Starting /dee2/code/volunteer_pipeline.sh SRR7171863 current disk space = 3088442068992 free memory = 1453841396 SRR7171863 SRAfilesize 93fb5e9c5435f63973c3a723307b4280 SRR7171863.sra SRR7171863.sra file validated SRR7171863 is paired end SRR7171863 is conventional basespace SRR7171863 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171863_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7185 33.0 33.0 34.0 32.0 34.0 2 33.17925 34.0 33.0 34.0 33.0 34.0 3 32.33975 33.0 32.0 33.0 31.0 34.0 4 32.10275 33.0 33.0 33.0 31.0 34.0 5 32.75325 33.0 33.0 33.0 32.0 34.0 6 36.21675 38.0 36.0 38.0 33.0 38.0 7 37.03775 38.0 37.0 38.0 35.0 38.0 8 36.904 38.0 38.0 38.0 35.0 38.0 9 37.42275 38.0 38.0 38.0 37.0 38.0 10-14 37.5277 38.0 38.0 38.0 37.2 38.0 15-19 37.562749999999994 38.0 38.0 38.0 37.2 38.0 20-24 37.5706 38.0 38.0 38.0 37.8 38.0 25-29 37.56755 38.0 38.0 38.0 38.0 38.0 30-34 37.5291 38.0 38.0 38.0 37.4 38.0 35-39 37.55035 38.0 38.0 38.0 37.6 38.0 40-44 37.5095 38.0 38.0 38.0 37.4 38.0 45-49 37.48045 38.0 38.0 38.0 37.0 38.0 50-54 37.4576 38.0 38.0 38.0 37.0 38.0 55-59 37.364599999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.3098 38.0 38.0 38.0 36.8 38.0 65-69 37.26649999999999 38.0 38.0 38.0 36.2 38.0 70-74 37.176500000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.20035 38.0 38.0 38.0 36.0 38.0 80-84 37.1107 38.0 38.0 38.0 36.0 38.0 85-89 37.0475 38.0 38.0 38.0 36.0 38.0 90-94 36.93855 38.0 38.0 38.0 35.2 38.0 95-99 36.858850000000004 38.0 38.0 38.0 35.2 38.0 100-104 36.68059999999999 38.0 38.0 38.0 34.4 38.0 105-109 36.645 38.0 38.0 38.0 34.2 38.0 110-114 36.2899 38.0 37.4 38.0 34.0 38.0 115-119 36.199349999999995 38.0 37.2 38.0 33.6 38.0 120-124 36.0754 38.0 37.0 38.0 32.8 38.0 125-129 36.047200000000004 38.0 37.0 38.0 33.0 38.0 130-134 35.68805 38.0 36.2 38.0 31.8 38.0 135-139 35.43275 38.0 36.0 38.0 31.0 38.0 140-144 35.103500000000004 38.0 35.6 38.0 28.8 38.0 145-149 34.60735 38.0 35.0 38.0 28.0 38.0 150-151 31.708 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 3.0 19 1.0 20 2.0 21 4.0 22 2.0 23 6.0 24 1.0 25 7.0 26 9.0 27 12.0 28 15.0 29 19.0 30 30.0 31 35.0 32 62.0 33 87.0 34 128.0 35 274.0 36 703.0 37 2595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.824999999999996 14.374999999999998 13.600000000000001 34.2 2 22.175 18.15 34.575 25.1 3 20.7 24.099999999999998 26.75 28.449999999999996 4 21.875 31.7 22.375 24.05 5 21.025 33.75 25.6 19.625 6 17.175 35.925000000000004 26.275 20.625 7 13.425 23.599999999999998 44.7 18.275 8 18.675 23.95 30.325000000000003 27.05 9 17.8 24.65 31.55 26.0 10-14 19.06 30.495 27.21 23.235 15-19 19.88 28.634999999999998 28.544999999999998 22.939999999999998 20-24 19.8 28.78 28.09 23.330000000000002 25-29 19.855 28.875 27.810000000000002 23.46 30-34 19.56 28.67 27.845 23.925 35-39 20.18 28.68 27.875 23.265 40-44 19.77 29.28 27.625 23.325000000000003 45-49 19.715 28.275 28.095 23.915 50-54 19.84 28.794999999999998 28.050000000000004 23.315 55-59 19.925 28.360000000000003 27.79 23.925 60-64 19.91 28.720000000000002 27.255000000000003 24.115000000000002 65-69 20.075000000000003 