Starting /dee2/code/volunteer_pipeline.sh SRR7171864 current disk space = 3088585211904 free memory = 1557708132 SRR7171864 SRAfilesize ef416fa62d43503a4e80dfccf1fb9888 SRR7171864.sra SRR7171864.sra file validated SRR7171864 is paired end SRR7171864 is conventional basespace SRR7171864 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171864_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.62125 32.0 18.0 33.0 18.0 33.0 2 27.39325 29.0 25.0 31.0 18.0 33.0 3 30.199 31.0 29.0 33.0 27.0 33.0 4 31.74625 33.0 31.0 33.0 29.0 33.0 5 32.40025 33.0 33.0 33.0 32.0 34.0 6 36.511 38.0 36.0 38.0 34.0 38.0 7 37.189 38.0 38.0 38.0 36.0 38.0 8 37.40875 38.0 38.0 38.0 37.0 38.0 9 37.50175 38.0 38.0 38.0 37.0 38.0 10-14 37.5306 38.0 38.0 38.0 37.2 38.0 15-19 37.58145 38.0 38.0 38.0 37.8 38.0 20-24 37.53335 38.0 38.0 38.0 37.2 38.0 25-29 37.5037 38.0 38.0 38.0 37.2 38.0 30-34 37.4817 38.0 38.0 38.0 37.0 38.0 35-39 37.4281 38.0 38.0 38.0 37.0 38.0 40-44 37.387350000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.322050000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.2824 38.0 38.0 38.0 37.0 38.0 55-59 37.2204 38.0 38.0 38.0 36.2 38.0 60-64 37.1472 38.0 38.0 38.0 36.0 38.0 65-69 37.0779 38.0 38.0 38.0 36.0 38.0 70-74 37.02655 38.0 38.0 38.0 36.0 38.0 75-79 36.9288 38.0 38.0 38.0 35.6 38.0 80-84 36.84035 38.0 38.0 38.0 35.4 38.0 85-89 36.81995 38.0 38.0 38.0 35.2 38.0 90-94 36.658049999999996 38.0 38.0 38.0 34.4 38.0 95-99 36.57875 38.0 38.0 38.0 34.2 38.0 100-104 36.3818 38.0 37.8 38.0 34.0 38.0 105-109 36.29665 38.0 37.8 38.0 34.0 38.0 110-114 36.16115 38.0 37.0 38.0 33.4 38.0 115-119 35.927099999999996 38.0 37.0 38.0 32.6 38.0 120-124 35.752250000000004 38.0 36.8 38.0 31.8 38.0 125-129 35.623799999999996 38.0 36.4 38.0 31.4 38.0 130-134 35.25605 38.0 36.0 38.0 30.0 38.0 135-139 34.983450000000005 38.0 35.6 38.0 28.2 38.0 140-144 34.504000000000005 38.0 35.0 38.0 26.6 38.0 145-149 34.10260000000001 38.0 35.0 38.0 24.8 38.0 150-151 31.041874999999997 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 2.0 16 2.0 17 0.0 18 3.0 19 4.0 20 3.0 21 7.0 22 7.0 23 7.0 24 7.0 25 14.0 26 14.0 27 20.0 28 20.0 29 27.0 30 37.0 31 46.0 32 60.0 33 99.0 34 154.0 35 293.0 36 831.0 37 2338.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.77722152690863 15.819774718397998 10.362953692115145 32.040050062578224 2 20.025000000000002 18.224999999999998 35.449999999999996 26.3 3 18.375 23.05 28.65 29.925 4 21.6 31.7 23.974999999999998 22.725 5 22.900000000000002 31.85 24.9 20.349999999999998 6 19.825 34.050000000000004 24.75 21.375 7 14.575 24.375 42.699999999999996 18.35 8 18.15 24.675 29.799999999999997 27.375 9 17.875 22.925 33.324999999999996 25.874999999999996 10-14 19.375 29.885 27.034999999999997 23.705000000000002 15-19 19.335 28.655 28.515 23.494999999999997 20-24 20.57 28.32 27.800000000000004 23.31 25-29 19.905 28.694999999999997 27.839999999999996 23.56 30-34 19.744999999999997 28.439999999999998 28.305000000000003 23.51 35-39 19.89 28.555000000000003 28.155 23.400000000000002 40-44 19.855 27.800000000000004 