Starting /dee2/code/volunteer_pipeline.sh SRR7171861 current disk space = 3113209081856 free memory = 1398236628 SRR7171861 SRAfilesize f055dfd69fb80493512d987e1c44aaec SRR7171861.sra SRR7171861.sra file validated SRR7171861 is paired end SRR7171861 is conventional basespace SRR7171861 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171861_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.0765 31.0 25.0 33.0 18.0 33.0 2 31.69075 33.0 31.0 33.0 29.0 34.0 3 31.973 33.0 31.0 33.0 29.0 34.0 4 32.12575 33.0 31.0 33.0 31.0 34.0 5 32.858 33.0 33.0 33.0 32.0 34.0 6 36.64875 38.0 37.0 38.0 34.0 38.0 7 37.09675 38.0 38.0 38.0 35.0 38.0 8 37.413 38.0 38.0 38.0 36.0 38.0 9 37.6005 38.0 38.0 38.0 37.0 38.0 10-14 37.63405 38.0 38.0 38.0 38.0 38.0 15-19 37.6079 38.0 38.0 38.0 38.0 38.0 20-24 37.593399999999995 38.0 38.0 38.0 37.8 38.0 25-29 37.55825 38.0 38.0 38.0 38.0 38.0 30-34 37.51545 38.0 38.0 38.0 38.0 38.0 35-39 37.4889 38.0 38.0 38.0 37.6 38.0 40-44 37.4966 38.0 38.0 38.0 37.6 38.0 45-49 37.440099999999994 38.0 38.0 38.0 37.4 38.0 50-54 37.3467 38.0 38.0 38.0 37.0 38.0 55-59 37.325450000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.23315 38.0 38.0 38.0 36.4 38.0 65-69 37.2278 38.0 38.0 38.0 37.0 38.0 70-74 37.12865 38.0 38.0 38.0 36.2 38.0 75-79 37.0949 38.0 38.0 38.0 36.0 38.0 80-84 37.00265 38.0 38.0 38.0 36.0 38.0 85-89 36.97065 38.0 38.0 38.0 36.0 38.0 90-94 36.88635000000001 38.0 38.0 38.0 35.6 38.0 95-99 36.7487 38.0 38.0 38.0 35.0 38.0 100-104 36.62645 38.0 38.0 38.0 34.2 38.0 105-109 36.4433 38.0 38.0 38.0 34.0 38.0 110-114 36.402249999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.258449999999996 38.0 37.8 38.0 34.0 38.0 120-124 36.1429 38.0 37.2 38.0 33.6 38.0 125-129 35.92105 38.0 37.0 38.0 33.0 38.0 130-134 35.4756 38.0 36.0 38.0 30.6 38.0 135-139 35.2878 38.0 36.0 38.0 30.6 38.0 140-144 34.84655 38.0 35.2 38.0 28.0 38.0 145-149 34.42979999999999 38.0 35.0 38.0 27.2 38.0 150-151 31.302999999999997 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 3.0 17 4.0 18 2.0 19 1.0 20 1.0 21 4.0 22 7.0 23 9.0 24 5.0 25 11.0 26 10.0 27 14.0 28 23.0 29 18.0 30 26.0 31 44.0 32 46.0 33 79.0 34 133.0 35 251.0 36 741.0 37 2564.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.875 13.175 10.9 35.05 2 21.305326331582897 16.27906976744186 37.609402350587644 24.8062015503876 3 19.675 21.625 28.000000000000004 30.7 4 22.475 30.2 23.225 24.099999999999998 5 22.875 31.674999999999997 24.75 20.7 6 18.7 34.699999999999996 26.3 20.3 7 13.875000000000002 23.799999999999997 42.15 20.175 8 17.825 23.7 31.525 26.950000000000003 9 18.025 23.200000000000003 32.824999999999996 25.95 10-14 19.8 29.14 27.169999999999998 23.89 15-19 20.195 28.310000000000002 27.85 23.645 20-24 19.91 28.365000000000002 27.955000000000002 23.77 25-29 20.175 28.215 27.615000000000002 23.995 30-34 20.19 28.425 27.615000000000002 23.77 35-39 20.885 27.794999999999998 27.534999999999997 23.785 40-44 20.080000000000002 28.84 27.445000000000004 23.635 45-49 20.549999999999997 27.315 27.97 24.165 50-54 20.84 28.299999999999997 27.115000000000002 23.745 55-59 20.64 28.410000000000004 