Starting /dee2/code/volunteer_pipeline.sh SRR7171856
    current disk space = 3088225005568
    free memory = 1470765212 
SRR7171856 SRAfilesize
f7ae9a12a03ddbe671b394389dd285fe  SRR7171856.sra
SRR7171856.sra file validated
SRR7171856 is paired end
SRR7171856 is conventional basespace
SRR7171856 read1 length is 151 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	SRR7171856_1.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	151
%GC	43
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	31.4965	33.0	33.0	34.0	32.0	34.0
2	32.76	34.0	33.0	34.0	32.0	34.0
3	31.8535	33.0	31.0	33.0	28.0	34.0
4	31.94175	33.0	32.0	33.0	31.0	34.0
5	32.29025	33.0	33.0	33.0	31.0	34.0
6	36.05525	38.0	36.0	38.0	33.0	38.0
7	36.86925	38.0	37.0	38.0	34.0	38.0
8	37.343	38.0	38.0	38.0	36.0	38.0
9	37.518	38.0	38.0	38.0	37.0	38.0
10-14	37.5012	38.0	38.0	38.0	37.0	38.0
15-19	37.5455	38.0	38.0	38.0	37.8	38.0
20-24	37.516949999999994	38.0	38.0	38.0	37.8	38.0
25-29	37.5015	38.0	38.0	38.0	37.8	38.0
30-34	37.48895	38.0	38.0	38.0	37.6	38.0
35-39	37.42755	38.0	38.0	38.0	37.4	38.0
40-44	37.449400000000004	38.0	38.0	38.0	37.4	38.0
45-49	37.41515	38.0	38.0	38.0	37.0	38.0
50-54	37.3809	38.0	38.0	38.0	37.0	38.0
55-59	37.36345	38.0	38.0	38.0	37.0	38.0
60-64	37.335	38.0	38.0	38.0	37.0	38.0
65-69	37.30565	38.0	38.0	38.0	37.0	38.0
70-74	37.27655	38.0	38.0	38.0	36.8	38.0
75-79	37.2048	38.0	38.0	38.0	36.6	38.0
80-84	37.143299999999996	38.0	38.0	38.0	36.2	38.0
85-89	37.1295	38.0	38.0	38.0	36.0	38.0
90-94	37.0081	38.0	38.0	38.0	36.0	38.0
95-99	36.951800000000006	38.0	38.0	38.0	35.6	38.0
100-104	36.9199	38.0	38.0	38.0	35.8	38.0
105-109	36.821200000000005	38.0	38.0	38.0	35.0	38.0
110-114	36.67320000000001	38.0	38.0	38.0	34.8	38.0
115-119	36.579100000000004	38.0	38.0	38.0	34.2	38.0
120-124	36.4605	38.0	38.0	38.0	34.0	38.0
125-129	36.1618	38.0	37.4	38.0	33.6	38.0
130-134	36.063900000000004	38.0	37.0	38.0	33.0	38.0
135-139	35.98694999999999	38.0	37.4	38.0	33.0	38.0
140-144	35.78335	38.0	36.2	38.0	32.4	38.0
145-149	35.44585	38.0	36.0	38.0	31.2	38.0
150-151	32.57925	37.0	33.5	38.0	16.5	38.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
7	1.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	1.0
16	0.0
17	3.0
18	1.0
19	1.0
20	2.0
21	3.0
22	2.0
23	1.0
24	4.0
25	12.0
26	8.0
27	9.0
28	20.0
29	20.0
30	38.0
31	43.0
32	55.0
33	61.0
34	122.0
35	190.0
36	546.0
37	2857.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	32.09715330373466	16.819012797074954	11.099503786889526	39.98433011230087
2	19.55	21.6	32.35	26.5
3	19.0	28.025	24.825	28.15
4	22.95	34.1	21.125	21.825
5	21.4	37.525	21.95	19.125
6	16.875	36.95	26.075	20.1
7	12.9	23.25	44.725	19.125
8	18.625	22.35	28.725	30.3
9	17.375	23.35	31.874999999999996	27.400000000000002
10-14	19.41	29.549999999999997	26.93	24.11
15-19	19.45	29.525000000000002	27.544999999999998	23.48
20-24	19.54	28.689999999999998	28.165000000000003	23.605
25-29	19.63	29.325000000000003	27.834999999999997	23.21
30-34	19.305	29.080000000000002	27.605	24.01
35-39	19.575	28.910000000000004	27.634999999999998	23.880000000000003
40-44	19.27	29.854999999999997	27.165	23.71
