Starting /dee2/code/volunteer_pipeline.sh SRR7171862 current disk space = 3088396316672 free memory = 1449920208 SRR7171862 SRAfilesize 7f7804819daae1d8482b8d9e212386c1 SRR7171862.sra SRR7171862.sra file validated SRR7171862 is paired end SRR7171862 is conventional basespace SRR7171862 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171862_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74625 33.0 33.0 34.0 32.0 34.0 2 33.108 34.0 33.0 34.0 33.0 34.0 3 32.62975 33.0 33.0 34.0 31.0 34.0 4 32.14 33.0 31.0 33.0 31.0 34.0 5 32.7775 33.0 33.0 33.0 32.0 34.0 6 36.84925 38.0 37.0 38.0 35.0 38.0 7 37.15725 38.0 38.0 38.0 36.0 38.0 8 37.39675 38.0 38.0 38.0 37.0 38.0 9 37.4665 38.0 38.0 38.0 37.0 38.0 10-14 37.5615 38.0 38.0 38.0 37.8 38.0 15-19 37.563550000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.543099999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.52485 38.0 38.0 38.0 37.4 38.0 30-34 37.48915 38.0 38.0 38.0 37.2 38.0 35-39 37.45315000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.38225 38.0 38.0 38.0 37.0 38.0 45-49 37.3863 38.0 38.0 38.0 37.0 38.0 50-54 37.33855 38.0 38.0 38.0 37.0 38.0 55-59 37.30885000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.227199999999996 38.0 38.0 38.0 36.2 38.0 65-69 37.204449999999994 38.0 38.0 38.0 36.4 38.0 70-74 37.16215 38.0 38.0 38.0 36.0 38.0 75-79 37.08655 38.0 38.0 38.0 36.0 38.0 80-84 36.991499999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.9497 38.0 38.0 38.0 35.8 38.0 90-94 36.85895000000001 38.0 38.0 38.0 35.2 38.0 95-99 36.721149999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.643600000000006 38.0 38.0 38.0 34.4 38.0 105-109 36.5948 38.0 38.0 38.0 34.0 38.0 110-114 36.3602 38.0 37.6 38.0 34.0 38.0 115-119 36.19415 38.0 37.2 38.0 33.2 38.0 120-124 35.977850000000004 38.0 37.0 38.0 32.2 38.0 125-129 35.94780000000001 38.0 36.8 38.0 32.6 38.0 130-134 35.60675 38.0 36.0 38.0 31.0 38.0 135-139 35.344350000000006 38.0 36.0 38.0 29.8 38.0 140-144 35.04105 38.0 35.4 38.0 28.6 38.0 145-149 34.5738 38.0 35.0 38.0 27.4 38.0 150-151 31.57525 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 1.0 20 2.0 21 3.0 22 7.0 23 1.0 24 8.0 25 8.0 26 9.0 27 16.0 28 22.0 29 24.0 30 32.0 31 31.0 32 72.0 33 82.0 34 149.0 35 248.0 36 670.0 37 2609.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.51875937968984 15.607803901950975 11.205602801400701 35.66783391695848 2 19.950000000000003 19.85 35.15 25.05 3 18.425 27.400000000000002 26.25 27.925 4 21.075 34.625 22.2 22.1 5 20.849999999999998 37.05 22.575 19.525000000000002 6 18.675 34.725 26.325 20.275000000000002 7 13.900000000000002 22.2 43.525000000000006 20.375 8 16.8 22.85 31.35 28.999999999999996 9 18.65 22.900000000000002 31.474999999999998 26.974999999999998 10-14 19.869999999999997 29.435 26.215 24.48 15-19 19.72 27.884999999999998 28.43 23.965 20-24 19.695 28.24 27.74 24.325 25-29 20.095 28.694999999999997 27.6 23.61 30-34 20.244999999999997 27.889999999999997 27.79 24.075 35-39 20.035 27.944999999999997 27.83 24.19 40-44 20.474999999999998 27.91 28.03 23.585 45-49 20.315 28.375 27.384999999999998 23.925 50-54 20.294999999999998 27.97 27.915 23.82 55-59 20.23 28.165000000000003 27.755000000000003 23.849999999999998 60-64 20.244999999999997 28.395 27.76 23.599999999999998 65-69 20.025000000000002 27.965 27.58 24.43 70-74 20.105 28.310000000000002 27.500000000000004 24.085 75-79 20.115 27.99 27.839999999999996 24.055 80-84 20.985 27.975 27.375 23.665 85-89 20.23 28.33 27.894999999999996 23.544999999999998 90-94 20.51 27.779999999999998 27.644999999999996 24.065 95-99 20.5 28.005000000000003 28.335 23.16 100-104 20.87 28.065 27.22 23.845 105-109 20.775 27.85 28.04 23.335 110-114 20.72 27.83 27.99 23.46 115-119 20.985 28.060000000000002 27.310000000000002 23.645 120-124 20.25 27.700000000000003 27.860000000000003 