28.725 27.92 23.28 70-74 20.09 28.555000000000003 27.825 23.53 75-79 19.915 28.084999999999997 27.865000000000002 24.135 80-84 20.525 28.199999999999996 27.975 23.3 85-89 20.46 28.315 27.500000000000004 23.724999999999998 90-94 19.56 28.79 27.544999999999998 24.104999999999997 95-99 20.064999999999998 28.505000000000003 28.075 23.355 100-104 20.345 28.345 27.815 23.494999999999997 105-109 20.055 28.360000000000003 27.79 23.794999999999998 110-114 20.325 27.950000000000003 28.15 23.575 115-119 20.645 28.49 27.82 23.044999999999998 120-124 20.285 28.175 27.650000000000002 23.89 125-129 20.555 28.139999999999997 27.725 23.580000000000002 130-134 20.61 28.449999999999996 27.195000000000004 23.745 135-139 20.665 27.74 27.200000000000003 24.395 140-144 20.96 28.37 27.38 23.29 145-149 21.29 28.03 27.215 23.465 150-151 20.974999999999998 27.2625 27.237499999999997 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 1.0 21 1.5 22 0.5 23 0.5 24 0.5 25 3.5 26 7.0 27 7.0 28 11.0 29 15.5 30 21.5 31 26.5 32 35.0 33 53.0 34 62.0 35 81.0 36 103.0 37 115.5 38 136.5 39 155.0 40 182.5 41 224.5 42 253.0 43 270.5 44 276.0 45 271.0 46 255.0 47 243.0 48 227.0 49 201.0 50 175.5 51 134.5 52 99.5 53 86.5 54 72.0 55 48.5 56 37.0 57 26.5 58 20.5 59 18.5 60 10.0 61 6.0 62 3.5 63 2.0 64 3.5 65 2.0 66 1.0 67 3.5 68 3.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.6375000000000002 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.4625 0.0 0.0 0.0 0.0 126-127 2.6500000000000004 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.3375 0.0 0.0 0.0 0.0 132-133 3.7 0.0 0.0 0.0 0.0 134-135 3.9625000000000004 0.0 0.0 0.0 0.0 136-137 4.2375 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATATCC 10 0.006830828 145.0 3 >>END_MODULE SRR7171863 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171863_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04225 33.0 33.0 34.0 32.0 34.0 2 33.09275 34.0 33.0 34.0 32.0 34.0 3 33.1545 34.0 33.0 34.0 33.0 34.0 4 33.0995 34.0 33.0 34.0 33.0 34.0 5 33.10475 34.0 33.0 34.0 33.0 34.0 6 37.32125 38.0 38.0 38.0 37.0 38.0 7 37.271 38.0 38.0 38.0 37.0 38.0 8 37.24575 38.0 38.0 38.0 37.0 38.0 9 37.2425 38.0 38.0 38.0 37.0 38.0 10-14 37.1909 38.0 38.0 38.0 36.8 38.0 15-19 37.2038 38.0 38.0 38.0 37.0 38.0 20-24 37.2318 38.0 38.0 38.0 37.0 38.0 25-29 37.18489999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.1526 38.0 38.0 38.0 37.0 38.0 35-39 36.79795 38.0 38.0 38.0 36.2 38.0 40-44 36.68315 38.0 38.0 38.0 36.0 38.0 45-49 37.0019 38.0 38.0 38.0 36.2 38.0 50-54 36.96865 38.0 38.0 38.0 36.2 38.0 55-59 36.99425 38.0 38.0 38.0 36.2 38.0 60-64 36.91495 38.0 38.0 38.0 36.0 38.0 65-69 36.88074999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.77735 38.0 38.0 38.0 36.0 38.0 75-79 36.72255 38.0 38.0 38.0 35.4 38.0 80-84 36.6997 38.0 38.0 38.0 35.6 38.0 85-89 36.49315 38.0 38.0 38.0 34.6 38.0 90-94 36.4547 38.0 38.0 38.0 34.4 38.0 95-99 36.3363 38.0 38.0 38.0 34.0 38.0 100-104 36.181599999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.01415 38.0 37.4 38.0 33.4 38.0 110-114 35.91665 38.0 37.2 38.0 33.2 38.0 115-119 