45-49	19.655	28.67	27.229999999999997	24.445
50-54	19.885	28.7	27.3	24.115000000000002
55-59	19.744999999999997	29.175	27.455000000000002	23.625
60-64	19.63	28.854999999999997	27.705000000000002	23.810000000000002
65-69	20.085	28.285	27.555000000000003	24.075
70-74	19.994999999999997	28.694999999999997	27.405	23.905
75-79	20.630000000000003	28.255000000000003	27.43	23.685000000000002
80-84	19.61	28.7	27.48	24.21
85-89	20.419999999999998	28.310000000000002	27.884999999999998	23.385
90-94	20.575	28.165000000000003	28.12	23.14
95-99	20.41	28.33	27.155	24.104999999999997
100-104	19.935	28.265	28.13	23.669999999999998
105-109	20.54	28.225	27.345000000000002	23.89
110-114	20.405	28.49	27.555000000000003	23.549999999999997
115-119	20.445	28.075	28.33	23.150000000000002
120-124	20.205000000000002	28.065	28.115000000000002	23.615
125-129	20.91	27.805000000000003	27.875	23.41
130-134	20.075000000000003	28.055000000000003	27.62	24.25
135-139	21.12	27.355	27.465	24.060000000000002
140-144	20.515	28.115000000000002	28.110000000000003	23.26
145-149	20.595	28.084999999999997	27.38	23.94
150-151	20.5375	27.0875	27.762500000000003	24.6125
>>END_MODULE
>>Per sequence GC content	pass
#GC Content	Count
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.5
9	0.5
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	0.0
18	0.0
19	1.5
20	1.5
21	0.5
22	1.5
23	3.0
24	2.5
25	4.5
26	7.0
27	7.0
28	8.0
29	14.0
30	22.5
31	23.0
32	26.5
33	40.0
34	50.5
35	65.0
36	91.5
37	119.0
38	141.5
39	167.0
40	204.0
41	231.5
42	243.0
43	259.0
44	278.0
45	279.5
46	268.0
47	251.0
48	241.0
49	208.5
50	168.0
51	145.5
52	105.5
53	81.0
54	63.0
55	45.5
56	38.0
57	25.5
58	20.0
59	16.5
60	11.0
61	7.0
62	5.0
63	3.5
64	1.0
65	0.0
66	0.0
67	0.0
68	0.5
69	1.0
70	0.5
71	0.0
72	0.0
73	0.0
74	0.0
75	0.0
76	0.0
77	0.0
78	0.0
79	0.0
80	0.0
81	0.0
82	0.0
83	0.0
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	4.275
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10-14	0.0
15-19	0.0
20-24	0.0
25-29	0.0
30-34	0.0
35-39	0.0
40-44	0.0
45-49	0.0
50-54	0.0
55-59	0.0
60-64	0.0
65-69	0.0
70-74	0.0
75-79	0.0
80-84	0.0
85-89	0.0
90-94	0.0
95-99	0.0
100-104	0.0
105-109	0.0
110-114	0.0
115-119	0.0
120-124	0.0
125-129	0.0
130-134	0.0
135-139	0.0
140-144	0.0
145-149	0.0
150-151	0.0
>>END_MODULE
>>Sequence Length Distribution	pass
#Length	Count
151	4000.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	99.8
#Duplication Level	Percentage of deduplicated	Percentage of total
1	99.79959919839679	99.6
2	0.2004008016032064	0.4
3	0.0	0.0
4	0.0	0.0
5	0.0	0.0
6	0.0	0.0
7	0.0	0.0
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	pass
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0	0.0	0.0	0.0	0.0
32-33	0.0	0.0	0.0	0.0	0.0
34-35	0.0	0.0	0.0	0.0	0.0
36-37	0.0	0.0	0.0	0.0	0.0
38-39	0.0	0.0	0.0	0.0	0.0
40-41	0.0	0.0	0.0	0.0	0.0
42-43	0.0	0.0	0.0	0.0	0.0
44-45	0.0	0.0	0.0	0.0	0.0
46-47	0.0	0.0	0.0	0.0	0.0
48-49	0.0	0.0	0.0	0.0	0.0
50-51	0.0	0.0	0.0	0.0	0.0
52-53	0.0	0.0	0.0	0.0	0.0
54-55	0.0	0.0	0.0	0.0	0.0
56-57	0.0	0.0	0.0	0.0	0.0
58-59	0.0	0.0	0.0	0.0	0.0
60-61	0.0	0.0	0.0	0.0	0.0
62-63	0.0	0.0	0.0	0.0	0.0
64-65	0.0	0.0	0.0	0.0	0.0
