Starting /dee2/code/volunteer_pipeline.sh SRR7171857 current disk space = 3088164356096 free memory = 1416596876 SRR7171857 SRAfilesize 8cf72a141e587fc9924e22416465d300 SRR7171857.sra SRR7171857.sra file validated SRR7171857 is paired end SRR7171857 is conventional basespace SRR7171857 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171857_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.77325 33.0 33.0 34.0 32.0 34.0 2 32.87675 34.0 33.0 34.0 32.0 34.0 3 31.9785 33.0 31.0 33.0 29.0 34.0 4 32.0565 33.0 32.0 33.0 31.0 34.0 5 32.295 33.0 33.0 33.0 31.0 34.0 6 36.0795 38.0 36.0 38.0 33.0 38.0 7 36.718 38.0 37.0 38.0 34.0 38.0 8 36.7595 38.0 37.0 38.0 34.0 38.0 9 37.2635 38.0 38.0 38.0 36.0 38.0 10-14 37.450250000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.522000000000006 38.0 38.0 38.0 37.6 38.0 20-24 37.4839 38.0 38.0 38.0 37.2 38.0 25-29 37.464349999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.442600000000006 38.0 38.0 38.0 37.4 38.0 35-39 37.403 38.0 38.0 38.0 37.0 38.0 40-44 37.334799999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.318 38.0 38.0 38.0 37.0 38.0 50-54 37.31605 38.0 38.0 38.0 37.0 38.0 55-59 37.264300000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.239549999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.19205 38.0 38.0 38.0 36.8 38.0 70-74 37.139050000000005 38.0 38.0 38.0 36.6 38.0 75-79 37.0644 38.0 38.0 38.0 36.0 38.0 80-84 36.9894 38.0 38.0 38.0 36.0 38.0 85-89 36.97995 38.0 38.0 38.0 36.0 38.0 90-94 36.941449999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.79965 38.0 38.0 38.0 35.2 38.0 100-104 36.73355 38.0 38.0 38.0 35.0 38.0 105-109 36.64545 38.0 38.0 38.0 34.6 38.0 110-114 36.49305 38.0 38.0 38.0 34.2 38.0 115-119 36.3953 38.0 38.0 38.0 34.0 38.0 120-124 36.29105 38.0 38.0 38.0 34.0 38.0 125-129 36.03145 38.0 37.6 38.0 33.0 38.0 130-134 35.89665 38.0 37.0 38.0 33.0 38.0 135-139 35.8435 38.0 37.2 38.0 33.0 38.0 140-144 35.63584999999999 38.0 36.0 38.0 33.0 38.0 145-149 35.306650000000005 38.0 36.0 38.0 31.0 38.0 150-151 32.65025 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 2.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 3.0 16 1.0 17 3.0 18 2.0 19 3.0 20 2.0 21 3.0 22 4.0 23 6.0 24 6.0 25 5.0 26 8.0 27 11.0 28 21.0 29 29.0 30 30.0 31 37.0 32 55.0 33 78.0 34 115.0 35 191.0 36 502.0 37 2875.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.36203319502075 14.83402489626556 11.903526970954356 38.90041493775934 2 19.1 19.5 33.125 28.275 3 19.45 24.875 25.324999999999996 30.349999999999998 4 23.150000000000002 31.374999999999996 22.575 22.900000000000002 5 21.349999999999998 35.5 22.725 20.424999999999997 6 18.875 34.449999999999996 26.8 19.875 7 14.424999999999999 24.975 42.25 18.35 8 17.325 23.849999999999998 32.25 26.575 9 18.15 24.525 33.900000000000006 23.425 10-14 19.585 30.15 27.450000000000003 22.814999999999998 15-19 19.185 29.310000000000002 27.83 23.674999999999997 20-24 19.564999999999998 29.4 27.97 23.064999999999998 25-29 19.45 29.23 27.965 23.355 30-34 19.935 28.335 28.425 23.305 35-39 19.435 28.849999999999998 28.115000000000002 23.599999999999998 40-44 19.81 28.735 28.15 23.305 45-49 19.24 29.244999999999997 27.97 23.544999999999998 50-54 19.73 28.965000000000003 27.944999999999997 23.36 55-59 19.955000000000002 28.715000000000003 27.735 23.595 60-64 