24.19 125-129 20.68 27.57 27.58 24.169999999999998 130-134 21.15 27.725 27.555000000000003 23.57 135-139 20.555 27.950000000000003 27.095000000000002 24.4 140-144 20.96 28.02 27.065 23.955000000000002 145-149 20.945 27.66 27.43 23.965 150-151 21.45 26.974999999999998 28.025 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.0 25 1.5 26 3.5 27 6.0 28 7.5 29 9.0 30 16.0 31 21.0 32 30.0 33 35.0 34 40.5 35 53.0 36 70.5 37 102.5 38 132.0 39 167.0 40 196.0 41 212.0 42 244.0 43 264.5 44 289.0 45 291.5 46 273.0 47 260.0 48 240.0 49 215.5 50 181.0 51 155.0 52 128.5 53 97.5 54 67.5 55 47.0 56 33.5 57 26.0 58 19.5 59 15.5 60 11.5 61 8.0 62 7.0 63 6.0 64 4.5 65 3.5 66 1.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.6375 0.0 0.0 0.0 0.0 126-127 1.8624999999999998 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 3.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 50 5.60876E-5 20.3 75-79 >>END_MODULE SRR7171862 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171862_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.908 33.0 33.0 34.0 32.0 34.0 2 33.00875 34.0 33.0 34.0 32.0 34.0 3 33.084 34.0 33.0 34.0 32.0 34.0 4 33.00275 34.0 33.0 34.0 33.0 34.0 5 33.044 34.0 33.0 34.0 33.0 34.0 6 37.205 38.0 38.0 38.0 37.0 38.0 7 37.329 38.0 38.0 38.0 37.0 38.0 8 37.33125 38.0 38.0 38.0 37.0 38.0 9 37.29025 38.0 38.0 38.0 37.0 38.0 10-14 37.1759 38.0 38.0 38.0 37.0 38.0 15-19 37.176 38.0 38.0 38.0 37.0 38.0 20-24 37.175200000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.120400000000004 38.0 38.0 38.0 36.8 38.0 30-34 37.06475 38.0 38.0 38.0 37.0 38.0 35-39 36.78245 38.0 38.0 38.0 36.2 38.0 40-44 36.6432 38.0 38.0 38.0 36.0 38.0 45-49 36.9988 38.0 38.0 38.0 36.0 38.0 50-54 36.97455 38.0 38.0 38.0 36.0 38.0 55-59 36.8952 38.0 38.0 38.0 36.0 38.0 60-64 36.934850000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.88105 38.0 38.0 38.0 36.0 38.0 70-74 36.771550000000005 38.0 38.0 38.0 35.2 38.0 75-79 36.77445 38.0 38.0 38.0 35.4 38.0 80-84 36.73544999999999 38.0 38.0 38.0 35.2 38.0 85-89 36.596700000000006 38.0 38.0 38.0 34.8 38.0 90-94 36.46035 38.0 38.0 38.0 34.0 38.0 95-99 36.366550000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.23745 38.0 38.0 38.0 34.0 38.0 105-109 36.1609 38.0 37.4 38.0 33.4 38.0 110-114 36.0279 38.0 37.2 38.0 33.0 38.0 115-119 35.89235 38.0 37.2 38.0 32.6 38.0 120-124 35.49165000000001 38.0 36.4 38.0 30.2 38.0 125-129 35.40785 38.0 36.2 38.0 30.6 38.0 130-134 35.111450000000005 38.0 36.0 38.0 28.6 38.0 135-139 34.730450000000005 38.0 35.4 38.0 28.0 38.0 140-144 34.52460000000001 38.0 35.0 38.0 27.0 38.0 145-149 34.08275 38.0 34.6 38.0 24.6 38.0 150-151 30.328249999999997 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 3.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 2.0 13 2.0 14 1.0 15 0.0 16 2.0 17 3.0 18 6.0 19 4.0 20 6.0 21 7.0 22 10.0 23 11.0 24 14.0 25 9.0 26 16.0 27 22.0 28 22.0 29 25.0 30 34.0 31 46.0 32 76.0 33 81.0 34 168.0 35 280.0 36 666.0 37 2470.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.35 17.7 16.825000000000003 25.124999999999996 2 24.425 24.55 33.300000000000004 17.724999999999998 3 21.875 27.825 30.325000000000003 19.975 4 24.675 34.525 21.675 19.125 5 25.174999999999997 37.4 19.950000000000003 17.474999999999998 6 19.375 37.95 23.425 19.25 7 18.925 18.575 40.275 22.225 8 21.95 22.45 27.025 28.575 9 21.525 25.650000000000002 27.975 24.85 10-14 23.32 29.195 25.645 21.84 15-19 22.81 27.495000000000005 28.175 21.52 20-24 23.71 28.09 26.705000000000002 21.495 25-29 23.150000000000002 27.99 27.275 21.584999999999997 30-34 22.669936930623685 28.24607067774552 27.725498047852636 21.358494343778155 35-39 23.09437386569873 27.94414196410567 27.324057269610808 21.637426900584796 40-44 23.218251564708257 28.200080759135876 27.604482132041184 20.97718554411468 45-49 22.805 28.139999999999997 