.0 135-139 35.01055 38.0 36.0 38.0 28.8 38.0 140-144 34.6681 38.0 35.2 38.0 27.8 38.0 145-149 34.18275 38.0 35.0 38.0 25.8 38.0 150-151 30.75 36.5 29.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 7.0 4 3.0 5 2.0 6 3.0 7 1.0 8 2.0 9 1.0 10 1.0 11 4.0 12 4.0 13 2.0 14 2.0 15 2.0 16 1.0 17 4.0 18 2.0 19 0.0 20 7.0 21 4.0 22 1.0 23 4.0 24 13.0 25 16.0 26 20.0 27 22.0 28 32.0 29 28.0 30 37.0 31 45.0 32 59.0 33 99.0 34 106.0 35 194.0 36 544.0 37 2718.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.892365456821025 18.448060075093867 17.546933667083856 30.112640801001252 2 23.25581395348837 25.081270317579396 34.55863965991498 17.104276069017253 3 20.38009502375594 27.156789197299325 31.782945736434108 20.68017004251063 4 23.380845211302827 34.90872718179545 23.25581395348837 18.454613653413354 5 23.830957739434858 36.734183545886474 22.18054513628407 17.254313578394598 6 19.5 36.85 24.25 19.400000000000002 7 18.25 19.525000000000002 41.349999999999994 20.875 8 21.7 22.2 27.900000000000002 28.199999999999996 9 23.0 24.349999999999998 30.075000000000003 22.575 10-14 23.286164308215408 28.691434571728585 26.16630831541577 21.85609280464023 15-19 22.847996798879606 28.459960986345223 27.809733406692345 20.88230880808283 20-24 23.06382978723404 28.56070087609512 27.399249061326657 20.97622027534418 25-29 23.27909887359199 27.64956195244055 27.8648310387985 21.20650813516896 30-34 22.72340425531915 28.37546933667084 27.68961201501877 21.21151439299124 35-39 23.089634451677515 28.502754131196795 27.310966449674513 21.096644967451176 40-44 22.922090927298218 28.09433206489085 27.909072701782495 21.07450430602844 45-49 23.332165557279417 28.211801211150593 27.536159351383816 20.919873880186177 50-54 22.819563912782556 28.570714142828567 27.595519103820763 21.014202840568114 55-59 23.308496274441165 27.919187878181727 27.36410461569235 21.408211231684753 60-64 23.533530029504426 28.449267390108517 27.14407161074161 20.873130969645448 65-69 23.721186059302966 27.44637231861593 28.061403070153506 20.771038551927596 70-74 23.474999999999998 28.565 27.195000000000004 20.765 75-79 23.74 27.400000000000002 27.794999999999998 21.065 80-84 23.415 27.875 27.36 21.349999999999998 85-89 23.494999999999997 28.07 27.525 20.91 90-94 24.185000000000002 27.735 27.450000000000003 20.630000000000003 95-99 23.465 28.470000000000002 27.284999999999997 20.78 100-104 23.669999999999998 27.79 27.565 20.974999999999998 105-109 23.855 27.98 27.334999999999997 20.830000000000002 110-114 23.200000000000003 28.505000000000003 27.310000000000002 20.985 115-119 23.945 27.905 27.735 20.415 120-124 23.544999999999998 28.005000000000003 27.694999999999997 20.755000000000003 125-129 24.69 28.13 27.445000000000004 19.735 130-134 24.26 27.455000000000002 27.544999999999998 20.74 135-139 24.615000000000002 27.88 27.650000000000002 19.855 140-144 23.91 27.815 27.66 20.615 145-149 24.77 28.044999999999998 27.165 20.02 150-151 24.675 26.950000000000003 27.8375 20.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 1.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 0.5 25 2.0 26 3.0 27 3.0 28 5.0 29 9.5 30 10.5 31 11.0 32 22.0 33 31.0 34 39.5 35 53.5 36 78.5 37 111.5 38 130.0 39 151.5 40 186.0 41 222.0 42 262.5 43 282.5 44 291.0 45 288.5 46 281.5 47 270.5 48 241.5 49 203.0 50 178.5 51 151.0 52 112.5 53 94.0 54 72.5 55 50.0 56 35.5 57 29.5 58 21.5 59 14.0 60 10.0 61 6.0 62 6.5 63 6.5 64 2.5 65 1.5 66 3.5 67 3.