66-67	0.0	0.0	0.0	0.0	0.0
68-69	0.0	0.0	0.0	0.0	0.0
70-71	0.0	0.0	0.0	0.0	0.0
72-73	0.0	0.0	0.0	0.0	0.0
74-75	0.0	0.0	0.0	0.0	0.0
76-77	0.0	0.0	0.0	0.0	0.0
78-79	0.0	0.0	0.0	0.0	0.0
80-81	0.025	0.0	0.0	0.0	0.0
82-83	0.025	0.0	0.0	0.0	0.0
84-85	0.025	0.0	0.0	0.0	0.0
86-87	0.025	0.0	0.0	0.0	0.0
88-89	0.025	0.0	0.0	0.0	0.0
90-91	0.037500000000000006	0.0	0.0	0.0	0.0
92-93	0.0875	0.0	0.0	0.0	0.0
94-95	0.125	0.0	0.0	0.0	0.0
96-97	0.15	0.0	0.0	0.0	0.0
98-99	0.2	0.0	0.0	0.0	0.0
100-101	0.2625	0.0	0.0	0.0	0.0
102-103	0.2875	0.0	0.0	0.0	0.0
104-105	0.325	0.0	0.0	0.0	0.0
106-107	0.4125	0.0	0.0	0.0	0.0
108-109	0.4375	0.0	0.0	0.0	0.0
110-111	0.475	0.0	0.0	0.0	0.0
112-113	0.6	0.0	0.0	0.0	0.0
114-115	0.75	0.0	0.0	0.0	0.0
116-117	0.825	0.0	0.0	0.0	0.0
118-119	1.0	0.0	0.0	0.0	0.0
120-121	1.15	0.0	0.0	0.0	0.0
122-123	1.1875	0.0	0.0	0.0	0.0
124-125	1.3375	0.0	0.0	0.0	0.0
126-127	1.4500000000000002	0.0	0.0	0.0	0.0
128-129	1.55	0.0	0.0	0.0	0.0
130-131	1.7374999999999998	0.0	0.0	0.0	0.0
132-133	2.0125	0.0	0.0	0.0	0.0
134-135	2.1875	0.0	0.0	0.0	0.0
136-137	2.325	0.0	0.0	0.0	0.0
138-139	2.6125	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	warn
#Sequence	Count	PValue	Obs/Exp Max	Max Obs/Exp Position
ACAAGCT	10	0.0068343505	144.975	6
>>END_MODULE
SRR7171856 read2 length is 151 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	SRR7171856_2.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	151
%GC	44
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	32.96575	33.0	33.0	34.0	32.0	34.0
2	33.056	34.0	33.0	34.0	32.0	34.0
3	33.10075	34.0	33.0	34.0	33.0	34.0
4	33.061	34.0	33.0	34.0	32.0	34.0
5	33.036	34.0	33.0	34.0	33.0	34.0
6	37.266	38.0	38.0	38.0	37.0	38.0
7	37.20725	38.0	38.0	38.0	37.0	38.0
8	37.25925	38.0	38.0	38.0	37.0	38.0
9	37.29275	38.0	38.0	38.0	37.0	38.0
10-14	37.2463	38.0	38.0	38.0	37.0	38.0
15-19	37.204249999999995	38.0	38.0	38.0	37.0	38.0
20-24	37.14685000000001	38.0	38.0	38.0	37.0	38.0
25-29	37.1436	38.0	38.0	38.0	37.0	38.0
30-34	37.1541	38.0	38.0	38.0	37.0	38.0
35-39	37.048199999999994	38.0	38.0	38.0	37.0	38.0
40-44	37.013799999999996	38.0	38.0	38.0	37.0	38.0
45-49	37.097300000000004	38.0	38.0	38.0	37.0	38.0
50-54	37.09505	38.0	38.0	38.0	36.8	38.0
55-59	37.0818	38.0	38.0	38.0	37.0	38.0
60-64	37.01455	38.0	38.0	38.0	36.2	38.0
65-69	36.955349999999996	38.0	38.0	38.0	36.0	38.0
70-74	36.91335	38.0	38.0	38.0	36.0	38.0
75-79	36.8684	38.0	38.0	38.0	36.0	38.0
80-84	36.8333	38.0	38.0	38.0	36.0	38.0
85-89	36.6843	38.0	38.0	38.0	35.0	38.0
90-94	36.61355	38.0	38.0	38.0	35.0	38.0
95-99	36.6243	38.0	38.0	38.0	35.0	38.0
100-104	36.38185	38.0	38.0	38.0	34.2	38.0
105-109	36.29025	38.0	38.0	38.0	33.8	38.0
110-114	36.27485	38.0	38.0	38.0	34.0	38.0
115-119	36.072500000000005	38.0	38.0	38.0	33.8	38.0
120-124	35.89995	38.0	37.4	38.0	33.0	38.0
125-129	35.77185	38.0	37.2	38.0	32.6	38.0
130-134	35.48005	38.0	36.2	38.0	31.0	38.0
135-139	35.21820000000001	38.0	36.0	38.0	30.6	38.0
140-144	34.81365	38.0	35.6	38.0	28.6	38.0
145-149	34.46425000000001	38.0	35.0	38.0	27.6	38.0
150-151	31.213250000000002	36.5	31.0	38.0	12.5	38.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