27.575 21.48 50-54 23.505000000000003 28.360000000000003 27.3 20.835 55-59 24.02 27.975 27.339999999999996 20.665 60-64 23.615 27.905 27.01 21.47 65-69 23.205000000000002 28.03 27.37 21.395 70-74 23.7 28.1 27.229999999999997 20.97 75-79 23.805 27.725 27.55 20.919999999999998 80-84 23.810000000000002 28.345 27.05 20.794999999999998 85-89 23.669999999999998 27.625 27.21 21.495 90-94 23.82 27.560000000000002 27.325 21.295 95-99 23.775 27.755000000000003 27.33 21.14 100-104 23.985 28.22 26.995 20.8 105-109 24.015 27.99 27.555000000000003 20.44 110-114 24.060000000000002 27.644999999999996 27.365000000000002 20.93 115-119 24.26 27.685 27.185 20.87 120-124 23.630000000000003 27.755000000000003 27.715 20.9 125-129 23.985 27.685 27.175 21.154999999999998 130-134 24.11 28.494999999999997 26.905 20.49 135-139 24.565 27.815 27.245 20.375 140-144 24.635 27.900000000000002 26.85 20.615 145-149 24.240000000000002 28.64 26.86 20.26 150-151 24.7 28.299999999999997 26.5875 20.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 1.0 25 2.0 26 2.0 27 1.5 28 3.5 29 6.0 30 6.5 31 8.5 32 14.5 33 22.5 34 26.0 35 36.5 36 70.0 37 97.5 38 126.5 39 155.0 40 185.5 41 220.5 42 260.5 43 281.5 44 278.5 45 302.0 46 296.5 47 269.0 48 258.0 49 226.0 50 182.0 51 143.5 52 119.0 53 97.0 54 71.5 55 53.0 56 41.5 57 39.0 58 26.5 59 15.0 60 12.0 61 8.5 62 6.0 63 6.0 64 4.5 65 4.5 66 3.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.11 35-39 0.8200000000000001 40-44 0.9400000000000001 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.6499999999999999 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.225 0.0 0.0 0.0 0.0 122-123 1.4249999999999998 0.0 0.0 0.0 0.0 124-125 1.6125 0.0 0.0 0.0 0.0 126-127 1.8624999999999998 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.2875 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.6624999999999996 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra Read 747668 spots for SRR7171862.sra Written 747668 spots for SRR7171862.sra Read 747651 spots for SRR7171862.sra Written 747651 spots for SRR7171862.sra SRR ids: ['SRR7171862.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sziyomz4 SRR7171862.sra spots: 14953037 blocks: [[1, 747651], [747652, 1495302], [1495303, 2242953], [2242954, 2990604], [2990605, 3738255], [3738256, 4485906], [4485907, 5233557], [5233558, 5981208], [5981209, 6728859], [6728860, 7476510], [7476511, 8224161], [8224162, 8971812], [8971813, 9719463], [9719464, 10467114], [10467115, 11214765], [11214766, 11962416], [11962417, 12710067], [12710068, 13457718], [13457719, 14205369], [14205370, 14953037]] SRR7171862 file size 5045393 SRR7171862 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171862 SRR7171862_1.fastq SRR7171862_2.fastq Input file: SRR7171862_1.fastq Paired file: SRR7171862_2.fastq trimmed: SRR7171862-trimmed-pair1.fastq, SRR7171862-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:44:56 2025 >> started Thu Feb 13 21:45:12 2025 >> done (16.509s) 14953037 read pairs processed; of these: 19909 ( 0.13%) short read pairs filtered out after trimming by size control 14088 ( 0.09%) empty read pairs filtered out after trimming by size control 14919040 (99.77%) read pairs available; of these: 5982634 (40.10%) trimmed read pairs available after processing 8936406 (59.