35.801300000000005 38.0 37.2 38.0 32.6 38.0 120-124 35.491499999999995 38.0 36.6 38.0 31.4 38.0 125-129 35.357299999999995 38.0 36.4 38.0 30.8 38.0 130-134 35.1222 38.0 36.0 38.0 29.8 38.0 135-139 34.8306 38.0 35.6 38.0 28.0 38.0 140-144 34.5501 38.0 35.0 38.0 27.2 38.0 145-149 34.03375 38.0 34.6 38.0 24.4 38.0 150-151 30.637375 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 2.0 5 4.0 6 2.0 7 0.0 8 0.0 9 4.0 10 1.0 11 3.0 12 4.0 13 7.0 14 2.0 15 3.0 16 5.0 17 5.0 18 2.0 19 1.0 20 6.0 21 1.0 22 6.0 23 6.0 24 8.0 25 8.0 26 15.0 27 20.0 28 23.0 29 25.0 30 38.0 31 51.0 32 61.0 33 96.0 34 145.0 35 251.0 36 644.0 37 2542.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.725 16.45 17.8 27.025 2 23.65 24.05 34.2 18.099999999999998 3 21.5 28.025 28.975 21.5 4 24.925 35.35 21.6 18.125 5 25.4 36.449999999999996 20.625 17.525 6 19.25 37.275000000000006 24.675 18.8 7 18.85 19.05 41.0 21.099999999999998 8 21.8 24.075 27.150000000000002 26.974999999999998 9 22.6 25.15 29.349999999999998 22.900000000000002 10-14 22.96 28.62 26.840000000000003 21.58 15-19 23.57 27.655 28.249999999999996 20.525 20-24 23.78 29.07 27.11 20.04 25-29 23.205000000000002 28.92 27.560000000000002 20.315 30-34 22.8943415122684 28.257386079118678 27.70155232849274 21.14672008012018 35-39 23.184751916095202 28.55990318676886 27.5363049616781 20.719039935457843 40-44 23.636271887773123 28.31407377504163 27.09794620780138 20.95170812938386 45-49 23.43 28.715000000000003 27.310000000000002 20.544999999999998 50-54 23.735 28.27 27.305 20.69 55-59 23.085 28.060000000000002 27.68 21.175 60-64 23.22 28.845 26.790000000000003 21.145 65-69 23.945 28.535 27.205000000000002 20.315 70-74 23.565 28.439999999999998 27.37 20.625 75-79 24.044999999999998 27.6 27.985 20.369999999999997 80-84 23.794999999999998 28.189999999999998 27.450000000000003 20.565 85-89 23.76 27.965 27.88 20.395 90-94 23.615 27.67 28.155 20.560000000000002 95-99 23.75 27.435 27.605 21.21 100-104 23.66 28.57 27.395000000000003 20.375 105-109 23.93 27.775 28.175 20.119999999999997 110-114 23.94 27.665 27.68 20.715 115-119 23.905 28.505000000000003 27.875 19.715 120-124 24.224999999999998 28.505000000000003 27.889999999999997 19.38 125-129 23.855 28.16 28.03 19.955000000000002 130-134 24.345 28.485 27.205000000000002 19.965 135-139 24.525 28.525 27.21 19.74 140-144 24.755 28.16 27.55 19.535 145-149 25.22 27.77 27.529999999999998 19.48 150-151 24.349999999999998 28.5875 27.8625 19.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 2.5 24 4.0 25 3.5 26 3.0 27 5.0 28 6.0 29 8.5 30 14.5 31 15.0 32 22.5 33 33.0 34 39.5 35 51.0 36 74.5 37 90.0 38 118.0 39 161.5 40 202.5 41 242.5 42 267.0 43 280.0 44 293.5 45 300.5 46 291.0 47 250.5 48 229.5 49 210.0 50 167.5 51 137.0 52 114.5 53 98.0 54 71.5 55 51.5 56 37.0 57 25.0 58 16.0 59 14.5 60 11.0 61 5.0 62 4.5 63 6.0 64 6.0 65 4.0 66 1.5 67 1.0 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.15 35-39 0.84 40-44 0.915 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.6375000000000002 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.3875 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.0125 0.0 0.0 0.0 0.0 136-137 4.3 0.0 0.0 0.0 0.0 138-139 4.