19.71 29.099999999999998 27.73 23.46 65-69 19.945 28.265 28.57 23.22 70-74 19.605 28.155 28.249999999999996 23.990000000000002 75-79 19.935 28.82 27.62 23.625 80-84 20.41 27.85 28.485 23.255 85-89 20.0 28.235 28.060000000000002 23.705000000000002 90-94 19.75 28.444999999999997 27.744999999999997 24.060000000000002 95-99 20.27 28.055000000000003 28.075 23.599999999999998 100-104 20.015 28.189999999999998 28.205000000000002 23.59 105-109 20.5 27.875 28.005000000000003 23.62 110-114 20.24 28.075 28.000000000000004 23.685000000000002 115-119 20.855 27.775 27.889999999999997 23.48 120-124 20.349999999999998 28.235 27.72 23.695 125-129 20.585 27.79 27.58 24.044999999999998 130-134 20.9 28.34 27.765 22.994999999999997 135-139 20.474999999999998 27.62 27.87 24.035 140-144 20.43 28.28 27.715 23.575 145-149 20.455000000000002 28.044999999999998 27.83 23.669999999999998 150-151 21.25 28.625 26.525 23.599999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.5 23 2.0 24 2.5 25 3.5 26 6.0 27 10.0 28 15.0 29 20.0 30 23.0 31 35.0 32 49.5 33 54.5 34 60.5 35 74.0 36 92.0 37 112.0 38 148.5 39 188.0 40 207.5 41 223.5 42 232.5 43 244.0 44 268.0 45 281.0 46 274.0 47 250.0 48 220.0 49 184.0 50 151.0 51 126.5 52 91.5 53 74.0 54 66.0 55 46.5 56 40.0 57 30.5 58 18.0 59 12.0 60 8.0 61 8.0 62 6.0 63 6.0 64 7.0 65 4.0 66 3.0 67 3.5 68 2.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.4874999999999998 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 2.025 0.0 0.0 0.0 0.0 128-129 2.2249999999999996 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.7 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.2375 0.0 0.0 0.0 0.0 138-139 3.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAAAC 10 0.006832588 144.9875 9 AACAGTA 10 0.006832588 144.9875 7 ATACAAA 15 1.14152615E-4 144.9875 8 >>END_MODULE SRR7171857 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171857_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77325 33.0 33.0 34.0 32.0 34.0 2 32.8495 34.0 33.0 34.0 32.0 34.0 3 32.927 34.0 33.0 34.0 32.0 34.0 4 32.854 34.0 33.0 34.0 32.0 34.0 5 32.81625 34.0 33.0 34.0 32.0 34.0 6 36.98475 38.0 38.0 38.0 37.0 38.0 7 36.951 38.0 38.0 38.0 37.0 38.0 8 36.91675 38.0 38.0 38.0 37.0 38.0 9 36.94525 38.0 38.0 38.0 37.0 38.0 10-14 36.934400000000004 38.0 38.0 38.0 37.0 38.0 15-19 36.8562 38.0 38.0 38.0 37.0 38.0 20-24 36.7457 38.0 38.0 38.0 36.8 38.0 25-29 36.74720000000001 38.0 38.0 38.0 37.0 38.0 30-34 36.65495 38.0 38.0 38.0 36.6 38.0 35-39 36.63985 38.0 38.0 38.0 36.4 38.0 40-44 36.58055 38.0 38.0 38.0 36.0 38.0 45-49 36.671949999999995 38.0 38.0 38.0 36.2 38.0 50-54 36.63485 38.0 38.0 38.0 36.0 38.0 55-59 36.6571 38.0 38.0 38.0 36.0 38.0 60-64 36.6389 38.0 38.0 38.0 36.0 38.0 65-69 36.52605 38.0 38.0 38.0 36.0 38.0 70-74 36.48485000000001 38.0 38.0 38.0 35.4 38.0 75-79 36.45955 38.0 38.0 38.0 35.2 38.0 80-84 36.3881 38.0 38.0 38.0 34.8 38.0 85-89 36.25149999999999 38.0 38.0 38.0 34.6 38.0 90-94 36.1612 38.0 38.0 38.0 34.0 38.0 95-99 36.1407 38.0 38.0 38.0 34.2 38.0 100-104 35.9452 38.0 38.0 38.0 34.0 38.0 105-109 35.82645 38.0 38.0 38.0 33.6 38.0 110-114 35.8307 38.0 38.0 38.0 33.4 38.0 115-119 35.69695 38.0 38.0 38.0 33.0 38.0 120-124 35.501050000000006 38.0 37.0 38.0 32.0 38.0 125-129 35.323350000000005 38.0 37.0 38.0 31.0 38.0 130-134 35.0573 38.0 36.0 38.0 29.4 38.0 135-139 34.843050000000005 38.0 36.0 38.0 28.0 38.0 140-144 34.336400000000005 38.0 35.2 38.0 25.2 38.0 145-149 34.00985 38.0 35.0 38.0 24.0 38.0 150-151 30.777375 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 5.0 4 12.0 5 2.0 6 3.0 7 2.0 8 1.0 9 4.0 10 2.0 11 7.0 12 5.0 13 2.0 14 4.0 15 5.0 16 3.0 17 3.0 18 3.0 19 6.0 20 5.0 21 1.0 22 7.0 23 8.0 24 11.0 25 17.0 26 13.0 27 22.0 28 33.0 29 34.0 30 27.0 31 44.0 32 53.0 33 78.0 34 105.0 35 186.0 36 498.0 37 2763.