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 0 0.00% 21 3 0.00% 22 3 0.00% 23 1 0.00% 24 3 0.00% 25 3 0.00% 26 6 0.00% 27 2 0.00% 28 3 0.00% 29 4 0.00% 30 5 0.00% 31 7 0.00% 32 2 0.00% 33 6 0.00% 34 7 0.00% 35 5 0.00% 36 2 0.00% 37 3 0.00% 38 3 0.00% 39 6 0.00% 40 4 0.00% 41 8 0.00% 42 3 0.00% 43 4 0.00% 44 10 0.00% 45 11 0.00% 46 11 0.00% 47 8 0.00% 48 9 0.00% 49 18 0.00% 50 21 0.00% 51 16 0.00% 52 23 0.00% 53 26 0.00% 54 25 0.00% 55 29 0.00% 56 37 0.00% 57 29 0.00% 58 45 0.00% 59 50 0.00% 60 45 0.00% 61 68 0.00% 62 75 0.00% 63 90 0.00% 64 80 0.00% 65 98 0.00% 66 99 0.00% 67 121 0.00% 68 156 0.00% 69 173 0.00% 70 193 0.00% 71 224 0.00% 72 265 0.00% 73 301 0.00% 74 279 0.00% 75 367 0.00% 76 478 0.00% 77 504 0.00% 78 477 0.00% 79 616 0.00% 80 658 0.00% 81 730 0.00% 82 873 0.01% 83 1018 0.01% 84 1888 0.01% 85 2467 0.02% 86 2633 0.02% 87 2967 0.02% 88 3091 0.02% 89 3185 0.02% 90 3190 0.02% 91 3299 0.02% 92 3564 0.02% 93 3656 0.02% 94 4008 0.03% 95 4073 0.03% 96 4375 0.03% 97 4563 0.03% 98 4973 0.03% 99 5304 0.04% 100 5481 0.04% 101 5928 0.04% 102 6292 0.04% 103 6703 0.04% 104 7230 0.05% 105 7604 0.05% 106 8025 0.05% 107 8423 0.06% 108 8905 0.06% 109 9428 0.06% 110 9965 0.07% 111 10452 0.07% 112 11189 0.07% 113 11845 0.08% 114 12587 0.08% 115 13358 0.09% 116 13855 0.09% 117 14562 0.10% 118 14890 0.10% 119 15718 0.11% 120 16720 0.11% 121 16946 0.11% 122 18099 0.12% 123 19266 0.13% 124 20134 0.13% 125 21234 0.14% 126 22186 0.15% 127 23304 0.16% 128 24220 0.16% 129 25539 0.17% 130 26951 0.18% 131 28586 0.19% 132 30675 0.21% 133 32587 0.22% 134 34839 0.23% 135 36803 0.25% 136 40010 0.27% 137 42564 0.29% 138 45750 0.31% 139 50063 0.34% 140 54541 0.37% 141 59968 0.40% 142 67553 0.45% 143 77681 0.52% 144 90465 0.61% 145 110123 0.74% 146 140212 0.94% 147 196773 1.32% 148 312244 2.09% 149 646879 4.34% 150 3381589 22.67% 151 8936406 59.90% 14919040 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=30 prefix-density=0.25 prefix-fanout=2.2 sequence=AGTTCATCTCAGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=423.85 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=34.3 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=27 prefix-density=0.36 prefix-fanout=3.1 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=124.27 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=23.4 sequence=GAAGAAGAGAGG SRR7171862 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:46:01 Started mapping on | Feb 13 21:46:01 Finished on | Feb 13 21:48:36 Mapping speed, Million of reads per hour | 346.51 Number of input reads | 14919040 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13687274 Uniquely mapped reads % | 91.74% Average mapped length | 296.84 Number of splices: Total | 14204739 Number of splices: Annotated (sjdb) | 13976385 Number of splices: GT/AG | 13983707 Number of splices: GC/AG | 179607 Number of splices: AT/AC | 9939 Number of splices: Non-canonical | 31486 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380826 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 37947 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.38% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 868601 868601 868601 N_multimapping 380826 380826 380826 N_noFeature 255567 13566121 305823 N_ambiguous 137786 729 66603 UnstrandedReadsAssigned:13293921 PositiveStrandReadsAssigned:120424 NegativeStrandReadsAssigned:13314848 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171862 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171862-trimmed-pair1.fastq SRR7171862-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,919,040 reads, 13,189,146 reads pseudoaligned [quant] estimated average fragment length: 260.6 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7171862.ke.tsv 34699 SRR7171862.se.tsv 87100 total ==> SRR7171862.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.4 904 36.3047 Potri.005G024800.1.v4.1 1035 775.4 161 14.6627 Potri.004G059700.1.v4.1 961 701.421 16 1.61085 Potri.007G009000.2.v4.1 1416 1156.4 0 0 Potri.003G141000.2.v4.1 2943 2683.4 444 11.6845 Potri.016G087400.1.v4.1 270 67.515 1045 1093.02 Potri.015G069301.1.v4.1 564 308.281 0 0 Potri.010G195200.1.v4.1 1773 1513.4 224 10.4522 Potri.012G127500.1.v4.1 977 717.4 5401 531.649 ==> SRR7171862.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 157 SRR7171862 completed mapping pipeline successfully