Starting /dee2/code/volunteer_pipeline.sh SRR7171859 current disk space = 3088505450496 free memory = 1580106964 SRR7171859 SRAfilesize 8aa35e417226846ae7529fb43d27772c SRR7171859.sra SRR7171859.sra file validated SRR7171859 is paired end SRR7171859 is conventional basespace SRR7171859 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171859_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.71025 33.0 33.0 34.0 32.0 34.0 2 32.87225 34.0 33.0 34.0 32.0 34.0 3 32.15275 33.0 33.0 34.0 29.0 34.0 4 32.83725 33.0 33.0 34.0 32.0 34.0 5 33.02775 33.0 33.0 34.0 32.0 34.0 6 36.665 38.0 37.0 38.0 34.0 38.0 7 37.169 38.0 38.0 38.0 36.0 38.0 8 37.37625 38.0 38.0 38.0 37.0 38.0 9 37.481 38.0 38.0 38.0 37.0 38.0 10-14 37.55135 38.0 38.0 38.0 37.8 38.0 15-19 37.5338 38.0 38.0 38.0 37.8 38.0 20-24 37.487899999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.5046 38.0 38.0 38.0 37.2 38.0 30-34 37.4992 38.0 38.0 38.0 37.6 38.0 35-39 37.50555 38.0 38.0 38.0 37.4 38.0 40-44 37.44955 38.0 38.0 38.0 37.0 38.0 45-49 37.41775 38.0 38.0 38.0 37.0 38.0 50-54 37.38779999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.341899999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.310500000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.27605 38.0 38.0 38.0 37.0 38.0 70-74 37.208149999999996 38.0 38.0 38.0 36.6 38.0 75-79 37.151 38.0 38.0 38.0 36.2 38.0 80-84 37.13565000000001 38.0 38.0 38.0 36.0 38.0 85-89 37.0726 38.0 38.0 38.0 36.0 38.0 90-94 36.963750000000005 38.0 38.0 38.0 35.8 38.0 95-99 36.9116 38.0 38.0 38.0 35.8 38.0 100-104 36.879200000000004 38.0 38.0 38.0 35.4 38.0 105-109 36.7292 38.0 38.0 38.0 34.8 38.0 110-114 36.6309 38.0 38.0 38.0 34.4 38.0 115-119 36.563250000000004 38.0 38.0 38.0 34.2 38.0 120-124 36.473349999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.05785 38.0 37.4 38.0 33.0 38.0 130-134 35.97375 38.0 37.2 38.0 33.0 38.0 135-139 35.92915 38.0 37.0 38.0 33.0 38.0 140-144 35.7846 38.0 36.0 38.0 33.0 38.0 145-149 35.3113 38.0 36.0 38.0 31.2 38.0 150-151 32.754625 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 2.0 21 2.0 22 4.0 23 7.0 24 6.0 25 4.0 26 13.0 27 14.0 28 22.0 29 21.0 30 38.0 31 45.0 32 40.0 33 65.0 34 111.0 35 204.0 36 525.0 37 2873.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.098958333333336 14.921875000000002 11.041666666666666 40.9375 2 17.549999999999997 22.225 33.275 26.950000000000003 3 19.975 26.150000000000002 24.474999999999998 29.4 4 22.0 34.449999999999996 21.175 22.375 5 20.4 35.425000000000004 24.55 19.625 6 17.8 37.1 24.25 20.849999999999998 7 13.675 22.55 43.325 20.45 8 18.4 22.5 29.2 29.9 9 18.825 22.1 32.9 26.174999999999997 10-14 19.545 29.459999999999997 27.11 23.885 15-19 19.744999999999997 28.144999999999996 27.67 24.44 20-24 19.725 28.810000000000002 28.12 23.345 25-29 19.82 29.025000000000002 27.145000000000003 24.01 30-34 19.845 28.634999999999998 27.525 23.995 35-39 19.975 28.595 28.000000000000004 23.43 40-44 19.925 28.505000000000003 27.950000000000003 23.62 45-49 19.6 28.110000000000003 28.21 24.08 50-54 20.115 28.425 27.62 23.84 55-59 20.095 27.55 28.33 24.025 60-64 19.580000000000002 28.875 27.52 24.025 65-69 20.095 28.17 27.77 23.965 70-74 19.99 27.57 