Starting /dee2/code/volunteer_pipeline.sh SRR7171860 current disk space = 3088591339520 free memory = 1575818864 SRR7171860 SRAfilesize fdb76d46d453e8353cc94dc3d45cc400 SRR7171860.sra SRR7171860.sra file validated SRR7171860 is paired end SRR7171860 is conventional basespace SRR7171860 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171860_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.02625 33.0 33.0 34.0 32.0 34.0 2 32.85025 34.0 33.0 34.0 32.0 34.0 3 32.70275 33.0 33.0 34.0 31.0 34.0 4 32.24625 33.0 32.0 33.0 31.0 34.0 5 32.66675 33.0 33.0 33.0 32.0 34.0 6 36.6425 38.0 37.0 38.0 34.0 38.0 7 36.72675 38.0 37.0 38.0 34.0 38.0 8 37.3435 38.0 38.0 38.0 37.0 38.0 9 37.512 38.0 38.0 38.0 37.0 38.0 10-14 37.48395000000001 38.0 38.0 38.0 37.4 38.0 15-19 37.5321 38.0 38.0 38.0 38.0 38.0 20-24 37.5 38.0 38.0 38.0 38.0 38.0 25-29 37.488299999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.479 38.0 38.0 38.0 38.0 38.0 35-39 37.4067 38.0 38.0 38.0 37.4 38.0 40-44 37.4037 38.0 38.0 38.0 37.0 38.0 45-49 37.32 38.0 38.0 38.0 37.0 38.0 50-54 37.313100000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.271049999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.21275 38.0 38.0 38.0 37.0 38.0 65-69 37.193349999999995 38.0 38.0 38.0 36.8 38.0 70-74 37.1602 38.0 38.0 38.0 36.2 38.0 75-79 37.11409999999999 38.0 38.0 38.0 36.2 38.0 80-84 37.089800000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.029799999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.9653 38.0 38.0 38.0 36.0 38.0 95-99 36.86035 38.0 38.0 38.0 35.8 38.0 100-104 36.8394 38.0 38.0 38.0 35.4 38.0 105-109 36.6748 38.0 38.0 38.0 34.8 38.0 110-114 36.5878 38.0 38.0 38.0 34.2 38.0 115-119 36.466750000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.43215 38.0 38.0 38.0 34.0 38.0 125-129 36.09185 38.0 37.6 38.0 33.0 38.0 130-134 35.9342 38.0 37.0 38.0 33.0 38.0 135-139 35.91885 38.0 37.2 38.0 32.8 38.0 140-144 35.667950000000005 38.0 36.0 38.0 32.2 38.0 145-149 35.2225 38.0 36.0 38.0 31.0 38.0 150-151 32.4945 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 1.0 11 1.0 12 2.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 7.0 22 5.0 23 6.0 24 5.0 25 12.0 26 8.0 27 10.0 28 26.0 29 28.0 30 31.0 31 51.0 32 51.0 33 61.0 34 106.0 35 212.0 36 458.0 37 2913.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.951596292481977 15.550978372811535 11.277033985581875 41.22039134912461 2 17.625 20.474999999999998 31.624999999999996 30.275000000000002 3 18.075 25.025 24.525 32.375 4 21.475 31.724999999999998 21.55 25.25 5 21.2 34.725 24.025 20.05 6 18.0 36.8 25.275 19.925 7 13.125 23.175 44.25 19.45 8 16.950000000000003 25.424999999999997 30.599999999999998 27.025 9 17.5 24.925 33.650000000000006 23.925 10-14 18.335 30.385 27.474999999999998 23.805 15-19 19.13 29.23 27.99 23.65 20-24 18.92 29.165000000000003 27.884999999999998 24.03 25-29 19.215 29.015 28.24 23.53 30-34 19.650000000000002 29.195 27.689999999999998 23.465 35-39 18.64 28.71 27.97 24.68 40-44 19.42 28.57 28.28 23.73 45-49 19.055 28.825 28.139999999999997 23.98 50-54 19.425 29.2 27.465 23.91 55-59 19.855 29.054999999999996 27.675 23.415 60-64 19.134999999999998 29.015 28.000000000000004 