27.395000000000003 23.555 60-64 20.48 27.935 27.474999999999998 24.11 65-69 20.674999999999997 27.755000000000003 27.565 24.005000000000003 70-74 21.13 27.439999999999998 27.685 23.745 75-79 20.349999999999998 28.435 27.33 23.885 80-84 20.77 27.675 27.400000000000002 24.154999999999998 85-89 20.805 28.065 27.48 23.65 90-94 20.95 27.894999999999996 27.500000000000004 23.655 95-99 20.665 27.474999999999998 27.800000000000004 24.060000000000002 100-104 20.330000000000002 27.089999999999996 28.335 24.245 105-109 20.935000000000002 28.15 26.8 24.115000000000002 110-114 20.995 27.67 27.325 24.01 115-119 21.16 27.99 27.145000000000003 23.705000000000002 120-124 21.515 27.175 27.16 24.15 125-129 21.58 26.825 27.465 24.13 130-134 21.355 27.560000000000002 27.145000000000003 23.94 135-139 21.415 27.67 27.095000000000002 23.82 140-144 21.185000000000002 27.845 27.0 23.97 145-149 20.825 27.800000000000004 27.284999999999997 24.09 150-151 21.0375 27.787499999999998 26.5625 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.5 25 1.5 26 2.5 27 4.0 28 4.5 29 9.0 30 16.0 31 19.0 32 27.0 33 37.0 34 46.5 35 63.5 36 75.0 37 96.5 38 125.5 39 151.0 40 179.0 41 192.5 42 231.0 43 271.0 44 263.0 45 281.0 46 283.0 47 250.5 48 236.5 49 218.0 50 193.5 51 158.5 52 138.0 53 107.0 54 70.0 55 60.0 56 48.0 57 36.0 58 27.0 59 18.5 60 13.0 61 9.5 62 7.5 63 6.5 64 5.0 65 3.5 66 2.0 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.925 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 3.025 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.4625 0.0 0.0 0.0 0.0 134-135 3.7750000000000004 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAT 10 0.006830828 145.0 9 >>END_MODULE SRR7171861 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171861_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.993 33.0 33.0 34.0 32.0 34.0 2 33.123 34.0 33.0 34.0 33.0 34.0 3 33.0905 34.0 33.0 34.0 33.0 34.0 4 33.1025 34.0 33.0 34.0 33.0 34.0 5 33.09525 34.0 33.0 34.0 32.0 34.0 6 37.33025 38.0 38.0 38.0 37.0 38.0 7 37.40375 38.0 38.0 38.0 38.0 38.0 8 37.26925 38.0 38.0 38.0 37.0 38.0 9 37.29175 38.0 38.0 38.0 37.0 38.0 10-14 37.2861 38.0 38.0 38.0 37.0 38.0 15-19 37.272999999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.242200000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.269000000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.1674 38.0 38.0 38.0 37.0 38.0 35-39 37.0115 38.0 38.0 38.0 37.0 38.0 40-44 36.948449999999994 38.0 38.0 38.0 36.4 38.0 45-49 37.16375 38.0 38.0 38.0 37.0 38.0 50-54 37.1226 38.0 38.0 38.0 36.8 38.0 55-59 37.067099999999996 38.0 38.0 38.0 36.4 38.0 60-64 37.07405 38.0 38.0 38.0 36.4 38.0 65-69 37.01715 38.0 38.0 38.0 36.0 38.0 70-74 36.89585 38.0 38.0 38.0 36.0 38.0 75-79 36.8944 38.0 38.0 38.0 36.0 38.0 80-84 36.7906 38.0 38.0 38.0 36.0 38.0 85-89 36.64805 38.0 38.0 38.0 35.0 38.0 90-94 36.60595 38.0 38.0 38.0 34.8 38.0 95-99 36.3858 38.0 38.0 38.0 34.2 38.0 100-104 36.40575 38.0 38.0 38.0 34.0 38.0 105-109 36.2949 38.0 38.0 38.0 34.0 38.0 110-114 36.205200000000005 38.0 38.0 38.0 33.8 38.0 115-119 35.8651 38.0 37.0 38.0 32.6 38.0 120-124 35.69265 38.0 