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.265214124718256 19.058352116203356 17.756073127973952 25.920360631104433 2 25.175175175175173 25.025025025025027 31.08108108108108 18.71871871871872 3 21.010505252626313 29.189594797398698 29.789894947473737 20.01000500250125 4 25.85646411602901 33.033258314578646 22.155538884721178 18.95473868467117 5 24.16208104052026 36.76838419209605 21.335667833916958 17.733866933466732 6 19.650000000000002 37.1 23.724999999999998 19.525000000000002 7 19.45 19.8 39.775 20.974999999999998 8 21.95 23.65 27.275 27.125 9 22.55 25.3 28.000000000000004 24.15 10-14 23.50117505875294 28.311415570778536 26.491324566228315 21.69608480424021 15-19 23.520584262918312 27.957580911410133 27.55740083037367 20.964433995297885 20-24 23.399458972046887 28.589319707444144 27.07644524596734 20.934776074541627 25-29 23.34720064157185 28.730389454162697 26.840759861661066 21.08165004260438 30-34 23.09234934322671 28.852902837661688 27.228516995888903 20.8262308232227 35-39 22.847399829497018 29.23123213479765 26.708790933253095 21.212577102452236 40-44 23.320633647483458 28.794866653298577 27.200721876879886 20.68377782233808 45-49 23.577724358974358 28.26522435897436 27.48397435897436 20.673076923076923 50-54 23.615627032164475 27.90255615026762 27.5423940773348 20.939422740233105 55-59 23.44054824671102 28.65789605322395 26.93211945375419 20.969436246310842 60-64 24.0998199639928 28.220644128825768 27.345469093818764 20.33406681336267 65-69 23.60618030901545 28.576428821441073 26.916345817290864 20.901045052252613 70-74 23.84 28.355000000000004 27.415 20.39 75-79 23.805 27.735 27.55 20.91 80-84 23.915 28.305000000000003 27.015 20.765 85-89 23.669999999999998 28.689999999999998 27.62 20.02 90-94 24.14 28.04 27.235 20.585 95-99 23.52 28.03 27.034999999999997 21.415 100-104 24.165 27.655 27.834999999999997 20.345 105-109 23.52 28.144999999999996 27.72 20.615 110-114 23.849999999999998 28.035 27.615000000000002 20.5 115-119 24.085 27.650000000000002 27.750000000000004 20.515 120-124 23.47 28.4 27.339999999999996 20.79 125-129 23.515 28.83 27.525 20.13 130-134 24.51 27.325 27.82 20.345 135-139 23.96 28.48 27.355 20.205000000000002 140-144 23.96 27.955000000000002 28.17 19.915 145-149 24.66 27.725 27.575 20.04 150-151 24.575 27.875 28.6125 18.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 2.0 21 1.0 22 1.5 23 1.5 24 0.5 25 1.5 26 3.5 27 2.5 28 5.0 29 10.5 30 10.0 31 12.0 32 20.0 33 24.0 34 36.5 35 63.5 36 81.5 37 99.0 38 131.0 39 178.0 40 193.0 41 196.5 42 233.0 43 261.5 44 291.5 45 297.5 46 293.5 47 268.5 48 224.5 49 210.5 50 184.5 51 146.5 52 123.0 53 100.5 54 77.5 55 59.5 56 40.5 57 26.0 58 18.0 59 17.5 60 14.5 61 8.5 62 4.5 63 4.5 64 5.0 65 3.0 66 1.0 67 0.5 68 2.0 69 2.