23.849999999999998 65-69 19.275000000000002 28.970000000000002 27.74 24.015 70-74 19.09 29.325000000000003 27.894999999999996 23.69 75-79 20.02 27.779999999999998 27.83 24.37 80-84 19.96 28.105000000000004 28.185 23.75 85-89 19.835 28.804999999999996 27.529999999999998 23.830000000000002 90-94 20.16 28.244999999999997 27.925 23.669999999999998 95-99 19.755 28.21 27.950000000000003 24.085 100-104 19.634999999999998 28.235 28.125 24.005000000000003 105-109 20.349999999999998 28.294999999999998 27.72 23.635 110-114 19.814999999999998 28.82 27.765 23.599999999999998 115-119 20.64 28.38 27.589999999999996 23.39 120-124 19.805 28.87 27.465 23.86 125-129 20.810000000000002 28.015 27.54 23.635 130-134 20.265 28.37 27.405 23.96 135-139 20.64 28.405 27.395000000000003 23.56 140-144 20.49 27.939999999999998 27.67 23.9 145-149 20.549999999999997 28.465 27.389999999999997 23.595 150-151 19.7125 28.275 27.4125 24.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 2.5 25 4.5 26 9.0 27 11.0 28 13.0 29 17.0 30 21.0 31 31.0 32 42.5 33 52.0 34 62.5 35 78.5 36 103.0 37 122.0 38 134.5 39 161.5 40 198.5 41 231.5 42 253.0 43 256.0 44 283.5 45 292.5 46 256.0 47 228.0 48 208.5 49 194.0 50 165.0 51 134.0 52 107.0 53 79.5 54 64.0 55 44.5 56 31.0 57 24.5 58 19.5 59 15.5 60 10.0 61 9.0 62 6.0 63 5.5 64 4.0 65 2.0 66 1.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4375 0.0 0.0 0.0 0.0 122-123 1.575 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 1.9875 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.2125000000000004 0.0 0.0 0.0 0.0 136-137 3.5375 0.0 0.0 0.0 0.0 138-139 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171860 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171860_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7395 33.0 33.0 34.0 32.0 34.0 2 32.8325 33.0 33.0 34.0 32.0 34.0 3 32.86025 34.0 33.0 34.0 32.0 34.0 4 32.784 34.0 33.0 34.0 32.0 34.0 5 32.81875 34.0 33.0 34.0 32.0 34.0 6 36.96525 38.0 38.0 38.0 37.0 38.0 7 36.978 38.0 38.0 38.0 37.0 38.0 8 36.978 38.0 38.0 38.0 36.0 38.0 9 37.0135 38.0 38.0 38.0 37.0 38.0 10-14 36.9674 38.0 38.0 38.0 36.6 38.0 15-19 36.84165 38.0 38.0 38.0 36.2 38.0 20-24 36.755250000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.708 38.0 38.0 38.0 36.0 38.0 30-34 36.759100000000004 38.0 38.0 38.0 36.4 38.0 35-39 36.67385 38.0 38.0 38.0 36.0 38.0 40-44 36.6449 38.0 38.0 38.0 36.0 38.0 45-49 36.666450000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.664300000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.687149999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.56155 38.0 38.0 38.0 35.6 38.0 65-69 36.4983 38.0 38.0 38.0 35.0 38.0 70-74 36.478300000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.369800000000005 38.0 38.0 38.0 34.4 38.0 80-84 36.4186 38.0 38.0 38.0 35.0 38.0 85-89 36.32655000000001 38.0 38.0 38.0 34.0 38.0 90-94 36.15775 38.0 38.0 38.0 34.0 38.0 95-99 36.1445 38.0 38.0 38.0 34.0 38.0 100-104 35.976800000000004 38.0 37.8 38.0 33.6 38.0 105-109 35.807100000000005 38.0 37.2 38.0 32.8 38.0 110-114 35.7691 38.0 37.4 38.0 32.6 38.0 115-119 35.6351 38.0 37.0 38.0 31.6 38.0 120-124 35.41885 38.0 37.0 38.0 31.2 38.0 125-129 35.211000000000006 38.0 36.0 