29.035 23.31 45-49 19.939999999999998 28.59 27.41 24.060000000000002 50-54 20.285 28.435 28.244999999999997 23.035 55-59 20.105 28.305000000000003 27.87 23.72 60-64 19.575 28.54 28.08 23.805 65-69 20.395 28.705000000000002 27.800000000000004 23.1 70-74 20.135 28.715000000000003 27.955000000000002 23.195 75-79 20.345 28.455000000000002 27.83 23.369999999999997 80-84 20.465 28.610000000000003 27.655 23.27 85-89 20.45 27.825 28.395 23.330000000000002 90-94 19.895 28.375 27.92 23.810000000000002 95-99 20.06 28.24 28.1 23.599999999999998 100-104 21.035 28.42 27.235 23.31 105-109 20.175 28.185 28.015 23.625 110-114 20.765 28.335 28.084999999999997 22.814999999999998 115-119 20.72 28.15 27.55 23.580000000000002 120-124 20.955 28.025 27.595 23.425 125-129 20.585 28.000000000000004 27.955000000000002 23.46 130-134 20.74 28.4 27.615000000000002 23.244999999999997 135-139 20.625 28.13 27.675 23.57 140-144 20.765 27.685 27.51 24.04 145-149 21.145 27.994999999999997 27.29 23.57 150-151 21.4 27.762500000000003 27.5625 23.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 4.0 26 5.0 27 7.5 28 11.0 29 12.0 30 18.0 31 23.5 32 34.5 33 48.5 34 56.5 35 71.0 36 94.5 37 123.0 38 134.5 39 161.5 40 210.0 41 232.5 42 252.5 43 272.5 44 263.5 45 273.5 46 275.5 47 250.5 48 223.0 49 186.5 50 166.5 51 144.0 52 109.5 53 80.0 54 58.5 55 45.0 56 39.0 57 29.0 58 19.0 59 15.5 60 14.0 61 8.5 62 4.5 63 4.0 64 3.5 65 1.5 66 1.0 67 2.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.5125000000000002 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171864 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171864_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.974 33.0 33.0 34.0 32.0 34.0 2 33.052 34.0 33.0 34.0 32.0 34.0 3 33.14275 34.0 33.0 34.0 33.0 34.0 4 33.1235 34.0 33.0 34.0 33.0 34.0 5 33.0735 34.0 33.0 34.0 33.0 34.0 6 37.395 38.0 38.0 38.0 37.0 38.0 7 37.30525 38.0 38.0 38.0 37.0 38.0 8 37.18225 38.0 38.0 38.0 37.0 38.0 9 37.315 38.0 38.0 38.0 37.0 38.0 10-14 37.22495 38.0 38.0 38.0 37.0 38.0 15-19 37.15915 38.0 38.0 38.0 37.0 38.0 20-24 37.179199999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.17155 38.0 38.0 38.0 37.0 38.0 30-34 37.123900000000006 38.0 38.0 38.0 37.0 38.0 35-39 36.9636 38.0 38.0 38.0 36.6 38.0 40-44 36.71295 38.0 38.0 38.0 36.0 38.0 45-49 36.94115000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.96645 38.0 38.0 38.0 36.0 38.0 55-59 36.9031 38.0 38.0 38.0 36.0 38.0 60-64 36.814049999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.8088 38.0 38.0 38.0 36.0 38.0 70-74 36.68265 38.0 38.0 38.0 35.0 38.0 75-79 36.634249999999994 38.0 38.0 38.0 35.0 38.0 80-84 36.575649999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.38845 38.0 38.0 38.0 34.0 38.0 90-94 36.21495 38.0 38.0 38.0 34.0 38.0 95-99 36.23395 38.0 38.0 38.0 34.0 38.0 100-104 36.1301 38.0 37.8 38.0 33.6 38.0 105-109 35.92700000000001 38.0 37.4 38.0 33.0 38.0 110-114 35.64875 38.0 37.0 38.0 31.0 38.0 115-119 35.6119 38.0 37.0 38.0 31.0 38.0 120-124 35.48154999999999 38.0 36.4 38.0 31.0 38.0 125-129 35.1612 