2	6.0
3	2.0
4	0.0
5	2.0
6	4.0
7	2.0
8	2.0
9	1.0
10	1.0
11	2.0
12	2.0
13	2.0
14	2.0
15	1.0
16	0.0
17	1.0
18	1.0
19	5.0
20	4.0
21	5.0
22	8.0
23	6.0
24	12.0
25	10.0
26	13.0
27	30.0
28	23.0
29	29.0
30	26.0
31	49.0
32	55.0
33	77.0
34	134.0
35	209.0
36	503.0
37	2771.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	38.37878408806605	16.062046534901175	17.137853390042533	28.42131598699024
2	25.71285642821411	23.51175587793897	33.26663331665833	17.508754377188595
3	21.785892946473236	25.937968984492244	31.79089544772386	20.485242621310658
4	24.006001500375092	33.683420855213804	22.605651412853213	19.70492623155789
5	24.7623811905953	36.04302151075538	20.810405202601302	18.384192096048025
6	19.2	37.55	22.775000000000002	20.474999999999998
7	18.925	18.125	41.3	21.65
8	22.650000000000002	22.775000000000002	26.724999999999998	27.85
9	23.925	24.15	27.875	24.05
10-14	23.2061603080154	28.691434571728585	26.176308815440773	21.92609630481524
15-19	22.99074768692173	28.31707926981745	27.786946736684172	20.905226306576644
20-24	23.192831397677214	28.04865839006808	27.99859831798158	20.759911894273127
25-29	22.898928177902434	27.7121105879996	28.2279875788841	21.160973655213862
30-34	23.216432865731463	28.08617234468938	27.439879759519037	21.25751503006012
35-39	22.536834719855666	28.510574320938158	27.453142227122378	21.499448732083792
40-44	23.820258491133153	28.243662959623283	27.46718765654744	20.468890892696123
45-49	23.016111277894527	28.17472230561393	27.804463124186928	21.00470329230461
50-54	23.251975592677805	28.19845953786136	27.493247974392315	21.05631689506852
55-59	23.730932733183295	27.771942985746435	27.426856714178545	21.070267566891722
60-64	23.20464092818564	27.815563112622527	28.010602120424082	20.96919383876775
65-69	23.316165808290414	27.996399819990998	27.711385569278463	20.976048802440122
70-74	23.96	27.985	27.415	20.64
75-79	23.98	28.015	27.595	20.41
80-84	23.445	28.415000000000003	27.250000000000004	20.89
85-89	23.505000000000003	28.189999999999998	27.71	20.595
90-94	24.27	27.694999999999997	27.775	20.26
95-99	23.724999999999998	27.500000000000004	28.365000000000002	20.41
100-104	23.395	28.065	28.12	20.419999999999998
105-109	23.5	27.85	27.905	20.745
110-114	23.66	27.700000000000003	27.865000000000002	20.775
115-119	24.415	27.685	27.765	20.135
120-124	24.099999999999998	27.889999999999997	28.225	19.785
125-129	24.21	28.410000000000004	27.284999999999997	20.095
130-134	24.395	28.134999999999998	27.605	19.865
135-139	24.22	27.85	27.63	20.3
140-144	23.61	27.66	28.299999999999997	20.43
145-149	25.165	27.665	27.29	19.88
150-151	24.3875	27.2625	28.787499999999998	19.5625
>>END_MODULE
>>Per sequence GC content	pass
#GC Content	Count
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.5
6	0.5
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	1.0
15	1.5
16	0.5
17	0.0
18	0.5
19	0.5
20	0.0
21	0.0
22	0.0
23	2.0
24	2.5
25	3.0
26	4.5
27	2.5
28	4.0
29	8.5
30	9.5
31	11.0
32	15.0
33	22.5
34	29.5
35	46.5
36	73.0
37	97.5
38	129.0
39	169.0
40	190.0
41	222.0
42	257.0
43	288.0
44	298.0
45	284.5
46	279.0
47	261.0
48	250.5
49	219.5
50	188.5
51	159.0