37.0 38.0 31.8 38.0 125-129 35.477799999999995 38.0 36.2 38.0 31.0 38.0 130-134 35.257999999999996 38.0 36.0 38.0 30.4 38.0 135-139 34.953599999999994 38.0 35.8 38.0 28.4 38.0 140-144 34.5186 38.0 35.2 38.0 27.0 38.0 145-149 34.0001 38.0 35.0 38.0 24.6 38.0 150-151 30.5865 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 1.0 11 2.0 12 1.0 13 2.0 14 1.0 15 1.0 16 3.0 17 3.0 18 6.0 19 5.0 20 5.0 21 6.0 22 7.0 23 4.0 24 16.0 25 15.0 26 17.0 27 19.0 28 28.0 29 31.0 30 27.0 31 40.0 32 41.0 33 81.0 34 133.0 35 258.0 36 618.0 37 2616.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.975 17.974999999999998 14.875 28.175 2 23.275000000000002 25.525 31.825 19.375 3 21.224999999999998 27.425 30.15 21.2 4 24.6 34.475 21.4 19.525000000000002 5 23.45 36.6 22.2 17.75 6 19.875 37.574999999999996 23.3 19.25 7 18.85 19.25 39.275 22.625 8 21.15 24.05 27.725 27.075 9 23.200000000000003 25.324999999999996 26.650000000000002 24.825 10-14 23.494999999999997 28.975 25.255 22.275 15-19 23.235 27.96 27.72 21.085 20-24 23.22 28.21 26.765 21.805 25-29 22.82 28.98 26.790000000000003 21.41 30-34 23.414487526299972 27.85292054904318 27.011321510870655 21.721270413786193 35-39 23.2477515952369 28.151534944480733 27.171783148269107 21.428930312013264 40-44 23.079243765084474 28.444288012872082 27.17216411906677 21.30430410297667 45-49 23.435 28.26 26.884999999999998 21.42 50-54 23.735 27.76 27.375 21.13 55-59 23.25 27.665 27.66 21.425 60-64 23.849999999999998 27.505000000000003 27.29 21.355 65-69 23.605 27.96 27.189999999999998 21.245 70-74 24.095 27.089999999999996 27.595 21.22 75-79 23.64 27.750000000000004 28.345 20.265 80-84 23.64 27.97 27.450000000000003 20.94 85-89 24.04 28.105000000000004 27.305 20.549999999999997 90-94 23.69 28.22 26.865 21.224999999999998 95-99 24.3 28.134999999999998 26.87 20.695 100-104 24.635 28.08 26.575 20.71 105-109 24.535 27.33 27.52 20.615 110-114 24.044999999999998 28.465 27.29 20.200000000000003 115-119 24.4 27.88 26.840000000000003 20.880000000000003 120-124 24.355 28.16 26.974999999999998 20.51 125-129 23.724999999999998 28.155 27.21 20.91 130-134 24.33 28.044999999999998 27.189999999999998 20.435 135-139 24.815 27.615000000000002 26.87 20.7 140-144 24.425 27.68 26.790000000000003 21.105 145-149 24.85 28.585 26.169999999999998 20.395 150-151 24.825 28.525 26.3125 20.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 0.5 26 2.0 27 4.0 28 5.0 29 6.0 30 7.5 31 10.5 32 14.0 33 23.5 34 36.5 35 38.0 36 54.5 37 87.0 38 122.0 39 146.0 40 176.5 41 225.5 42 251.5 43 268.5 44 288.0 45 322.0 46 310.5 47 272.0 48 249.5 49 210.5 50 176.0 51 150.0 52 128.5 53 100.0 54 79.0 55 59.0 56 41.0 57 32.0 58 21.0 59 18.5 60 14.0 61 9.5 62 9.5 63 7.5 64 7.5 65 5.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.19 35-39 0.485 40-44 0.5599999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16603487490522 98.1 2 0.7581501137225171 1.5 3 0.0 0.0 4 0.0 0.0 5 0.050543340914834464 0.25 6 0.025271670457417232 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 6 0.15 No Hit GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 5 0.125 No Hit GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.6875 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.125 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.7125 0.0 0.0 0.0 0.0 136-137 4.05 0.0 0.0 0.0 0.0 138-139 4.