38.0 36.0 38.0 28.6 38.0 130-134 34.8194 38.0 35.6 38.0 27.6 38.0 135-139 34.5304 38.0 35.0 38.0 26.6 38.0 140-144 34.03335 38.0 35.0 38.0 23.0 38.0 145-149 33.4922 38.0 34.4 38.0 19.8 38.0 150-151 29.988875 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 3.0 5 1.0 6 1.0 7 2.0 8 2.0 9 0.0 10 2.0 11 2.0 12 0.0 13 4.0 14 1.0 15 3.0 16 5.0 17 4.0 18 5.0 19 6.0 20 3.0 21 3.0 22 6.0 23 12.0 24 13.0 25 18.0 26 16.0 27 21.0 28 23.0 29 26.0 30 40.0 31 58.0 32 81.0 33 117.0 34 148.0 35 283.0 36 683.0 37 2399.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.375 17.724999999999998 14.924999999999999 23.974999999999998 2 23.375 25.75 32.4 18.475 3 21.075 28.625 30.5 19.8 4 25.15 34.625 20.95 19.275000000000002 5 23.849999999999998 37.6 21.65 16.900000000000002 6 19.675 36.4 23.9 20.025000000000002 7 19.25 19.775000000000002 38.85 22.125 8 20.724999999999998 23.75 28.7 26.825 9 21.875 25.525 28.449999999999996 24.15 10-14 22.485 29.275000000000002 26.424999999999997 21.815 15-19 22.53 27.794999999999998 28.32 21.355 20-24 22.705000000000002 28.744999999999997 27.575 20.974999999999998 25-29 23.080000000000002 28.78 26.99 21.15 30-34 23.244999999999997 27.794999999999998 27.894999999999996 21.065 35-39 22.816265060240966 27.730923694779115 28.022088353413654 21.430722891566266 40-44 23.032319870922198 27.948368880149243 27.68113749810921 21.33817375081934 45-49 23.794999999999998 27.915 27.455000000000002 20.835 50-54 22.905 27.97 27.92 21.205 55-59 23.724999999999998 28.384999999999998 27.425 20.465 60-64 23.46 27.834999999999997 27.875 20.830000000000002 65-69 23.23 27.62 27.944999999999997 21.205 70-74 23.22 28.18 27.74 20.86 75-79 23.785 27.37 28.035 20.810000000000002 80-84 23.3 27.975 27.894999999999996 20.830000000000002 85-89 23.345 27.615000000000002 27.93 21.11 90-94 23.76 28.499999999999996 27.54 20.200000000000003 95-99 22.82 28.165000000000003 28.084999999999997 20.93 100-104 22.985 28.470000000000002 27.96 20.585 105-109 23.87 28.325 27.27 20.535 110-114 23.400000000000002 28.439999999999998 27.92 20.24 115-119 23.525 27.950000000000003 28.13 20.395 120-124 24.709999999999997 27.685 27.555000000000003 20.05 125-129 23.36 28.725 27.625 20.29 130-134 23.98 27.525 27.845 20.65 135-139 23.965 28.13 27.55 20.355 140-144 23.845 28.134999999999998 27.834999999999997 20.185 145-149 23.96 28.025 27.665 20.349999999999998 150-151 24.7375 27.287499999999998 28.3125 19.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 2.0 24 2.0 25 2.0 26 4.5 27 4.0 28 3.0 29 7.0 30 11.0 31 15.0 32 25.0 33 35.0 34 49.0 35 64.0 36 77.5 37 97.0 38 120.0 39 153.5 40 190.5 41 226.5 42 262.0 43 284.0 44 295.0 45 300.0 46 281.0 47 257.0 48 240.5 49 208.0 50 159.5 51 128.0 52 114.0 53 92.0 54 73.0 55 53.5 56 42.0 57 33.5 58 20.5 59 12.0 60 9.5 61 9.5 62 7.5 63 8.0 64 4.5 65 2.5 66 2.