38.0 30.0 38.0 130-134 34.981449999999995 38.0 36.0 38.0 28.4 38.0 135-139 34.531800000000004 38.0 35.2 38.0 27.0 38.0 140-144 34.185050000000004 38.0 35.0 38.0 24.4 38.0 145-149 33.6744 38.0 35.0 38.0 20.8 38.0 150-151 30.2065 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 13.0 4 4.0 5 0.0 6 2.0 7 6.0 8 3.0 9 2.0 10 0.0 11 0.0 12 1.0 13 5.0 14 3.0 15 7.0 16 5.0 17 3.0 18 3.0 19 3.0 20 3.0 21 4.0 22 9.0 23 10.0 24 10.0 25 10.0 26 18.0 27 25.0 28 28.0 29 35.0 30 51.0 31 51.0 32 66.0 33 100.0 34 125.0 35 223.0 36 591.0 37 2563.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.56356356356356 17.81781781781782 17.59259259259259 26.026026026026027 2 24.824824824824827 23.5985985985986 33.38338338338339 18.193193193193196 3 20.830207551887973 28.35708927231808 30.38259564891223 20.43010752688172 4 25.006251562890725 34.10852713178294 22.330582645661416 18.554638659664917 5 24.55613903475869 35.35883970992748 22.980745186296573 17.104276069017253 6 20.225 36.0 24.55 19.225 7 18.15 18.375 42.175000000000004 21.3 8 22.475 22.425 28.199999999999996 26.900000000000002 9 22.900000000000002 27.075 27.05 22.975 10-14 23.356167808390417 29.6214810740537 25.731286564328215 21.291064553227663 15-19 23.06191857557267 28.293488046413923 27.488246473942183 21.15634690407122 20-24 23.036098733289943 28.65868923046112 27.652330646372604 20.65288138987633 25-29 23.363221960627158 29.158944046486003 27.05004257877073 20.427791414116115 30-34 23.67471690550155 28.36456558773424 27.50275578715302 20.457961719611184 35-39 24.001002757583354 27.81649536224618 27.73126096766107 20.451240912509398 40-44 23.382286602175327 28.40459124855897 27.362036990627036 20.851085158638664 45-49 23.440784863349684 28.256081689858846 27.90069075983582 20.402442686955652 50-54 23.544417767106843 28.04621848739496 28.241296518607445 20.168067226890756 55-59 23.695663048371767 27.63743684658096 27.98759441748787 20.679305687559403 60-64 24.219843968793757 28.220644128825768 27.535507101420286 20.024004800960192 65-69 24.09120456022801 28.30641532076604 27.26136306815341 20.341017050852543 70-74 24.01 28.005000000000003 27.400000000000002 20.585 75-79 24.19 27.845 27.474999999999998 20.49 80-84 24.68 27.965 27.305 20.05 85-89 24.12 27.839999999999996 27.800000000000004 20.24 90-94 23.95 27.900000000000002 27.175 20.974999999999998 95-99 23.955000000000002 28.565 27.405 20.075000000000003 100-104 24.515 27.975 27.345000000000002 20.165 105-109 23.87 28.18 27.76 20.19 110-114 24.16 27.975 27.82 20.044999999999998 115-119 24.215 28.305000000000003 27.35 20.13 120-124 23.5 28.1 28.26 20.14 125-129 24.349999999999998 28.315 27.889999999999997 19.445 130-134 24.065 28.470000000000002 27.345000000000002 20.119999999999997 135-139 24.68 28.185 27.450000000000003 19.685 140-144 24.445 27.91 27.905 19.74 145-149 24.125 28.310000000000002 27.860000000000003 19.705000000000002 150-151 25.775 27.5125 27.3875 19.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 1.0 18 1.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 1.5 26 2.5 27 5.5 28 6.5 29 8.0 30 11.0 31 16.0 32 18.5 33 28.0 34 39.0 35 45.5 36 65.5 37 95.5 38 127.0 39 158.5 40 192.0 41 234.5 42 263.5 43 284.0 44 290.5 45 287.0 46 298.5 47 286.5 48 249.5 49 204.0 50 159.0 51 130.0 52 117.5 53 95.5 54 66.5 55 47.0 56 35.0 57 33.0 58 29.0 59 19.0 60 12.5 61 8.0 62 4.0 63 3.5 64 2.0 65 1.0 66 2.5 67 1.5 68 0.