52	115.5
53	90.5
54	75.5
55	58.5
56	37.0
57	20.5
58	14.0
59	11.5
60	9.0
61	8.0
62	6.0
63	5.0
64	5.0
65	5.0
66	4.0
67	1.5
68	1.5
69	0.5
70	0.0
71	0.0
72	0.0
73	0.0
74	0.0
75	0.0
76	0.0
77	0.0
78	0.0
79	0.0
80	0.0
81	0.0
82	0.0
83	0.0
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	0.075
2	0.05
3	0.05
4	0.025
5	0.05
6	0.0
7	0.0
8	0.0
9	0.0
10-14	0.005
15-19	0.025
20-24	0.12
25-29	0.16999999999999998
30-34	0.2
35-39	0.22999999999999998
40-44	0.19
45-49	0.06999999999999999
50-54	0.03
55-59	0.025
60-64	0.02
65-69	0.005
70-74	0.0
75-79	0.0
80-84	0.0
85-89	0.0
90-94	0.0
95-99	0.0
100-104	0.0
105-109	0.0
110-114	0.0
115-119	0.0
120-124	0.0
125-129	0.0
130-134	0.0
135-139	0.0
140-144	0.0
145-149	0.0
150-151	0.0
>>END_MODULE
>>Sequence Length Distribution	pass
#Length	Count
151	4000.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	99.825
#Duplication Level	Percentage of deduplicated	Percentage of total
1	99.82469321312296	99.65
2	0.1753067868770348	0.35000000000000003
3	0.0	0.0
4	0.0	0.0
5	0.0	0.0
6	0.0	0.0
7	0.0	0.0
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	pass
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0	0.0	0.0	0.0	0.0
32-33	0.0	0.0	0.0	0.0	0.0
34-35	0.0	0.0	0.0	0.0	0.0
36-37	0.0	0.0	0.0	0.0	0.0
38-39	0.0	0.0	0.0	0.0	0.0
40-41	0.0	0.0	0.0	0.0	0.0
42-43	0.0	0.0	0.0	0.0	0.0
44-45	0.0	0.0	0.0	0.0	0.0
46-47	0.0	0.0	0.0	0.0	0.0
48-49	0.0	0.0	0.0	0.0	0.0
50-51	0.0	0.0	0.0	0.0	0.0
52-53	0.0	0.0	0.0	0.0	0.0
54-55	0.0	0.0	0.0	0.0	0.0
56-57	0.0	0.0	0.0	0.0	0.0
58-59	0.0	0.0	0.0	0.0	0.0
60-61	0.0	0.0	0.0	0.0	0.0
62-63	0.0	0.0	0.0	0.0	0.0
64-65	0.0	0.0	0.0	0.0	0.0
66-67	0.0	0.0	0.0	0.0	0.0
68-69	0.0	0.0	0.0	0.0	0.0
70-71	0.0	0.0	0.0	0.0	0.0
72-73	0.0	0.0	0.0	0.0	0.0
74-75	0.0	0.0	0.0	0.0	0.0
76-77	0.0	0.0	0.0	0.0	0.0
78-79	0.0	0.0	0.0	0.0	0.0
80-81	0.025	0.0	0.0	0.0	0.0
82-83	0.025	0.0	0.0	0.0	0.0
84-85	0.025	0.0	0.0	0.0	0.0
86-87	0.025	0.0	0.0	0.0	0.0
88-89	0.025	0.0	0.0	0.0	0.0
90-91	0.037500000000000006	0.0	0.0	0.0	0.0
92-93	0.0875	0.0	0.0	0.0	0.0
94-95	0.125	0.0	0.0	0.0	0.0
96-97	0.15	0.0	0.0	0.0	0.0
98-99	0.2	0.0	0.0	0.0	0.0
100-101	0.2625	0.0	0.0	0.0	0.0
102-103	0.2875	0.0	0.0	0.0	0.0
104-105	0.325	0.0	0.0	0.0	0.0
106-107	0.4125	0.0	0.0	0.0	0.0
108-109	0.44999999999999996	0.0	0.0	0.0	0.0
110-111	0.5	0.0	0.0	0.0	0.0
112-113	0.6375	0.0	0.0	0.0	0.0
114-115	0.8	0.0	0.0	0.0	0.0
116-117	0.875	0.0	0.0	0.0	0.0
118-119	1.0375	0.0	0.0	0.0	0.0
120-121	1.2	0.0	0.0	0.0	0.0
122-123	1.2374999999999998	0.0	0.0	0.0	0.0
124-125	1.3625	0.0	0.0	0.0	0.0
126-127	1.475	0.0	0.0	0.0	0.0
128-129	1.575	0.0	0.0	0.0	0.0
130-131	1.7625000000000002	0.0	0.0	0.0	0.0
132-133	2.0375	0.0	0.0	0.0	0.0
134-135	2.2125	0.0	0.0	0.0	0.0
136-137	2.3499999999999996	0.0	0.0	0.0	0.0
138-139	2.6375	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	warn
#Sequence	Count	PValue	Obs/Exp Max	Max Obs/Exp Position
TTGTTAG	10	0.006830828	145.0	6
TCGGAGT	10	0.006830828	145.0	6
>>END_MODULE
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802338 spots for SRR7171856.sra
Written 802338 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
Read 802325 spots for SRR7171856.sra