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.4 40-44 0.835 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64832956543582 99.175 2 0.27631248430042704 0.5499999999999999 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.025119316754584273 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 1.9874999999999998 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723736 spots for SRR7171864.sra Written 723736 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra Read 723725 spots for SRR7171864.sra Written 723725 spots for SRR7171864.sra SRR ids: ['SRR7171864.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hxwey7dd SRR7171864.sra spots: 14474511 blocks: [[1, 723725], [723726, 1447450], [1447451, 2171175], [2171176, 2894900], [2894901, 3618625], [3618626, 4342350], [4342351, 5066075], [5066076, 5789800], [5789801, 6513525], [6513526, 7237250], [7237251, 7960975], [7960976, 8684700], [8684701, 9408425], [9408426, 10132150], [10132151, 10855875], [10855876, 11579600], [11579601, 12303325], [12303326, 13027050], [13027051, 13750775], [13750776, 14474511]] SRR7171864 file size 4883236 SRR7171864 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171864 SRR7171864_1.fastq SRR7171864_2.fastq Input file: SRR7171864_1.fastq Paired file: SRR7171864_2.fastq trimmed: SRR7171864-trimmed-pair1.fastq, SRR7171864-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:09:34 2025 >> started Thu Feb 13 22:09:50 2025 >> done (15.553s) 14474511 read pairs processed; of these: 21213 ( 0.15%) short read pairs filtered out after trimming by size control 15009 ( 0.10%) empty read pairs filtered out after trimming by size control 14438289 (99.75%) read pairs available; of these: 5938609 (41.13%) trimmed read pairs available after processing 8499680 (58.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 8 0.00% 24 10 0.00% 25 4 0.00% 26 4 0.00% 27 6 0.00% 28 5 0.00% 29 4 0.00% 30 4 0.00% 31 5 0.00% 32 9 0.00% 33 7 0.00% 34 5 0.00% 35 6 0.00% 36 8 0.00% 37 5 0.00% 38 8 0.00% 39 10 0.00% 40 9 0.00% 41 6 0.00% 42 11 0.00% 43 9 0.00% 44 8 0.00% 45 13 0.00% 46 14 0.00% 47 12 0.00% 48 13 0.00% 49 14 0.00% 50 25 0.00% 51 19 0.00% 52 24 0.00% 53 35 0.00% 54 18 0.00% 55 31 0.00% 56 30 0.00% 57 56 0.00% 58 44 0.00% 59 51 0.00% 60 58 0.00% 61 74 0.00% 62 62 0.00% 63 70 0.00% 64 71 0.00% 65 91 0.00% 66 116 0.00% 67 134 0.00% 68 138 0.00% 69 146 0.00% 70 183 0.00% 71 185 0.00% 72 228 0.00% 73 274 0.00% 74 314 0.00% 75 312 0.00% 76 382 0.00% 77 427 0.00% 78 473 0.00% 79 534 0.00% 80 678 0.00% 81 769 0.01% 82 851 0.01% 83 979 0.01% 84 1968 0.01% 85 2534 0.02% 86 2653 0.02% 87 3105 0.02% 88 2936 0.02% 89 3087 0.02% 90 3242 0.02% 91 3406 0.02% 92 3482 0.02% 93 3716 0.03% 94 3812 0.03% 95 4147 0.03% 96 4526 0.03% 97 4908 0.03% 98 4883 0.03% 99 5336 0.04% 100 5586 0.04% 101 6157 0.04% 102 6469 0.04% 103 7003 0.05% 104 7564 0.05% 105 8102 0.06% 106 8354 0.06% 107 8946 0.06% 108 9259 0.06% 109 9954 0.07% 110 10510 0.07% 111 11470 0.08% 112 12027 0.08% 113 12653 0.09% 114 13481 0.09% 115 14317 0.10% 116 14821 0.10% 117 15693 0.11% 118 16411 0.11% 119 16803 0.12% 120 17967 0.12% 121 18522 0.13% 122 19859 0.14% 123 21006 0.15% 124 21957 0.15% 125 23171 0.16% 126 24284 0.17% 127 25415 0.18% 128 26240 0.18% 129 27731 0.19% 130 29035 0.20% 131 30456 0.21% 132 