28.27 24.169999999999998 75-79 20.055 27.944999999999997 28.060000000000002 23.94 80-84 20.455000000000002 27.715 27.744999999999997 24.085 85-89 20.175 28.189999999999998 27.900000000000002 23.735 90-94 20.044999999999998 28.615000000000002 27.315 24.025 95-99 20.74 27.74 28.084999999999997 23.435 100-104 20.78 28.395 27.185 23.64 105-109 20.169999999999998 27.955000000000002 27.860000000000003 24.015 110-114 20.365 28.1 27.61 23.925 115-119 20.4 27.894999999999996 28.244999999999997 23.46 120-124 20.669999999999998 27.800000000000004 28.075 23.455000000000002 125-129 20.635 27.145000000000003 28.23 23.990000000000002 130-134 20.715 28.494999999999997 26.735 24.055 135-139 20.41 28.134999999999998 27.450000000000003 24.005000000000003 140-144 20.580000000000002 28.01 27.49 23.919999999999998 145-149 20.505000000000003 27.595 27.72 24.18 150-151 20.8875 27.3375 27.8125 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 2.0 24 2.5 25 3.5 26 7.5 27 11.0 28 13.5 29 18.0 30 20.5 31 20.5 32 32.0 33 47.5 34 57.5 35 74.0 36 91.5 37 109.0 38 123.0 39 145.5 40 182.0 41 228.5 42 258.0 43 268.0 44 280.0 45 271.5 46 252.5 47 243.0 48 226.5 49 192.5 50 149.5 51 126.0 52 116.5 53 108.5 54 84.0 55 51.5 56 40.5 57 30.0 58 22.5 59 18.0 60 16.0 61 15.0 62 12.0 63 7.0 64 5.0 65 4.0 66 1.5 67 1.0 68 2.5 69 3.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.2 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.5125000000000002 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.8875 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.225 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATCTC 10 0.0068343505 144.975 6 >>END_MODULE SRR7171859 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171859_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8425 33.0 33.0 34.0 32.0 34.0 2 32.98475 34.0 33.0 34.0 32.0 34.0 3 33.067 34.0 33.0 34.0 32.0 34.0 4 32.953 34.0 33.0 34.0 32.0 34.0 5 33.0335 34.0 33.0 34.0 32.0 34.0 6 37.15075 38.0 38.0 38.0 37.0 38.0 7 37.104 38.0 38.0 38.0 37.0 38.0 8 37.1325 38.0 38.0 38.0 37.0 38.0 9 37.12475 38.0 38.0 38.0 37.0 38.0 10-14 37.144 38.0 38.0 38.0 37.0 38.0 15-19 37.07790000000001 38.0 38.0 38.0 36.8 38.0 20-24 36.9915 38.0 38.0 38.0 36.8 38.0 25-29 36.9608 38.0 38.0 38.0 36.4 38.0 30-34 36.94725 38.0 38.0 38.0 36.8 38.0 35-39 36.865700000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.8607 38.0 38.0 38.0 36.2 38.0 45-49 36.92595 38.0 38.0 38.0 36.0 38.0 50-54 36.91175 38.0 38.0 38.0 36.0 38.0 55-59 36.8625 38.0 38.0 38.0 36.0 38.0 60-64 36.82655 38.0 38.0 38.0 36.0 38.0 65-69 36.79785 38.0 38.0 38.0 35.8 38.0 70-74 36.68945000000001 38.0 38.0 38.0 35.6 38.0 75-79 36.6485 38.0 38.0 38.0 35.4 38.0 80-84 36.6231 38.0 38.0 38.0 35.2 38.0 85-89 36.549400000000006 38.0 38.0 38.0 35.0 38.0 90-94 36.409850000000006 38.0 38.0 38.0 34.2 38.0 95-99 36.38695 38.0 38.0 38.0 34.0 38.0 100-104 36.2267 38.0 38.0 38.0 34.0 38.0 105-109 36.0998 38.0 38.0 38.0 33.6 38.0 110-114 36.00005 38.0 38.0 38.0 33.4 38.0 115-119 35.8517 38.0 37.2 38.0 32.6 38.0 120-124 35.7639 38.0 37.0 38.0 32.4 38.0 125-129 35.571250000000006 38.0 36.4 38.0 31.6 38.0 130-134 35.31139999999999 38.0 36.0 38.0 30.4 38.0 135-139 35.05585 38.0 36.0 38.0 29.0 38.0 140-144 34.6699 38.0 35.0 38.0 27.8 38.0 145-149 34.10055 38.0 35.0 38.0 23.8 38.0 150-151 31.089624999999998 36.5 31.