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.1 3 0.05 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.045 20-24 0.19 25-29 0.245 30-34 0.27 35-39 0.295 40-44 0.26 45-49 0.16 50-54 0.045 55-59 0.045 60-64 0.02 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.2761737383881496 0.5499999999999999 3 0.07532011046949535 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.9625 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.4874999999999998 0.0 0.0 0.0 0.0 124-125 1.7 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.425 0.0 0.0 0.0 0.0 132-133 2.675 0.0 0.0 0.0 0.0 134-135 3.0125 0.0 0.0 0.0 0.0 136-137 3.2249999999999996 0.0 0.0 0.0 0.0 138-139 3.5374999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620615 spots for SRR7171857.sra Written 620615 spots for SRR7171857.sra Read 620622 spots for SRR7171857.sra Written 620622 spots for SRR7171857.sra SRR ids: ['SRR7171857.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gc92mizf SRR7171857.sra spots: 12412307 blocks: [[1, 620615], [620616, 1241230], [1241231, 1861845], [1861846, 2482460], [2482461, 3103075], [3103076, 3723690], [3723691, 4344305], [4344306, 4964920], [4964921, 5585535], [5585536, 6206150], [6206151, 6826765], [6826766, 7447380], [7447381, 8067995], [8067996, 8688610], [8688611, 9309225], [9309226, 9929840], [9929841, 10550455], [10550456, 11171070], [11171071, 11791685], [11791686, 12412307]] SRR7171857 file size 4184423 SRR7171857 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171857 SRR7171857_1.fastq SRR7171857_2.fastq Input file: SRR7171857_1.fastq Paired file: SRR7171857_2.fastq trimmed: SRR7171857-trimmed-pair1.fastq, SRR7171857-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:26:29 2025 >> started Thu Feb 13 21:26:50 2025 >> done (20.959s) 12412307 read pairs processed; of these: 39041 ( 0.31%) short read pairs filtered out after trimming by size control 33963 ( 0.27%) empty read pairs filtered out after trimming by size control 12339303 (99.41%) read pairs available; of these: 4185494 (33.92%) trimmed read pairs available after processing 8153809 (66.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 3 0.00% 21 2 0.00% 22 5 0.00% 23 10 0.00% 24 8 0.00% 25 8 0.00% 26 15 0.00% 27 7 0.00% 28 7 0.00% 29 10 0.00% 30 7 0.00% 31 13 0.00% 32 5 0.00% 33 8 0.00% 34 10 0.00% 35 10 0.00% 36 8 0.00% 37 11 0.00% 38 13 0.00% 39 12 0.00% 40 14 0.00% 41 16 0.00% 42 13 0.00% 43 29 0.00% 44 22 0.00% 45 34 0.00% 46 20 0.00% 47 56 0.00% 48 98 0.00% 49 30 0.00% 50 27 0.00% 51 32 0.00% 52 76 0.00% 53 103 0.00% 54 96 0.00% 55 52 0.00% 56 60 0.00% 57 90 0.00% 58 118 0.00% 59 63 0.00% 60 64 0.00% 61 100 0.00% 62 74 0.00% 63 85 0.00% 64 75 0.00% 65 114 0.00% 66 112 0.00% 67 123 0.00% 68 155 0.00% 69 160 0.00% 70 215 0.00% 71 214 0.00% 72 247 0.00% 73 308 0.00% 74 315 0.00% 75 382 0.00% 76 570 0.00% 77 498 0.00% 78 559 0.00% 79 616 0.00% 80 669 0.01% 81 744 0.01% 82 863 0.01% 83 1062 0.01% 84 2554 0.02% 85 3960 0.03% 86 3997 0.03% 87 4349 0.04% 88 4352 0.04% 89 4201 0.03% 90 4478 0.04% 91 4454 0.04% 92 4485 0.04% 93 4742 0.04% 94 4804 0.04% 95 4786 0.04% 96 4971 0.04% 97 5217 0.04% 98 5423 0.04% 99 5800 0.05% 100 6160 0.05% 101 6425 0.05% 102 6806 0.06% 103 7225 0.06% 104 7655 0.06% 105 7873 0.06% 106 8390 0.07% 107 8704 0.07% 108 9165 0.07% 109 9836 0.08% 110 10568 0.09% 111 11151 0.09% 112 11774 0.10% 113 12387 0.10% 114 12997 0.11% 115 13921 0.11% 116 14568 0.12% 117 14882 