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.03 20-24 0.135 25-29 0.185 30-34 0.21 35-39 0.27499999999999997 40-44 0.245 45-49 0.11 50-54 0.04 55-59 0.045 60-64 0.02 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72389558232932 99.325 2 0.2259036144578313 0.44999999999999996 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.8375 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.55 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582304 spots for SRR7171860.sra Written 582304 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra Read 582291 spots for SRR7171860.sra Written 582291 spots for SRR7171860.sra SRR ids: ['SRR7171860.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5h8k9em6 SRR7171860.sra spots: 11645833 blocks: [[1, 582291], [582292, 1164582], [1164583, 1746873], [1746874, 2329164], [2329165, 2911455], [2911456, 3493746], [3493747, 4076037], [4076038, 4658328], [4658329, 5240619], [5240620, 5822910], [5822911, 6405201], [6405202, 6987492], [6987493, 7569783], [7569784, 8152074], [8152075, 8734365], [8734366, 9316656], [9316657, 9898947], [9898948, 10481238], [10481239, 11063529], [11063530, 11645833]] SRR7171860 file size 3924690 SRR7171860 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171860 SRR7171860_1.fastq SRR7171860_2.fastq Input file: SRR7171860_1.fastq Paired file: SRR7171860_2.fastq trimmed: SRR7171860-trimmed-pair1.fastq, SRR7171860-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:14:39 2025 >> started Thu Feb 13 22:14:52 2025 >> done (12.811s) 11645833 read pairs processed; of these: 27792 ( 0.24%) short read pairs filtered out after trimming by size control 23310 ( 0.20%) empty read pairs filtered out after trimming by size control 11594731 (99.56%) read pairs available; of these: 3941307 (33.99%) trimmed read pairs available after processing 7653424 (66.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 3 0.00% 21 4 0.00% 22 4 0.00% 23 6 0.00% 24 5 0.00% 25 3 0.00% 26 8 0.00% 27 6 0.00% 28 6 0.00% 29 7 0.00% 30 4 0.00% 31 8 0.00% 32 6 0.00% 33 4 0.00% 34 6 0.00% 35 10 0.00% 36 3 0.00% 37 6 0.00% 38 14 0.00% 39 9 0.00% 40 8 0.00% 41 5 0.00% 42 18 0.00% 43 38 0.00% 44 23 0.00% 45 15 0.00% 46 23 0.00% 47 60 0.00% 48 94 0.00% 49 26 0.00% 50 19 0.00% 51 33 0.00% 52 83 0.00% 53 65 0.00% 54 79 0.00% 55 41 0.00% 56 71 0.00% 57 88 0.00% 58 105 0.00% 59 65 0.00% 60 69 0.00% 61 104 0.00% 62 99 0.00% 63 82 0.00% 64 94 0.00% 65 122 0.00% 66 124 0.00% 67 116 0.00% 68 143 0.00% 69 183 0.00% 70 180 0.00% 71 209 0.00% 72 211 0.00% 73 328 0.00% 74 335 0.00% 75 358 0.00% 76 574 0.00% 77 595 0.01% 78 556 0.00% 79 636 0.01% 80 733 0.01% 81 758 0.01% 82 852 0.01% 83 1016 0.01% 84 2343 0.02% 85 3124 0.03% 86 3115 0.03% 87 3527 0.03% 88 3664 0.03% 89 3613 0.03% 90 3697 0.03% 91 3684 0.03% 92 4005 0.03% 93 4067 0.04% 94 4039 0.03% 95 4420 0.04% 96 4698 0.04% 97 4640 0.04% 98 4944 0.04% 99 5142 0.04% 100 5458 0.05% 101 5906 0.05% 102 6012 0.05% 103 6570 0.06% 104 6952 0.06% 105 7307 0.06% 106 7840 0.07% 