32974 0.23% 133 35268 0.24% 134 37132 0.26% 135 39457 0.27% 136 42094 0.29% 137 44968 0.31% 138 47934 0.33% 139 52258 0.36% 140 56950 0.39% 141 62550 0.43% 142 69597 0.48% 143 79191 0.55% 144 93680 0.65% 145 112260 0.78% 146 143005 0.99% 147 197376 1.37% 148 307187 2.13% 149 633049 4.38% 150 3284604 22.75% 151 8499680 58.87% 14438289 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=24 prefix-density=0.27 prefix-fanout=2.3 sequence=AGTTCATCTCAGACCTCTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=28 fanout-score=24.86 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=9.9 sequence=TCCAGCAATAGGAAAGATTGTCTCTTCTTTCCATTAATATGCCTTCGTAAGACTTGCATCGATATCTTTGGTAACAGTTATCATGAAATCCATGTACTTGTCTGG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.51 fanout-score-rank=14 prefix-density=0.50 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=100.16 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.5 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAG SRR7171864 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:10:39 Started mapping on | Feb 13 22:10:40 Finished on | Feb 13 22:12:34 Mapping speed, Million of reads per hour | 455.95 Number of input reads | 14438289 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13258280 Uniquely mapped reads % | 91.83% Average mapped length | 296.35 Number of splices: Total | 12776955 Number of splices: Annotated (sjdb) | 12475204 Number of splices: GT/AG | 12560005 Number of splices: GC/AG | 166201 Number of splices: AT/AC | 12168 Number of splices: Non-canonical | 38581 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 369918 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 68229 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.03% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 829227 829227 829227 N_multimapping 369918 369918 369918 N_noFeature 396136 13103944 487272 N_ambiguous 145363 1315 81171 UnstrandedReadsAssigned:12716781 PositiveStrandReadsAssigned:153021 NegativeStrandReadsAssigned:12689837 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171864 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171864-trimmed-pair1.fastq SRR7171864-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,438,289 reads, 12,598,162 reads pseudoaligned [quant] estimated average fragment length: 255.593 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7171864.ke.tsv 34699 SRR7171864.se.tsv 87100 total ==> SRR7171864.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.41 1687 75.4847 Potri.005G024800.1.v4.1 1035 780.407 186 18.8056 Potri.004G059700.1.v4.1 961 706.423 19 2.12219 Potri.007G009000.2.v4.1 1416 1161.41 0 0 Potri.003G141000.2.v4.1 2943 2688.41 484 14.2052 Potri.016G087400.1.v4.1 270 70.2062 576 647.356 Potri.015G069301.1.v4.1 564 313.844 0 0 Potri.010G195200.1.v4.1 1773 1518.41 483 25.0989 Potri.012G127500.1.v4.1 977 722.423 10585 1156.1 ==> SRR7171864.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 325 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 731 SRR7171864 completed mapping pipeline successfully