0.12% 118 15549 0.13% 119 16526 0.13% 120 17833 0.14% 121 18013 0.15% 122 18225 0.15% 123 19416 0.16% 124 20450 0.17% 125 20574 0.17% 126 21478 0.17% 127 22732 0.18% 128 23269 0.19% 129 24506 0.20% 130 25660 0.21% 131 26572 0.22% 132 27980 0.23% 133 29597 0.24% 134 31293 0.25% 135 32951 0.27% 136 35023 0.28% 137 37282 0.30% 138 38677 0.31% 139 41607 0.34% 140 44096 0.36% 141 47694 0.39% 142 52508 0.43% 143 58166 0.47% 144 66922 0.54% 145 77433 0.63% 146 94215 0.76% 147 124204 1.01% 148 184225 1.49% 149 362707 2.94% 150 2245500 18.20% 151 8153809 66.08% 12339303 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=5.20 fanout-score-rank=25 prefix-density=0.96 prefix-fanout=3.0 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=71.53 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.5 sequence=CAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACTTGTAA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=5.84 fanout-score-rank=21 prefix-density=1.16 prefix-fanout=2.2 sequence=TGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=132.75 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=12.6 sequence=AGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAG SRR7171857 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:27:46 Started mapping on | Feb 13 21:27:46 Finished on | Feb 13 21:30:00 Mapping speed, Million of reads per hour | 331.50 Number of input reads | 12339303 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11382188 Uniquely mapped reads % | 92.24% Average mapped length | 296.26 Number of splices: Total | 10448585 Number of splices: Annotated (sjdb) | 10208318 Number of splices: GT/AG | 10273175 Number of splices: GC/AG | 133394 Number of splices: AT/AC | 9306 Number of splices: Non-canonical | 32710 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295469 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 39239 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.96% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 695299 695299 695299 N_multimapping 295469 295469 295469 N_noFeature 340675 11231461 420170 N_ambiguous 137970 970 66178 UnstrandedReadsAssigned:10903543 PositiveStrandReadsAssigned:149757 NegativeStrandReadsAssigned:10895840 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171857 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171857-trimmed-pair1.fastq SRR7171857-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,339,303 reads, 10,851,359 reads pseudoaligned [quant] estimated average fragment length: 249.306 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR7171857.ke.tsv 34699 SRR7171857.se.tsv 87100 total ==> SRR7171857.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.69 802 34.9782 Potri.005G024800.1.v4.1 1035 786.694 169 16.5807 Potri.004G059700.1.v4.1 961 712.706 36 3.89864 Potri.007G009000.2.v4.1 1416 1167.69 0 0 Potri.003G141000.2.v4.1 2943 2694.69 319 9.13698 Potri.016G087400.1.v4.1 270 71.4417 1137 1228.37 Potri.015G069301.1.v4.1 564 319.264 0 0 Potri.010G195200.1.v4.1 1773 1524.69 249 12.6049 Potri.012G127500.1.v4.1 977 728.706 9699 1027.3 ==> SRR7171857.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 153 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 346 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 356 SRR7171857 completed mapping pipeline successfully