107 7997 0.07% 108 8246 0.07% 109 8956 0.08% 110 9629 0.08% 111 9945 0.09% 112 10626 0.09% 113 11109 0.10% 114 12016 0.10% 115 12748 0.11% 116 13030 0.11% 117 13454 0.12% 118 13865 0.12% 119 15064 0.13% 120 16012 0.14% 121 16398 0.14% 122 16664 0.14% 123 17384 0.15% 124 18523 0.16% 125 19186 0.17% 126 19510 0.17% 127 21159 0.18% 128 21263 0.18% 129 22468 0.19% 130 23508 0.20% 131 24532 0.21% 132 25949 0.22% 133 27311 0.24% 134 29393 0.25% 135 30891 0.27% 136 32438 0.28% 137 34280 0.30% 138 36988 0.32% 139 39277 0.34% 140 41828 0.36% 141 45328 0.39% 142 49644 0.43% 143 55386 0.48% 144 63959 0.55% 145 73925 0.64% 146 90487 0.78% 147 118627 1.02% 148 177103 1.53% 149 347434 3.00% 150 2119440 18.28% 151 7653424 66.01% 11594731 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=29 prefix-density=0.85 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=24.34 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.7 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=22 prefix-density=0.81 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=29.25 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=9.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171860 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:15:35 Started mapping on | Feb 13 22:15:36 Finished on | Feb 13 22:17:10 Mapping speed, Million of reads per hour | 444.05 Number of input reads | 11594731 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10811397 Uniquely mapped reads % | 93.24% Average mapped length | 296.35 Number of splices: Total | 10570834 Number of splices: Annotated (sjdb) | 10334635 Number of splices: GT/AG | 10398031 Number of splices: GC/AG | 134813 Number of splices: AT/AC | 9165 Number of splices: Non-canonical | 28825 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272600 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 32628 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 535104 535104 535104 N_multimapping 272600 272600 272600 N_noFeature 305424 10677841 376107 N_ambiguous 123384 1010 59944 UnstrandedReadsAssigned:10382589 PositiveStrandReadsAssigned:132546 NegativeStrandReadsAssigned:10375346 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171860 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171860-trimmed-pair1.fastq SRR7171860-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,594,731 reads, 10,271,350 reads pseudoaligned [quant] estimated average fragment length: 252.613 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR7171860.ke.tsv 34699 SRR7171860.se.tsv 87100 total ==> SRR7171860.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.39 873 39.4262 Potri.005G024800.1.v4.1 1035 783.387 377 38.3903 Potri.004G059700.1.v4.1 961 709.392 20 2.24906 Potri.007G009000.2.v4.1 1416 1164.39 0 0 Potri.003G141000.2.v4.1 2943 2691.39 460 13.6345 Potri.016G087400.1.v4.1 270 71.3907 1211 1353.19 Potri.015G069301.1.v4.1 564 316.267 0 0 Potri.010G195200.1.v4.1 1773 1521.39 313.805 16.4542 Potri.012G127500.1.v4.1 977 725.387 4245 466.837 ==> SRR7171860.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 345 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 372 SRR7171860 completed mapping pipeline successfully