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 8.0 5 5.0 6 4.0 7 2.0 8 0.0 9 3.0 10 1.0 11 4.0 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 1.0 18 2.0 19 1.0 20 1.0 21 5.0 22 7.0 23 12.0 24 11.0 25 7.0 26 24.0 27 21.0 28 29.0 29 31.0 30 39.0 31 51.0 32 69.0 33 76.0 34 141.0 35 241.0 36 535.0 37 2654.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.84342171085543 16.783391695847925 16.783391695847925 29.589794897448723 2 24.831207801950487 23.655913978494624 35.13378344586147 16.379094773693424 3 22.83070767691923 26.38159539884971 30.90772693173293 19.879969992498125 4 24.224999999999998 34.825 22.1 18.85 5 24.281070267566893 36.58414603650913 21.85546386596649 17.27931982995749 6 19.725 38.7 23.400000000000002 18.175 7 18.7 17.675 42.775 20.849999999999998 8 21.95 22.650000000000002 26.674999999999997 28.725 9 23.35 24.825 27.05 24.775 10-14 23.86 29.39 25.779999999999998 20.97 15-19 22.83728372837284 28.28282828282828 28.03780378037804 20.842084208420843 20-24 22.89988492520138 28.21834192224946 28.02821834192225 20.853554810626907 25-29 23.936329962959256 28.3411752928221 27.23495845429973 20.48753628991891 30-34 23.08000400520677 28.537098227696006 27.50075097626915 20.882146790828077 35-39 23.304617850345586 28.43834518681759 27.436642291896224 20.820394670940598 40-44 23.691984178641164 28.643668953086664 26.931357332398736 20.73298953587343 45-49 23.35317361076377 27.734707147501624 28.104836692842493 20.80728254889211 50-54 23.522352235223522 28.227822782278228 27.682768276827684 20.567056705670566 55-59 23.557355735573555 28.172817281728175 27.782778277827784 20.487048704870485 60-64 23.50117505875294 28.30641532076604 27.471373568678437 20.721036051802592 65-69 23.416170808540425 28.32641632081604 27.66638331916596 20.591029551477575 70-74 23.265 28.26 27.775 20.7 75-79 23.705000000000002 27.855 27.74 20.7 80-84 23.48 27.955000000000002 27.845 20.72 85-89 24.05 27.79 27.43 20.73 90-94 23.84 28.355000000000004 27.145000000000003 20.66 95-99 23.94 27.889999999999997 27.82 20.349999999999998 100-104 24.04 27.83 27.435 20.695 105-109 24.099999999999998 27.950000000000003 27.935 20.015 110-114 24.075 27.815 27.584999999999997 20.525 115-119 23.765 28.310000000000002 27.525 20.4 120-124 24.060000000000002 27.35 27.625 20.965 125-129 24.185000000000002 27.339999999999996 28.54 19.935 130-134 24.154999999999998 28.605000000000004 27.644999999999996 19.595000000000002 135-139 24.14 28.34 27.134999999999998 20.385 140-144 23.95 27.765 27.73 20.555 145-149 24.45 27.715 27.900000000000002 19.935 150-151 24.224999999999998 27.875 27.737499999999997 20.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 1.5 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 3.5 26 4.5 27 5.5 28 10.0 29 12.5 30 9.0 31 15.0 32 23.0 33 29.5 34 46.5 35 64.5 36 80.0 37 96.5 38 124.5 39 169.5 40 208.5 41 240.0 42 251.5 43 277.0 44 293.5 45 275.0 46 254.5 47 232.5 48 221.5 49 202.0 50 168.5 51 132.5 52 122.5 53 105.0 54 73.0 55 57.0 56 44.5 57 35.5 58 27.0 59 19.5 60 15.5 61 11.5 62 8.0 63 5.0 64 3.5 65 4.0 66 2.5 67 1.5 68 1.5 69 0.