Written 802325 spots for SRR7171856.sra
SRR ids: ['SRR7171856.sra']
extra args: ['--split-files', '--defline-qual', '+']
tempdir: /tmp/pfd_2jqjbk1u
SRR7171856.sra spots: 16046513
blocks: [[1, 802325], [802326, 1604650], [1604651, 2406975], [2406976, 3209300], [3209301, 4011625], [4011626, 4813950], [4813951, 5616275], [5616276, 6418600], [6418601, 7220925], [7220926, 8023250], [8023251, 8825575], [8825576, 9627900], [9627901, 10430225], [10430226, 11232550], [11232551, 12034875], [12034876, 12837200], [12837201, 13639525], [13639526, 14441850], [14441851, 15244175], [15244176, 16046513]]
SRR7171856 file size 5415936
SRR7171856 completed basic pipeline successfully
skewer v0.2.2 [April 4, 2016]
COMMAND LINE:	skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171856 SRR7171856_1.fastq SRR7171856_2.fastq
Input file:	SRR7171856_1.fastq
Paired file:	SRR7171856_2.fastq
trimmed:	SRR7171856-trimmed-pair1.fastq, SRR7171856-trimmed-pair2.fastq

Parameters used:
-- 3' end adapter sequence (-x):	AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y):	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r):	0.100
-- maximum indel error ratio allowed (-d):	0.030
-- end quality threshold (-q):		10
-- minimum read length allowed after trimming (-l):	18
-- file format (-f):		Sanger/Illumina 1.8+ FASTQ 
-- number of concurrent threads (-t):	20
Thu Feb 13 21:22:59 2025 >> started

Thu Feb 13 21:23:17 2025 >> done (18.324s)
16046513 read pairs processed; of these:
   17764 ( 0.11%) short read pairs filtered out after trimming by size control
   16149 ( 0.10%) empty read pairs filtered out after trimming by size control
16012600 (99.79%) read pairs available; of these:
 5256694 (32.83%) trimmed read pairs available after processing
10755906 (67.17%) untrimmed read pairs available after processing

Length distribution of reads after trimming:
length	count	percentage
 18	       2	  0.00%
 19	       2	  0.00%
 20	       3	  0.00%
 21	       4	  0.00%
 22	       1	  0.00%
 23	       5	  0.00%
 24	       8	  0.00%
 25	       3	  0.00%
 26	       6	  0.00%
 27	       7	  0.00%
 28	       4	  0.00%
 29	       1	  0.00%
 30	       3	  0.00%
 31	       3	  0.00%
 32	       5	  0.00%
 33	       4	  0.00%
 34	       9	  0.00%
 35	       6	  0.00%
 36	       6	  0.00%
 37	       8	  0.00%
 38	      13	  0.00%
 39	       7	  0.00%
 40	       6	  0.00%
 41	      12	  0.00%
 42	      16	  0.00%
 43	      42	  0.00%
 44	      11	  0.00%
 45	      15	  0.00%
 46	      20	  0.00%
 47	      76	  0.00%
 48	     110	  0.00%
 49	      30	  0.00%
 50	      25	  0.00%
 51	      33	  0.00%
 52	     103	  0.00%
 53	     113	  0.00%
 54	      99	  0.00%
 55	      60	  0.00%
 56	      94	  0.00%
 57	     113	  0.00%
 58	     146	  0.00%
 59	      95	  0.00%
 60	      88	  0.00%
 61	     122	  0.00%
 62	     116	  0.00%
 63	      91	  0.00%
 64	      99	  0.00%
 65	     123	  0.00%
 66	     146	  0.00%
 67	     150	  0.00%
 68	     176	  0.00%
 69	     257	  0.00%
 70	     251	  0.00%
 71	     280	  0.00%
 72	     311	  0.00%
 73	     366	  0.00%
 74	     440	  0.00%
 75	     509	  0.00%