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGCAT 10 0.0068803662 144.65 1 TGAGCAG 10 0.0068803662 144.65 4 AGGTCCA 20 3.62237E-4 108.487495 4 >>END_MODULE Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546228 spots for SRR7171863.sra Written 546228 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra Read 546220 spots for SRR7171863.sra Written 546220 spots for SRR7171863.sra SRR ids: ['SRR7171863.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mggttwxn SRR7171863.sra spots: 10924408 blocks: [[1, 546220], [546221, 1092440], [1092441, 1638660], [1638661, 2184880], [2184881, 2731100], [2731101, 3277320], [3277321, 3823540], [3823541, 4369760], [4369761, 4915980], [4915981, 5462200], [5462201, 6008420], [6008421, 6554640], [6554641, 7100860], [7100861, 7647080], [7647081, 8193300], [8193301, 8739520], [8739521, 9285740], [9285741, 9831960], [9831961, 10378180], [10378181, 10924408]] SRR7171863 file size 3680223 SRR7171863 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171863 SRR7171863_1.fastq SRR7171863_2.fastq Input file: SRR7171863_1.fastq Paired file: SRR7171863_2.fastq trimmed: SRR7171863-trimmed-pair1.fastq, SRR7171863-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:44:19 2025 >> started Thu Feb 13 21:44:32 2025 >> done (12.467s) 10924408 read pairs processed; of these: 16862 ( 0.15%) short read pairs filtered out after trimming by size control 14507 ( 0.13%) empty read pairs filtered out after trimming by size control 10893039 (99.71%) read pairs available; of these: 4597877 (42.21%) trimmed read pairs available after processing 6295162 (57.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 4 0.00% 21 6 0.00% 22 8 0.00% 23 1 0.00% 24 3 0.00% 25 7 0.00% 26 2 0.00% 27 2 0.00% 28 4 0.00% 29 4 0.00% 30 6 0.00% 31 3 0.00% 32 6 0.00% 33 7 0.00% 34 6 0.00% 35 4 0.00% 36 2 0.00% 37 7 0.00% 38 7 0.00% 39 5 0.00% 40 6 0.00% 41 11 0.00% 42 5 0.00% 43 10 0.00% 44 4 0.00% 45 11 0.00% 46 4 0.00% 47 15 0.00% 48 13 0.00% 49 19 0.00% 50 25 0.00% 51 30 0.00% 52 26 0.00% 53 27 0.00% 54 37 0.00% 55 35 0.00% 56 29 0.00% 57 56 0.00% 58 36 0.00% 59 72 0.00% 60 56 0.00% 61 45 0.00% 62 86 0.00% 63 100 0.00% 64 99 0.00% 65 136 0.00% 66 122 0.00% 67 148 0.00% 68 162 0.00% 69 176 0.00% 70 206 0.00% 71 265 0.00% 72 292 0.00% 73 296 0.00% 74 339 0.00% 75 463 0.00% 76 510 0.00% 77 577 0.01% 78 594 0.01% 79 682 0.01% 80 802 0.01% 81 908 0.01% 82 975 0.01% 83 1192 0.01% 84 2005 0.02% 85 2575 0.02% 86 2748 0.03% 87 3107 0.03% 88 3197 0.03% 89 3314 0.03% 90 3531 0.03% 91 3530 0.03% 92 3842 0.04% 93 4111 0.04% 94 4357 0.04% 95 4457 0.04% 96 4880 0.04% 97 5172 0.05% 98 5434 0.05% 99 5979 0.05% 100 6233 0.06% 101 6512 0.06% 102 7221 0.07% 103 7436 0.07% 104 8144 0.07% 105 8634 0.08% 106 9227 0.08% 107 9509 0.09% 108 9799 0.09% 109 10587 0.10% 110 10937 0.10% 111 11869 0.11% 112 12516 0.11% 113 13217 0.12% 114 14146 0.13% 115 14664 0.13% 116 15306 0.14% 117 15742 0.14% 118 16428 0.15% 119 16996 0.16% 120 17794 0.16% 121 18566 0.17% 122 19188 0.18% 123 20267 0.19% 