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.065 25-29 0.11 30-34 0.13 35-39 0.16999999999999998 40-44 0.135 45-49 0.034999999999999996 50-54 0.01 55-59 0.01 60-64 0.005 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.6124999999999998 0.0 0.0 0.0 0.0 132-133 1.8125 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.1 0.0 0.0 0.0 0.0 138-139 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCAGC 10 0.00686971 144.72499 8 >>END_MODULE Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762963 spots for SRR7171859.sra Written 762963 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra Read 762945 spots for SRR7171859.sra Written 762945 spots for SRR7171859.sra SRR ids: ['SRR7171859.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wybwdq46 SRR7171859.sra spots: 15258918 blocks: [[1, 762945], [762946, 1525890], [1525891, 2288835], [2288836, 3051780], [3051781, 3814725], [3814726, 4577670], [4577671, 5340615], [5340616, 6103560], [6103561, 6866505], [6866506, 7629450], [7629451, 8392395], [8392396, 9155340], [9155341, 9918285], [9918286, 10681230], [10681231, 11444175], [11444176, 12207120], [12207121, 12970065], [12970066, 13733010], [13733011, 14495955], [14495956, 15258918]] SRR7171859 file size 5149046 SRR7171859 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171859 SRR7171859_1.fastq SRR7171859_2.fastq Input file: SRR7171859_1.fastq Paired file: SRR7171859_2.fastq trimmed: SRR7171859-trimmed-pair1.fastq, SRR7171859-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:51:39 2025 >> started Thu Feb 13 21:51:56 2025 >> done (17.169s) 15258918 read pairs processed; of these: 17417 ( 0.11%) short read pairs filtered out after trimming by size control 13255 ( 0.09%) empty read pairs filtered out after trimming by size control 15228246 (99.80%) read pairs available; of these: 5037713 (33.08%) trimmed read pairs available after processing 10190533 (66.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 5 0.00% 23 2 0.00% 24 4 0.00% 25 0 0.00% 26 6 0.00% 27 4 0.00% 28 2 0.00% 29 3 0.00% 30 1 0.00% 31 1 0.00% 32 2 0.00% 33 0 0.00% 34 3 0.00% 35 2 0.00% 36 6 0.00% 37 5 0.00% 38 9 0.00% 39 11 0.00% 40 3 0.00% 41 13 0.00% 42 10 0.00% 43 25 0.00% 44 15 0.00% 45 11 0.00% 46 17 0.00% 47 57 0.00% 48 103 0.00% 49 14 0.00% 50 18 0.00% 51 31 0.00% 52 86 0.00% 53 96 0.00% 54 66 0.00% 55 41 0.00% 56 61 0.00% 57 99 0.00% 58 108 0.00% 59 59 0.00% 60 46 0.00% 61 83 0.00% 62 57 0.00% 63 41 0.00% 64 60 0.00% 65 65 0.00% 66 77 0.00% 67 95 0.00% 68 93 0.00% 69 112 0.00% 70 127 0.00% 71 123 0.00% 72 137 0.00% 73 167 0.00% 74 266 0.00% 75 288 0.00% 76 348 0.00% 77 343 0.00% 78 393 0.00% 79 439 0.00% 80 437 0.00% 81 494 0.00% 82 576 0.00% 83 700 0.00% 84 1454 0.01% 85 2042 0.01% 86 2017 0.01% 87 2118 0.01% 88 2233 0.01% 89 2335 0.02% 90 2410 0.02% 91 2498 0.02% 92 2635 0.02% 93 2823 0.02% 94 2951 0.02% 95 3117 0.02% 96 3334 0.02% 97 3711 0.02% 98 3670 0.02% 99 3925 0.03% 100 4205 0.03% 101 4431 0.03% 102 4933 0.03% 103 5090 0.03% 104 5624 0.04% 105 5874 0.04% 106 6305 0.04% 107 6654 0.04% 108 7118 0.05% 109 7471 0.05% 110 8096 0.05% 111 8605 0.06% 112 9084 0.06% 113 9618 0.06% 114 10332 0.07% 115 