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.034999999999999996 20-24 0.125 25-29 0.125 30-34 0.125 35-39 0.15 40-44 0.13999999999999999 45-49 0.095 50-54 0.02 55-59 0.015 60-64 0.015 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69871955812202 99.275 2 0.2761737383881496 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025106703489831784 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.1375 0.0 0.0 0.0 0.0 124-125 1.2374999999999998 0.0 0.0 0.0 0.0 126-127 1.4500000000000002 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 2.0375 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.4625 0.0 0.0 0.0 0.0 138-139 2.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGGT 10 0.006830828 145.0 9 ACAAGCA 10 0.006830828 145.0 6 >>END_MODULE Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858596 spots for SRR7171855.sra Written 858596 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra Read 858590 spots for SRR7171855.sra Written 858590 spots for SRR7171855.sra SRR ids: ['SRR7171855.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ykh2ca5q SRR7171855.sra spots: 17171806 blocks: [[1, 858590], [858591, 1717180], [1717181, 2575770], [2575771, 3434360], [3434361, 4292950], [4292951, 5151540], [5151541, 6010130], [6010131, 6868720], [6868721, 7727310], [7727311, 8585900], [8585901, 9444490], [9444491, 10303080], [10303081, 11161670], [11161671, 12020260], [12020261, 12878850], [12878851, 13737440], [13737441, 14596030], [14596031, 15454620], [15454621, 16313210], [16313211, 17171806]] SRR7171855 file size 5797261 SRR7171855 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171855 SRR7171855_1.fastq SRR7171855_2.fastq Input file: SRR7171855_1.fastq Paired file: SRR7171855_2.fastq trimmed: SRR7171855-trimmed-pair1.fastq, SRR7171855-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:29:17 2025 >> started Thu Feb 13 21:29:36 2025 >> done (18.115s) 17171806 read pairs processed; of these: 25715 ( 0.15%) short read pairs filtered out after trimming by size control 21464 ( 0.12%) empty read pairs filtered out after trimming by size control 17124627 (99.73%) read pairs available; of these: 5631875 (32.89%) trimmed read pairs available after processing 11492752 (67.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 3 0.00% 21 1 0.00% 22 5 0.00% 23 3 0.00% 24 1 0.00% 25 3 0.00% 26 3 0.00% 27 1 0.00% 28 3 0.00% 29 3 0.00% 30 4 0.00% 31 4 0.00% 32 4 0.00% 33 0 0.00% 34 4 0.00% 35 2 0.00% 36 4 0.00% 37 4 0.00% 38 16 0.00% 39 4 0.00% 40 10 0.00% 41 9 0.00% 42 8 0.00% 43 34 0.00% 44 25 0.00% 45 20 0.00% 46 21 0.00% 47 76 0.00% 48 135 0.00% 49 28 0.00% 50 20 0.00% 51 40 0.00% 52 87 0.00% 53 124 0.00% 54 110 0.00% 55 62 0.00% 56 63 0.00% 57 125 0.00% 58 131 0.00% 59 66 0.00% 60 67 0.00% 61 93 0.00% 62 77 0.00% 63 70 0.00% 64 76 0.00% 65 93 0.00% 66 124 0.00% 67 117 0.00% 68 153 0.00% 69 146 0.00% 70 166 0.00% 71 177 0.00% 72 243 0.00% 73 215 0.00% 74 343 0.00% 75 374 0.00% 76 477 0.00% 77 570 0.00% 78 513 0.00% 79 568 0.00% 80 588 0.00% 81 657 0.00% 82 801 0.00% 83 945 0.01% 84 2118 0.01% 85 2882 0.02% 86 2896 0.02% 87 3177 0.02% 88 3154 0.02% 89 3386 0.02% 90 3440 0.02% 91 3478 0.02% 92 3700 0.02% 93 3820 0.02% 94 4171 0.02% 95 4537 0.03% 96 4703 0.03% 97 4790 0.03% 98 5040 0.03% 99 5490 0.03% 100 5755 0.03% 101 6096 