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902083 spots for SRR7171861.sra Written 902083 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra Read 902070 spots for SRR7171861.sra Written 902070 spots for SRR7171861.sra SRR ids: ['SRR7171861.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vxpulwlv SRR7171861.sra spots: 18041413 blocks: [[1, 902070], [902071, 1804140], [1804141, 2706210], [2706211, 3608280], [3608281, 4510350], [4510351, 5412420], [5412421, 6314490], [6314491, 7216560], [7216561, 8118630], [8118631, 9020700], [9020701, 9922770], [9922771, 10824840], [10824841, 11726910], [11726911, 12628980], [12628981, 13531050], [13531051, 14433120], [14433121, 15335190], [15335191, 16237260], [16237261, 17139330], [17139331, 18041413]] SRR7171861 file size 6091942 SRR7171861 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171861 SRR7171861_1.fastq SRR7171861_2.fastq Input file: SRR7171861_1.fastq Paired file: SRR7171861_2.fastq trimmed: SRR7171861-trimmed-pair1.fastq, SRR7171861-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:55:07 2025 >> started Fri Feb 14 11:55:29 2025 >> done (21.602s) 18041413 read pairs processed; of these: 20332 ( 0.11%) short read pairs filtered out after trimming by size control 16692 ( 0.09%) empty read pairs filtered out after trimming by size control 18004389 (99.79%) read pairs available; of these: 7995788 (44.41%) trimmed read pairs available after processing 10008601 (55.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 10 0.00% 21 4 0.00% 22 4 0.00% 23 7 0.00% 24 2 0.00% 25 4 0.00% 26 5 0.00% 27 12 0.00% 28 10 0.00% 29 9 0.00% 30 7 0.00% 31 3 0.00% 32 7 0.00% 33 8 0.00% 34 4 0.00% 35 5 0.00% 36 7 0.00% 37 4 0.00% 38 6 0.00% 39 6 0.00% 40 6 0.00% 41 4 0.00% 42 8 0.00% 43 10 0.00% 44 16 0.00% 45 24 0.00% 46 20 0.00% 47 18 0.00% 48 25 0.00% 49 24 0.00% 50 32 0.00% 51 37 0.00% 52 35 0.00% 53 55 0.00% 54 51 0.00% 55 58 0.00% 56 74 0.00% 57 87 0.00% 58 81 0.00% 59 106 0.00% 60 112 0.00% 61 113 0.00% 62 157 0.00% 63 176 0.00% 64 180 0.00% 65 222 0.00% 66 221 0.00% 67 245 0.00% 68 286 0.00% 69 298 0.00% 70 348 0.00% 71 437 0.00% 72 464 0.00% 73 534 0.00% 74 647 0.00% 75 709 0.00% 76 876 0.00% 77 1009 0.01% 78 1029 0.01% 79 1153 0.01% 80 1302 0.01% 81 1511 0.01% 82 1738 0.01% 83 1980 0.01% 84 2876 0.02% 85 3740 0.02% 86 4023 0.02% 87 4630 0.03% 88 5054 0.03% 89 5093 0.03% 90 5470 0.03% 91 5823 0.03% 92 6026 0.03% 93 6375 0.04% 94 6751 0.04% 95 7252 0.04% 96 7676 0.04% 97 7991 0.04% 98 8442 0.05% 99 9018 0.05% 100 9746 0.05% 101 10452 0.06% 102 11000 0.06% 103 12171 0.07% 104 12640 0.07% 105 13501 0.07% 106 14413 0.08% 107 14958 0.08% 108 15450 0.09% 109 16403 0.09% 110 17015 0.09% 111 18234 0.10% 112 19665 0.11% 113 20703 0.11% 114 22370 0.12% 115 22970 0.13% 116 23870 0.13% 117 24856 0.14% 118 28152 0.16% 119 24236 0.13% 120 27725 0.15% 121 28908 0.16% 122 30357 0.17% 123 32580 0.18% 124 34654 0.19% 