 76	     655	  0.00%
 77	     700	  0.00%
 78	     714	  0.00%
 79	     746	  0.00%
 80	     862	  0.01%
 81	     968	  0.01%
 82	    1074	  0.01%
 83	    1299	  0.01%
 84	    2036	  0.01%
 85	    2729	  0.02%
 86	    3043	  0.02%
 87	    3225	  0.02%
 88	    3542	  0.02%
 89	    3693	  0.02%
 90	    3799	  0.02%
 91	    4001	  0.02%
 92	    4234	  0.03%
 93	    4496	  0.03%
 94	    4642	  0.03%
 95	    4814	  0.03%
 96	    5051	  0.03%
 97	    5341	  0.03%
 98	    5536	  0.03%
 99	    5630	  0.04%
100	    6204	  0.04%
101	    6475	  0.04%
102	    7050	  0.04%
103	    7403	  0.05%
104	    7820	  0.05%
105	    8234	  0.05%
106	    8705	  0.05%
107	    9067	  0.06%
108	    9483	  0.06%
109	    9956	  0.06%
110	   10735	  0.07%
111	   11234	  0.07%
112	   11676	  0.07%
113	   12548	  0.08%
114	   13100	  0.08%
115	   13865	  0.09%
116	   14593	  0.09%
117	   15020	  0.09%
118	   15697	  0.10%
119	   16758	  0.10%
120	   18255	  0.11%
121	   17976	  0.11%
122	   18599	  0.12%
123	   19037	  0.12%
124	   20382	  0.13%
125	   20909	  0.13%
126	   22104	  0.14%
127	   22987	  0.14%
128	   23919	  0.15%
129	   25472	  0.16%
130	   26572	  0.17%
131	   27722	  0.17%
132	   29502	  0.18%
133	   31513	  0.20%
134	   33335	  0.21%
135	   35391	  0.22%
136	   37723	  0.24%
137	   39934	  0.25%
138	   42877	  0.27%
139	   45702	  0.29%
140	   49219	  0.31%
141	   53901	  0.34%
142	   60002	  0.37%
143	   67859	  0.42%
144	   78943	  0.49%
145	   93566	  0.58%
146	  115798	  0.72%
147	  155878	  0.97%
148	  241217	  1.51%
149	  487174	  3.04%
150	 2999919	 18.73%
151	10755906	 67.17%
16012600 reads passed initial QC


criterion=sequence-density
sequence-density=0.13
sequence-density-rank=1
fanout-score=2.56
fanout-score-rank=32
prefix-density=0.13
prefix-fanout=2.6
sequence=GTGGACTCCTTCTGGAT


criterion=fanout-score
sequence-density=0.07
sequence-density-rank=31
fanout-score=379.74
fanout-score-rank=1
prefix-density=0.76
prefix-fanout=33.4
sequence=TCTTCTTCTTCCT


criterion=sequence-density
sequence-density=0.16
sequence-density-rank=1
fanout-score=2.55
fanout-score-rank=34
prefix-density=0.18
prefix-fanout=2.3
sequence=GGCAGTGGCTGCAA


criterion=fanout-score
sequence-density=0.08
sequence-density-rank=25
fanout-score=265.58
fanout-score-rank=1
prefix-density=0.86
prefix-fanout=23.9
sequence=AGAAGAAGAAAT
SRR7171856 testing PE reads STAR mapping to Ensembl genome
                                 Started job on |	Feb 13 21:24:16
                             Started mapping on |	Feb 13 21:24:16
                                    Finished on |	Feb 13 21:26:03
       Mapping speed, Million of reads per hour |	538.74

                          Number of input reads |	16012600
                      Average input read length |	298
                                    UNIQUE READS:
                   Uniquely mapped reads number |	15044984
                        Uniquely mapped reads % |	93.96%
                          Average mapped length |	297.23
                       Number of splices: Total |	15576515
            Number of splices: Annotated (sjdb) |	15313091