0.04% 102 6471 0.04% 103 7098 0.04% 104 7580 0.04% 105 7989 0.05% 106 8366 0.05% 107 8768 0.05% 108 9254 0.05% 109 9846 0.06% 110 10713 0.06% 111 10990 0.06% 112 11540 0.07% 113 12105 0.07% 114 12900 0.08% 115 13927 0.08% 116 14508 0.08% 117 15002 0.09% 118 15866 0.09% 119 17090 0.10% 120 18586 0.11% 121 18886 0.11% 122 18823 0.11% 123 19655 0.11% 124 21099 0.12% 125 21646 0.13% 126 22610 0.13% 127 23911 0.14% 128 24666 0.14% 129 25770 0.15% 130 27614 0.16% 131 28733 0.17% 132 30537 0.18% 133 32869 0.19% 134 34880 0.20% 135 36528 0.21% 136 39320 0.23% 137 42289 0.25% 138 44807 0.26% 139 48960 0.29% 140 52193 0.30% 141 57433 0.34% 142 64277 0.38% 143 73092 0.43% 144 84359 0.49% 145 101189 0.59% 146 124928 0.73% 147 169462 0.99% 148 261990 1.53% 149 531830 3.11% 150 3247365 18.96% 151 11492752 67.11% 17124627 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=28 prefix-density=0.24 prefix-fanout=2.2 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=45.28 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=7.1 sequence=CAAGAACAAAGATCATGCCACCAAAGGCCCAAGCGAT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=7.22 fanout-score-rank=18 prefix-density=0.38 prefix-fanout=3.8 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=364.79 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=32.3 sequence=AAGAAGAAGAAA SRR7171855 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:30:20 Started mapping on | Feb 13 21:30:20 Finished on | Feb 13 21:32:13 Mapping speed, Million of reads per hour | 545.56 Number of input reads | 17124627 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16214902 Uniquely mapped reads % | 94.69% Average mapped length | 297.42 Number of splices: Total | 15912463 Number of splices: Annotated (sjdb) | 15594380 Number of splices: GT/AG | 15658064 Number of splices: GC/AG | 201172 Number of splices: AT/AC | 13792 Number of splices: Non-canonical | 39435 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415138 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 53830 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 518143 518143 518143 N_multimapping 415138 415138 415138 N_noFeature 429757 16040141 521276 N_ambiguous 188443 2343 103318 UnstrandedReadsAssigned:15596702 PositiveStrandReadsAssigned:172418 NegativeStrandReadsAssigned:15590308 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171855 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171855-trimmed-pair1.fastq SRR7171855-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,124,627 reads, 15,484,039 reads pseudoaligned [quant] estimated average fragment length: 266.03 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR7171855.ke.tsv 34699 SRR7171855.se.tsv 87100 total ==> SRR7171855.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.97 1910 66.1077 Potri.005G024800.1.v4.1 1035 769.97 274 21.5909 Potri.004G059700.1.v4.1 961 696.007 43 3.74842 Potri.007G009000.2.v4.1 1416 1150.97 0 0 Potri.003G141000.2.v4.1 2943 2677.97 481.36 10.9058 Potri.016G087400.1.v4.1 270 66.0186 1061 975.085 Potri.015G069301.1.v4.1 564 303.907 0 0 Potri.010G195200.1.v4.1 1773 1507.97 316.822 12.7472 Potri.012G127500.1.v4.1 977 711.981 7352 626.513 ==> SRR7171855.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 379 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 290 SRR7171855 completed mapping pipeline successfully