125 35827 0.20% 126 37594 0.21% 127 38626 0.21% 128 40274 0.22% 129 41771 0.23% 130 44121 0.25% 131 46268 0.26% 132 49082 0.27% 133 52128 0.29% 134 55725 0.31% 135 56490 0.31% 136 60113 0.33% 137 64271 0.36% 138 68724 0.38% 139 74006 0.41% 140 79659 0.44% 141 87220 0.48% 142 97774 0.54% 143 110554 0.61% 144 128156 0.71% 145 151885 0.84% 146 194404 1.08% 147 267710 1.49% 148 418168 2.32% 149 866680 4.81% 150 4208641 23.38% 151 10008601 55.59% 18004389 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=24 prefix-density=1.14 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.19 sequence-density-rank=15 fanout-score=18.48 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=8.0 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=24 prefix-density=1.08 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.15 sequence-density-rank=22 fanout-score=26.24 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=10.1 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171861 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:56:51 Started mapping on | Feb 14 11:56:51 Finished on | Feb 14 12:01:09 Mapping speed, Million of reads per hour | 251.22 Number of input reads | 18004389 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16066702 Uniquely mapped reads % | 89.24% Average mapped length | 295.53 Number of splices: Total | 16146610 Number of splices: Annotated (sjdb) | 15857923 Number of splices: GT/AG | 15890179 Number of splices: GC/AG | 200019 Number of splices: AT/AC | 13778 Number of splices: Non-canonical | 42634 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 441627 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 47237 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.92% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1514878 1514878 1514878 N_multimapping 441627 441627 441627 N_noFeature 336497 15912136 403962 N_ambiguous 184275 805 96834 UnstrandedReadsAssigned:15545930 PositiveStrandReadsAssigned:153761 NegativeStrandReadsAssigned:15565906 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171861 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171861-trimmed-pair1.fastq SRR7171861-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,004,389 reads, 15,394,375 reads pseudoaligned [quant] estimated average fragment length: 244.828 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7171861.ke.tsv 34699 SRR7171861.se.tsv 87100 total ==> SRR7171861.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.17 1712 49.007 Potri.005G024800.1.v4.1 1035 791.172 442 28.3727 Potri.004G059700.1.v4.1 961 717.203 24 1.69949 Potri.007G009000.2.v4.1 1416 1172.17 0 0 Potri.003G141000.2.v4.1 2943 2699.17 668 12.5689 Potri.016G087400.1.v4.1 270 74.3781 1561.73 1066.38 Potri.015G069301.1.v4.1 564 323.463 0 0 Potri.010G195200.1.v4.1 1773 1529.17 549.871 18.2623 Potri.012G127500.1.v4.1 977 733.198 14396 997.173 ==> SRR7171861.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 80 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 550 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 605 SRR7171861 completed mapping pipeline successfully