                       Number of splices: GT/AG |	15334019
                       Number of splices: GC/AG |	196963
                       Number of splices: AT/AC |	11209
               Number of splices: Non-canonical |	34324
                      Mismatch rate per base, % |	0.31%
                         Deletion rate per base |	0.03%
                        Deletion average length |	2.82
                        Insertion rate per base |	0.02%
                       Insertion average length |	2.50
                             MULTI-MAPPING READS:
        Number of reads mapped to multiple loci |	374938
             % of reads mapped to multiple loci |	2.34%
        Number of reads mapped to too many loci |	39001
             % of reads mapped to too many loci |	0.24%
                                  UNMAPPED READS:
       % of reads unmapped: too many mismatches |	0.00%
                 % of reads unmapped: too short |	3.41%
                     % of reads unmapped: other |	0.05%
                                  CHIMERIC READS:
                       Number of chimeric reads |	0
                            % of chimeric reads |	0.00%
N_unmapped	609904	609904	609904
N_multimapping	374938	374938	374938
N_noFeature	307670	14890727	386419
N_ambiguous	156744	1267	80431
UnstrandedReadsAssigned:14580570 PositiveStrandReadsAssigned:152990 NegativeStrandReadsAssigned:14578134
Dataset is classified negative stranded
MeadianReadLen=151 20thPercentileLength=151 echo kmer=147
SRR7171856 Starting Kallisto paired end mapping to ensembl reference transcriptome

[quant] fragment length distribution will be estimated from the data
[index] k-mer length: 31
[index] number of targets: 52,400
[index] number of k-mers: 62,057,036
[index] number of equivalence classes: 130,681
[quant] running in paired-end mode
[quant] will process pair 1: SRR7171856-trimmed-pair1.fastq
                             SRR7171856-trimmed-pair2.fastq
[quant] finding pseudoalignments for the reads ... done
[quant] processed 16,012,600 reads, 14,461,517 reads pseudoaligned
[quant] estimated average fragment length: 265.821
[   em] quantifying the abundances ... done
[   em] the Expectation-Maximization algorithm ran for 1,150 rounds

  52401 SRR7171856.ke.tsv
  34699 SRR7171856.se.tsv
  87100 total
==> SRR7171856.ke.tsv <==
target_id	length	eff_length	est_counts	tpm
Potri.005G200100.1.v4.1	2018	1753.18	757	27.1605
Potri.005G024800.1.v4.1	1035	770.179	113	9.22901
Potri.004G059700.1.v4.1	961	696.214	10	0.903494
Potri.007G009000.2.v4.1	1416	1151.18	0	0
Potri.003G141000.2.v4.1	2943	2678.18	375.098	8.80994
Potri.016G087400.1.v4.1	270	67.9658	1267	1172.61
Potri.015G069301.1.v4.1	564	304.774	0	0
Potri.010G195200.1.v4.1	1773	1508.18	110	4.58784
Potri.012G127500.1.v4.1	977	712.191	3236	285.812

==> SRR7171856.se.tsv <==
Potri.001G166300.v4.1	6
Potri.001G448400.v4.1	17
Potri.001G233950.v4.1	0
Potri.001G122700.v4.1	254
Potri.001G212900.v4.1	0
Potri.001G182400.v4.1	2
Potri.001G256600.v4.1	0
Potri.001G040500.v4.1	0
Potri.001G416900.v4.1	9
Potri.001G452600.v4.1	112
SRR7171856 completed mapping pipeline successfully