124 20994 0.19% 125 22010 0.20% 126 23037 0.21% 127 23902 0.22% 128 25171 0.23% 129 25857 0.24% 130 26966 0.25% 131 28178 0.26% 132 29686 0.27% 133 31416 0.29% 134 32924 0.30% 135 34405 0.32% 136 36413 0.33% 137 39042 0.36% 138 41338 0.38% 139 44057 0.40% 140 47257 0.43% 141 51939 0.48% 142 56240 0.52% 143 63922 0.59% 144 73665 0.68% 145 86683 0.80% 146 108512 1.00% 147 148619 1.36% 148 229942 2.11% 149 465416 4.27% 150 2407309 22.10% 151 6295162 57.79% 10893039 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=5.62 fanout-score-rank=16 prefix-density=0.61 prefix-fanout=3.1 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=23.75 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=4.1 sequence=ATCTCCTTCCAGGCCAGTGAGAGCCAGTGTGTTCTTTTCTTCATCCACTACCACCTTCTCTTTAAAGA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=32 prefix-density=0.44 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=31.41 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.9 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171863 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:45:23 Started mapping on | Feb 13 21:45:23 Finished on | Feb 13 21:47:12 Mapping speed, Million of reads per hour | 359.77 Number of input reads | 10893039 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10054727 Uniquely mapped reads % | 92.30% Average mapped length | 295.38 Number of splices: Total | 9678243 Number of splices: Annotated (sjdb) | 9469281 Number of splices: GT/AG | 9514758 Number of splices: GC/AG | 126589 Number of splices: AT/AC | 7527 Number of splices: Non-canonical | 29369 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255345 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 39656 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.91% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 597923 597923 597923 N_multimapping 255345 255345 255345 N_noFeature 281591 9956915 326316 N_ambiguous 107286 511 54032 UnstrandedReadsAssigned:9665850 PositiveStrandReadsAssigned:97301 NegativeStrandReadsAssigned:9674379 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171863 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171863-trimmed-pair1.fastq SRR7171863-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,893,039 reads, 9,613,084 reads pseudoaligned [quant] estimated average fragment length: 242.562 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7171863.ke.tsv 34699 SRR7171863.se.tsv 87100 total ==> SRR7171863.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.44 797 42.3283 Potri.005G024800.1.v4.1 1035 793.438 190 22.5924 Potri.004G059700.1.v4.1 961 719.458 8 1.04908 Potri.007G009000.2.v4.1 1416 1174.44 0 0 Potri.003G141000.2.v4.1 2943 2701.44 385.167 13.4517 Potri.016G087400.1.v4.1 270 74.4869 636 805.563 Potri.015G069301.1.v4.1 564 325.001 0 0 Potri.010G195200.1.v4.1 1773 1531.44 293.736 18.0959 Potri.012G127500.1.v4.1 977 735.453 10059 1290.39 ==> SRR7171863.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 383 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 195 SRR7171863 completed mapping pipeline successfully