10886 0.07% 116 11513 0.08% 117 12024 0.08% 118 12577 0.08% 119 13547 0.09% 120 15031 0.10% 121 15172 0.10% 122 15093 0.10% 123 16185 0.11% 124 17344 0.11% 125 17924 0.12% 126 18858 0.12% 127 19887 0.13% 128 20449 0.13% 129 21825 0.14% 130 22932 0.15% 131 24235 0.16% 132 26016 0.17% 133 27678 0.18% 134 29543 0.19% 135 31592 0.21% 136 33858 0.22% 137 36504 0.24% 138 39496 0.26% 139 42379 0.28% 140 46221 0.30% 141 51019 0.34% 142 56389 0.37% 143 64995 0.43% 144 76573 0.50% 145 91317 0.60% 146 112717 0.74% 147 155054 1.02% 148 239041 1.57% 149 485564 3.19% 150 2952987 19.39% 151 10190533 66.92% 15228246 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=24 prefix-density=0.30 prefix-fanout=2.4 sequence=AGTTCATCTCAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=29.97 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.0 sequence=AGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=26 prefix-density=0.46 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=24 fanout-score=24.91 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=8.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171859 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:52:48 Started mapping on | Feb 13 21:52:49 Finished on | Feb 13 21:55:33 Mapping speed, Million of reads per hour | 334.28 Number of input reads | 15228246 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13816779 Uniquely mapped reads % | 90.73% Average mapped length | 297.73 Number of splices: Total | 13276228 Number of splices: Annotated (sjdb) | 12992767 Number of splices: GT/AG | 13065680 Number of splices: GC/AG | 163474 Number of splices: AT/AC | 9895 Number of splices: Non-canonical | 37179 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304635 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 41267 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.92% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1122101 1122101 1122101 N_multimapping 304635 304635 304635 N_noFeature 402295 13667852 471266 N_ambiguous 160298 786 79864 UnstrandedReadsAssigned:13254186 PositiveStrandReadsAssigned:148141 NegativeStrandReadsAssigned:13265649 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171859 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171859-trimmed-pair1.fastq SRR7171859-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,228,246 reads, 13,129,827 reads pseudoaligned [quant] estimated average fragment length: 266.185 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7171859.ke.tsv 34699 SRR7171859.se.tsv 87100 total ==> SRR7171859.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.81 2058 86.0358 Potri.005G024800.1.v4.1 1035 769.815 1551 147.637 Potri.004G059700.1.v4.1 961 695.855 4 0.421222 Potri.007G009000.2.v4.1 1416 1150.81 0 0 Potri.003G141000.2.v4.1 2943 2677.81 778.238 21.2962 Potri.016G087400.1.v4.1 270 65.2463 733 823.224 Potri.015G069301.1.v4.1 564 304.143 0 0 Potri.010G195200.1.v4.1 1773 1507.81 547.925 26.6283 Potri.012G127500.1.v4.1 977 711.844 4254 437.907 ==> SRR7171859.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 413 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 337 SRR7171859 completed mapping pipeline successfully